INVESTIGATING RNA INTERFERENCE AS A BIOPESTICIDE FOR
DENDROCTONUS PONDEROSAE
by
Cassandra D. Penfold
B.Sc. (Hons), University of Northern British Columbia, 2021

THESIS SUBMITTED IN PARTIAL FULFILLMENT OF
THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE
IN
NATURAL RESOURCES AND ENVIRONMENTAL STUDIES

UNIVERSITY OF NORTHERN BRITISH COLUMBIA
April 2025
© Cassandra D. Penfold, 2025

Abstract
In western North America, the mountain pine beetle (Dendroctonus ponderosae, MPB) is
the most destructive pest of pine trees, consequently causing ecological, economic, and socioecological impacts. Previous and current management techniques are ecologically and
economically costly, creating a need for a low-cost, ecologically safe method for MPB
population management. A molecular approach, RNA interference (RNAi), is being increasingly
applied to pest management strategies due to target specificity and low production costs. The
RNAi pathway is a naturally occurring anti-viral pathway that degrades invading genetic
material. When co-opted, the RNAi pathway can be used to silence targeted genes in insects by
disrupting cellular function. Developing RNAi to use in ecologically safe trap trees can create a
novel tool for managing MPB populations. Existing and new gene targets were tested using
microinjection (injection of dsRNA) and oral delivery methods for causing species-specific MPB
mortality. Oral delivery involved the use of both in vitro synthesized dsRNA and heatinactivated, hpRNA-expressing yeast delivered through direct feeding and association with pine
phloem. Success of RNAi initiation was determined using mortality observations alongside gene
expression analysis.
This study has identified promising gene targets and laboratory-based dsRNA delivery
methods for RNAi initiation in emerged adult MPB. This study has also provided new insights
into previously established dsRNA delivery methods. High mortality in all injected MPB
suggests that dsRNA microinjection is too invasive for emerged adult MPB, despite being a
successful delivery method in congeneric species. A previously successful method, submerging
MPB in dsRNA for twelve hours, elicited an RNAi response in four of the six gene targets.
However, the results were not replicated and showed variation between bioassays. To advance

ii

the laboratory-based delivery method and provide support for RNAi use in lethal trap trees, a
phloem-based dsRNA delivery method was also tested. Successful ingestion, high MPB survival
in controls, and some RNAi-induced mortality supports the use of phloem-based methods for
future RNAi assays in MPB. Lastly, an investigative transcriptome analysis confirmed the
presence of critical RNAi components and provided insights into the MPB response to the
different delivery methods. The submerged MPB mainly responded metabolically by breaking
down energy stores, and the phloem-fed MPB showed the opposite metabolic response by
creating energy stores. This analysis further supports the phloem-based dsRNA delivery for
future RNAi studies on MPB. Future RNAi studies in MPB should consider emergence timing
and its impact on MPB health to reduce the confounding factors affecting MPB mortality.

iii

Table of Contents

Abstract ....................................................................................................................................... ii
Table of Contents ....................................................................................................................... iv
List of Tables............................................................................................................................... x
List of Figures .......................................................................................................................... xiii
Acknowledgements .................................................................................................................. xix
Chapter 1 - Introduction .................................................................................................................. 1
1.1 Mountain pine beetle biology and management ................................................................... 2
1.1.1 Mountain pine beetle life cycle and host attack ............................................................. 2
1.1.2 Mountain pine beetle outbreak dynamics ....................................................................... 3
1.1.3 Mountain pine beetle range expansion ........................................................................... 4
1.1.4 Impacts of the mountain pine beetle ............................................................................... 6
1.1.5 Mountain Pine Beetle Management Methods ................................................................ 8
1.2 Mountain pine beetle population genetics and structure ..................................................... 10
1.2.1 History of the taxonomic organization of the MPB species ......................................... 10
1.2.2 Genetic Variation among Mountain Pine Beetle Populations ...................................... 11
1.3 RNA interference (RNAi) use and limitations .................................................................... 12
1.3.1 Gene expression analysis .............................................................................................. 12
1.3.2 Ribonucleic acid interference (RNAi) .......................................................................... 13
1.3.3 Transcriptome analyses have discovered and identified RNAi pathway components in
insect species ......................................................................................................................... 16
1.3.4 Species-specificity of RNAi ......................................................................................... 16
1.3.5 Limitations of RNAi ..................................................................................................... 18
1.3.6 RNAi success in species closely related to MPB ......................................................... 22
1.4

Proposed research ........................................................................................................... 22

Chapter 2 - Use and evaluation of microinjection as a delivery method for target dsRNA to
initiate the RNAi pathway and test novel gene targets on emerged adult Dendroctonus
ponderosae. ................................................................................................................................... 25
2.1 Introduction ......................................................................................................................... 25
2.2 Methods ............................................................................................................................... 29
2.2.1 Subject collection ......................................................................................................... 29
iv

2.2.2 Gene target dsRNA ....................................................................................................... 31
2.2.3 Microinjection Delivery Trial Method ......................................................................... 32
2.2.4 Microinjection to Test Six Targets on Emerged Adult Mountain Pine Beetles (2022) 33
2.2.5 Repetition of Microinjection to Test Six Targets on Emerged Adult Mountain Pine
Beetles (2023) ........................................................................................................................ 34
2.2.6 Mountain Pine Beetle Microinjection iap Kill Curve .................................................. 35
2.2.7 Microinjection of Douglas-fir Beetles, an Off-target Species, with Mountain Pine
Beetle Targets ........................................................................................................................ 36
2.2.8 Gene expression analysis .............................................................................................. 37
2.3 Results ................................................................................................................................. 43
2.3.1 Microinjection Trial ...................................................................................................... 43
2.3.2 Six targets on emerged MPB adults (2022) .................................................................. 43
2.3.3 Six targets on emerged MPB adults (2023) .................................................................. 45
2.3.4 MPB iap Kill Curve...................................................................................................... 47
2.3.5 Microinjection of Douglas-fir Beetles, an Off-target Species, with Mountain Pine
Beetle Targets ........................................................................................................................ 48
2.4 Discussion ........................................................................................................................... 50
2.4.1 Microinjection Trial: needle selection .......................................................................... 50
2.4.2 Mountain pine beetle microinjections .......................................................................... 50
2.4.3 Increased dosage of dsRNA showed similar responses to previous assays ................. 53
2.4.4 Microinjection of DFB with MPB targets elicits mortality in negative control and
target dsRNA groups. ............................................................................................................ 54
2.4.5 Feasibility of microinjection as a delivery method for MPB ....................................... 55
2.5 Conclusion........................................................................................................................... 58
Chapter 3 - Testing novel targets for RNAi-mediated gene suppression and mortality in emerged
adult Dendroctonus ponderosae via oral delivery. ....................................................................... 59
3.1 Introduction ......................................................................................................................... 59
3.2 Methods ............................................................................................................................... 64
3.2.1 Subject Collection......................................................................................................... 64
3.2.2 Sucrose Bioassay – Method Test .................................................................................. 64
3.2.3 Blue-dyed Sucrose Bioassay ........................................................................................ 65
3.2.4 Submergence Trial – feeding status.............................................................................. 66
3.2.5 Submergence target dsRNA Assay............................................................................... 67
3.2.6 Female Submergence Assay ......................................................................................... 68
v

3.2.7 Male Submergence Assays ........................................................................................... 68
3.2.8 Submergence Assay to test three targets on emerged adult mountain pine beetle (2024)
............................................................................................................................................... 69
3.2.9 Gene Expression Methods ............................................................................................ 70
3.3 Results ................................................................................................................................. 73
3.3.1 Sucrose bioassay test .................................................................................................... 73
3.3.2 Blue-dyed sucrose bioassay test and feeding status results .......................................... 73
3.3.3. Impact of feeding status on target liquid uptake......................................................... 73
3.3.4 Submergence target dsRNA Assay – Six targets (2022) .............................................. 73
3.3.4.1 Gene expression analysis: Submergence target dsRNA Assay – Six targets (2022) 74
3.3.5 Female Submergence Assay ......................................................................................... 76
3.3.5.1 Gene expression analysis: Female submergence assay – 2023 ................................. 77
3.3.6 Male Submergence Assays ........................................................................................... 78
3.3.6.1 Gene expression analysis: Male submergence assay – 2023 ..................................... 79
3.3.7 Submergence assay testing three targets on emerged adult mountain pine beetle (2024)
............................................................................................................................................... 80
3.3.7.1 Gene expression analysis - submergence assay testing three targets on emerged
female adult mountain pine beetle (FS24) ............................................................................. 82
3.3.7.1.1 Relative iap gene expression .................................................................................. 82
3.3.7.1.2 Relative vha19 gene expression ............................................................................. 84
3.3.7.1.3 Relative mesh gene expression ............................................................................... 86
3.4 Discussion ........................................................................................................................... 89
3.4.1 Submergence is the optimal method for orally delivering liquid to adult MPB........... 89
3.4.2 Successful RNAi initiation in four of six gene targets ................................................. 90
3.4.3 Absence of an RNAi response when submerging adult female mountain pine beetles in
hpRNA-expressing yeast solutions........................................................................................ 92
3.4.4 No RNAi initiation when submerging adult male mountain pine beetles in hpRNAexpressing yeast solutions ..................................................................................................... 95
3.4.5 Successful RNAi initiation in female adult mountain pine beetles submerged in in vitro
dsRNA with gene expression quantified at consecutive time points..................................... 96
3.4.5.1 RNAi-mediated iap suppression ................................................................................ 97
3.4.5.2 RNAi-mediated vha19 suppression ........................................................................... 97
3.4.5.3 Delayed response in adult female MPB to dsMESH delivery................................... 98
3.4.6 dsRNA uptake success.................................................................................................. 99
vi

3.5 Conclusion......................................................................................................................... 101
Chapter 4 - Investigating the effectiveness of delivering heat-inactivated, hpRNA-expressing
yeast through phloem to adult mountain pine beetles. ................................................................ 102
4.1 Introduction ....................................................................................................................... 102
4.2 Methods ............................................................................................................................. 106
4.2.1 Subject Collection....................................................................................................... 106
4.2.2 Ground Phloem Feeding Trails................................................................................... 106
4.2.3 Phloem home feeding trials ........................................................................................ 109
4.2.4 Gene expression analysis ............................................................................................ 116
4.3 Results ............................................................................................................................... 117
4.3.1 Phloem Preparation and Feeding Trial Results .......................................................... 117
4.3.2 Mortality of MPB fed dsRNA-soaked ground phloem .............................................. 117
4.3.3 Translocation trials ..................................................................................................... 118
4.3.4 Phloem home trial ....................................................................................................... 120
4.3.5 Phloem home – yeast solutions painted on phloem (PHP) ......................................... 121
4.3.6 Phloem home – translocated yeast solutions through the phloem (PHT)................... 125
4.3.7 Phloem home – phloem soaked in yeast solutions (PHS) .......................................... 127
4.4 Discussion ......................................................................................................................... 130
4.4.1. Phloem entices target liquid ingestion by MPB ........................................................ 130
4.4.2 Phloem homes show phloem ingestion and high survival .......................................... 130
4.4.3 Successful dsRNA translocation through lodgepole pine .......................................... 131
4.4.4 No RNAi in dsRNA-expressing yeast translocated or soaked phloem home ............ 131
4.4.5 No RNAi initiation in dsRNA-expressing yeast solution painted on phloem home
(PHP) assay.......................................................................................................................... 132
4.4.6. General absence of response in adult MPB to dsRNA-expressing, heat-inactivated
yeast ..................................................................................................................................... 135
4.5 Conclusion......................................................................................................................... 138
Chapter 5 Preliminary transcriptomic analysis comparing negative controls to one another within
each of the three dsRNA/hpRNA delivery methods to investigate the genomic response of adult
MPB. ........................................................................................................................................... 139
5.1 Introduction ....................................................................................................................... 139
5.2 Methods ............................................................................................................................. 143
5.2.1 Sample Preparation ..................................................................................................... 143
5.2.2. 3’Tag-Seq Library Preparation and Sequencing ....................................................... 143
vii

5.2.3 Differential Gene Expression (DGE) Analysis .......................................................... 144
5.2.4 Annotation and Gene Ontology of DGE results ......................................................... 144
5.3 Results ............................................................................................................................... 146
5.3.1 Sample Selection ........................................................................................................ 146
5.3.2 Differential Gene Expression analysis results ............................................................ 146
5.3.3. Gene ontology............................................................................................................ 149
5.4 Discussion ......................................................................................................................... 163
5.4.1 Presence of genes coding for critical RNAi machinery was confirmed in all MPB .. 163
5.4.2 No significant differential gene expression when adult MPB injected with compared to
no-injection controls ............................................................................................................ 164
5.4.3 Differentially expressed genes in the comparisons show similar response to dsRS and
dsIAP. .................................................................................................................................. 165
5.4.4 Differential gene expression indicates a genomic response in MPB when ingesting
phloem. ................................................................................................................................ 166
5.4.5 Submergence comparison gene ontology reveals unexpected gene regulation .......... 167
5.4.6 Phloem-fed gene ontology .......................................................................................... 171
5.5 Conclusion......................................................................................................................... 174
Chapter 6 – Discussion and Conclusion ..................................................................................... 175
6.1 General chapter conclusions.............................................................................................. 175
6.1.1 Chapter two summary: microinjection is too invasive for adult mountain pine beetles
............................................................................................................................................. 175
6.1.2 Chapter three summary: submergence irregularly elicits an RNAi response in
mountain pine beetles .......................................................................................................... 176
6.1.3 Chapter four summary: ingestion of phloem associated with dsRNA-expressing yeast
solutions shows promise for further testing ......................................................................... 178
6.1.4 Chapter five summary: identification of the metabolic processes involved in the
delivery methods provides support for future directions ..................................................... 178
6.2 Important factors to consider for MPB bioassays ............................................................. 180
6.2.1 Beetle emergence timing ............................................................................................ 180
6.2.2 Beetle sex in assays .................................................................................................... 181
6.2.3 Sample size ................................................................................................................. 183
6.3 Future Directions ............................................................................................................... 186
6.3.1 Gene targets ................................................................................................................ 186
6.3.2 Delivery method ......................................................................................................... 187
viii

6.4 Final remarks ..................................................................................................................... 188
Literature Cited ....................................................................................................................... 189
Appendix ................................................................................................................................. 206
Chapter 2.............................................................................................................................. 206
Chapter 3.............................................................................................................................. 210
Chapter 4.............................................................................................................................. 211
Chapter 5.............................................................................................................................. 212

ix

List of Tables
Table 2.1 Information on the long dsRNA synthesized to target six essential genes in mountain
pine beetle (Dendroctonus ponderosae). ....................................................................................... 31
Table 2.2 Primer and probe sequences for target genes and reference genes used in digital droplet
PCR (ddPCR) for expression analysis in adult mountain pine beetles (Dendroctonus ponderosae,
MPB) after dsRNA exposure. ....................................................................................................... 39
Table 3.1 Brief summary of the submergence assay methods performed on emerged adult
mountain pine beetles (Dendroctonus ponderosae, MPB) in this study. ..................................... 70
Table 4.1 A tally of the best uptake success among the different trials (determined by the
presence or absence of blue dye in MPB adult (n = 10) guts) 12h after exposure to the blue-dyed
1% sucrose solution. ................................................................................................................... 117
Table 5.1 Treatment comparisons within each dsRNA/hpRNA delivery method used for
differential gene expression analysis to investigate the response to RNAi and the delivery
methods in adult mountain pine beetle (Dendroctonus ponderosae). ......................................... 145
Table 5.2 Presence or absence of genes coding for RNAi machinery components in the
differential gene expression analysis comparing the negative controls in different delivery
methods. ...................................................................................................................................... 148
Table S1 Protein-coding sequences and accession numbers of gene targets in mountain pine
beetle (Dendroctonus ponderosae). Long dsRNA sequence is highlighted in yellow. Digital
droplet PCR (ddPCR) primers (highlighted in green) were designed outside of the dsRNA region
to avoid inclusion of the dsRNA in the gene quantification. ...................................................... 206
Table S2 A tally of the presence or absence of blue dye in MPB adult guts after exposure to a
blue-dyed 1% sucrose solution. .................................................................................................. 210
Table S3 Observation of the presence or absence of blue dye in MPB adult guts after exposure to
blue-dyed 1% sucrose as proof of ingestion. .............................................................................. 210
Table S4 Presence or absence of blue dye in the guts of adult MPB after being submerged in
blue-dyed 1% sucrose for 12h..................................................................................................... 211
Table S5 Final tally of surviving “starved” and “fed” adult MPB 16 days post-submergence in
the three treatment groups: water, 0.05mg/ml and 0.1mg/ml hpRS-expressing yeast solutions. 211
Table S6 Quantification of hpRS translocated in phloem at the top (phT#), middle (phM#), and
bottom (phB#) of pine rounds placed in yeast solutions (see section 4.2.3.4.2). Included are noreverse transcriptase controls (-RTC_#), a no-template control (NTC), and a positive control (E
gBlock). For further definitions of controls, refer to Chapter 2, section 2.2.8.1 and 2.2.8.4. .... 211
Table S7 Quality check results for total RNA eluted from adult MPB in previous RNAi assays
meeting requirements for 3’TagSeq library prep and sequencing. Concentration measured with
x

the Qubit 4 Fluorometer Broad Range RNA assay (Thermo Fisher Scientific Inc., 2015) and the
sample integrity (RIN) was determined using the Agilent RNA 6000 Nano Kit on the Agilent
Bioanalyzer 2100 (Agilent, Santa Clara, CA). The ND-1000 Nanodrop (v.3.8.1, NanoDrop
Technologies 2024) was used to measure the 260/280 and 260/230 ratios. The 3’Tag-Seq
analysis requirements are provided in red. * Though the RIN assigned to the samples is not
reliable for insect RNA as there is an endogenous break in the 28S rRNA, the RNA quality was
visually assessed using the electropherogram for each sample, showing little to no degredation
and the two peaks close together (Fabrick and Hull 2017). ........................................................ 212
Table S8 Read count after quality control (QC) and mapping rate summary for each total MPB
RNA sample in the differential gene expression analysis. ......................................................... 213
Table S9 List of annotated GO terms associated with up-regulated genes in adult MPB
submerged in dsIAP (J22S_I) compared to adult MPB not submerged at all (C22) obtained from
NaviGO. Categories of GO terms include: cellular component (CC), biological processes (BP),
and molecular function (MF). Enrichment is provided with calculated p-value, significance level
is p<0.05...................................................................................................................................... 213
Table S10 List of annotated GO terms associated with down-regulated genes in adult MPB
submerged in dsIAP (J22S_I) compared to adult MPB not submerged at all (C22) obtained from
NaviGO. Categories of GO terms include: cellular component (CC), biological processes (BP),
and molecular function (MF). Enrichment is provided with calculated p-value, significance level
is p<0.05...................................................................................................................................... 214
Table S11 List of annotated GO terms associated with up-regulated genes in adult MPB
submerged in dsRS (J22S_D) compared to adult MPB not submerged at all (C22) obtained from
NaviGO. Categories of GO terms include: cellular component (CC), biological processes (BP),
and molecular function (MF). Enrichment is provided with calculated p-value, significance level
is p<0.05...................................................................................................................................... 215
Table S12 List of annotated GO terms associated with down-regulated genes in adult MPB
submerged in dsRS (J22S_D) compared to adult MPB not submerged at all (C22) obtained from
NaviGO. Categories of GO terms include: cellular component (CC), biological processes (BP),
and molecular function (MF). Enrichment is provided with calculated p-value, significance level
is p<0.05...................................................................................................................................... 216
Table S13 List of annotated GO terms associated with up-regulated genes in adult MPB fed
water-associated with phloem (PHPF_W) compared to adult MPB not fed at all (C23) obtained
from NaviGO. Categories of GO terms include: cellular component (CC), biological processes
(BP), and molecular function (MF). Enrichment is provided with calculated p-value, significance
level is p<0.05. ............................................................................................................................ 217
Table S14 List of annotated GO terms associated with down-regulated genes in adult MPB fed
water-associated with phloem (PHPF_W) compared to adult MPB not fed at all (C23) obtained
from NaviGO. Categories of GO terms include: cellular component (CC), biological processes
(BP), and molecular function (MF). Enrichment is provided with calculated p-value, significance
level is p<0.05. ............................................................................................................................ 218
xi

Table S15 List of annotated GO terms associated with up-regulated genes in adult MPB fed
hpRS-associated with phloem (PHPF_D) compared to adult MPB not fed at all (C23) obtained
from NaviGO. Categories of GO terms include: cellular component (CC), biological processes
(BP), and molecular function (MF). Enrichment is provided with calculated p-value, significance
level is p<0.05. ............................................................................................................................ 219
Table S16 List of annotated GO terms associated with down-regulated genes in adult MPB fed
hpRS-associated with phloem compared (PHPF_D) to adult MPB not fed at all (C23) obtained
from NaviGO. Categories of GO terms include: cellular component (CC), biological processes
(BP), and molecular function (MF). Enrichment is provided with calculated p-value, significance
level is p<0.05. ............................................................................................................................ 221
Table S17 List of annotated GO terms associated with up-regulated genes in adult MPB fed
hpRS-associated with phloem (PHPF_D) compared to adult MPB fed water-associated with
phloem (PHPF_W) obtained from NaviGO. Categories of GO terms include: cellular component
(CC), biological processes (BP), and molecular function (MF). Enrichment is provided with
calculated p-value, significance level is p<0.05. ........................................................................ 221
Table S18 List of annotated GO terms associated with down-regulated genes in adult MPB fed
hpRS-associated with phloem compared to adult MPB fed water-associated with phloem
obtained from NaviGO. Categories of GO terms include: cellular component (CC), biological
processes (BP), and molecular function (MF). Enrichment is provided with calculated p-value,
significance level is p<0.05. ....................................................................................................... 222

xii

List of Figures
Figure 2.1 Subject collection methods. A) Mountain pine beetle-infested bolts in a modified
plastic tote. B) Totes containing MPB-infested bolts stored in non-temperature regulated shed at
the Prince George University of Northern British Columbia (UNBC) campus. C) Lindgren
funnel trap with Douglas-fir beetle lure components (seudenol-frontalin, kairomone, and LR
ethanol) to attract and collect live Douglas-fir beetles on UNBC Prince George campus. .......... 30
Figure 3.1 A submerged adult mountain pine beetle (Dendroctonus ponderosae, MPB) in bluedyed 1% sucrose solution. Beetles were submerged in liquid to the posterior end of the pronotum
for 12h. .......................................................................................................................................... 66
Figure 3.2 Percent survival over 11 days of adult mountain pine beetles (Dendroctonus
ponderosae, MPB) (n = 10) submerged in dsRNA for six gene targets: dsIAP, dsHSP, dsVHA19,
dsTSP2A, dsMESH, and dsSSK and the control dsRS. ............................................................... 74
Figure 3.3 Comparison of the mean (n = 5) of the log2 transformed relative target gene
expression between the treatment and negative control (dsRS) group 24h after submergence in
dsRNA. Statistical analysis was performed using a Student’s t-test (A-C, E-F) or a MannWhitney-Wilcoxon Test (D). Significance codes are: ‘***’ < 0.001; ‘**’ < 0.01; ‘*’ < 0.05 A)
iap gene (t = -3.2484, df = 6.9886, p = 0.01412), B) hsp gene (t = -1.1787, df = 7.3002, p =
0.2755), C) vha19 gene (t = -5.5759, df = 5.834, p = 0.00155), D) tsp2a gene (W = 9, p =
0.5476), E) mesh gene (t = 4.4964, df = 4.2431, p = 0.009468), and F) ssk gene (t = -5.0566, df =
5.3101, p = 0.003299). .................................................................................................................. 75
Figure 3.4 Percent survival over 11 days of adult female mountain pine beetles (Dendroctonus
ponderosae, MPB) (n = 10) submerged in kit-synthesized dsRNA or heat-deactivated, dsIAPand dsVHA19-expressing yeast solutions of different concentrations: 0.05mg/ml hpIAP
(0.05_hpIAP), 0.1mg/ml hpIAP (0.1_hpIAP), 0.05mg/ml hpVHA19 (0.05_hpVHA19), 0.1mg/ml
hpVHA19 (0.1_hpVHA19) and kit-synthesized dsIAP (dsIAP) and dsVHA19 at 2.5μg/μl
(dsVHA19). The survival of two negative controls: water (H2O) and a random sequence
expressed in a 0.1mg/ml yeast solution (0.1_hpRS) and kit-synthesized (2.5μg/μl (dsRS) were
recorded and plotted alongside for comparison. ........................................................................... 77
Figure 3.5 Comparison of the mean log2 transformed relative target gene expression between the
treatment controls and the negative controls 72h after submergence in dsRNA or hpRNA.
Statistical analysis was performed using a one-way ANOVA test. A) Comparison of 0.05mg/ml
hpIAP (0.05_hpIAP, n=4), 0.1mg/ml hpIAP (0.1_hpIAP, n=3), dsIAP at 2.5μg/μl (dsIAP, n=4),
and the negative controls water (H2O, n=3), dsRS (dsRS, 2.5μg/μl, n=5), 0.1mg/ml hpRS
(0.1_hpRS, n=3): iap expression is not significantly different (p = 0.581, F= 0.7777, df= 5) B)
Comparison between 0.05mg/ml hpVHA19 (0.05_hpVHA19, n=4), 0.1mg/ml hpVHA19
(0.1_hpVHA19, n=6), dsVHA19 at 2.5μg/μl (dsVHA19, n=2*), and the negative controls water
(H2O, n=3), dsRS (dsRS, 2.5μg/μl, n=5), and 0.1mg/ml hpRS (0.1_hpRS, n=3): vha19
expression is not significantly different (p = 0.485, F= 0.903, df= 4). * With only two biological
repetitions, this treatment group was excluded from the statistical analysis but plotted for visual
observation. ................................................................................................................................... 78

xiii

Figure 3.6 Percent survival over 14 days of adult male mountain pine beetles (Dendroctonus
ponderosae, MPB) (n = 10) submerged in: 0.05mg/ml hpIAP (0.05_hpIAP), 0.1mg/ml hpIAP
(0.1_hpIAP), 0.05mg/ml hpMESH (0.05_hpMESH), 0.1mg/ml hpMESH (0.1_hpMESH), or
dsMESH at 2.5μg/μl (dsMESH). The survival of two negative controls: water (H2O) and
0.1mg/ml hpRS yeast solution (0.1_hpRS; does not match any transcript in the mountain pine
beetle transcriptome) was recorded and plotted alongside for comparison. ................................. 79
Figure 3.7 Comparison of the mean log2 transformed relative target gene expression between the
treatment controls and the negative controls 72h after submergence in dsRNA. Statistical
analysis was performed using the Kruskal-Wallis test. A) Comparison between 0.05mg/ml dsIAP
(0.05_dsIAP, n=5), 0.1mg/ml dsIAP (0.1_IAP, n=5) and the negative controls water (H2O, n=5)
and 0.1mg/ml dsRS (0.1_dsRS, n=5): iap expression is not significantly different (p = 0.5977, χ2
= 1.88, df= 3). B) Comparison between yeast solutions 0.05mg/ml dsMESH (0.05_dsMESH,
n=5), 0.1mg/ml dsMESH (0.1_mesh, n=6) and kit-synthesized dsMESH at 2.5μg/μl (ndsMESH,
n=4) to the negative controls water (H2O, n=5) and 0.1mg/ml dsRS (0.1_dsRS, n=5): mesh
expression is not significantly different (p = 0.5663, χ2= 2.9495, df= 4). .................................... 80
Figure 3.8 Percent survival over eight days of adult female mountain pine beetle (Dendroctonus
ponderosae, MPB) (n = 10) submerged in kit-synthesized dsRNA for three gene targets: iap
(dsIAP), vha19 (dsVHA19), and mesh (dsMESH) at a concentration of 2.5μg/μl. The survival of
three negative controls: no-submergence control (no_sub_control), water (H2O), and 2.5μg/μl
double-stranded random stem (dsRS; does not match any transcript in the mountain pine beetle
transcriptome) was recorded and plotted alongside for comparison. ........................................... 81
Figure 3.9 Comparison of the mean log2 relative iap gene expression between the dsIAP and
control groups: no-submergence control (no_sub_control), water (H2O), and 2.5μg/μl doublestranded random stem (dsRS; does not match any transcript in the mountain pine beetle
transcriptome). Statistical analysis using the one-way ANOVA test showed significant
differences among at least one of the group means at each time point. A) At 24h (n = 6), iap gene
expression in H2O (p = 0.01) and dsRS (p = 0.00013) groups were significantly lower than the
no-submergence control group. Expression of iap in dsIAP was significantly lower than nosubmergence control and H2O (p < 0.0001 and p = 0.001, respectively). B) At 48h (n=6), iap
expression in the H2O (n=5) and dsIAP groups was significantly lower than the no-submergence
control group (p = 0.03 and p = 0.004, respectively). C) At 72h (n = 6; dsRS n=5), iap expression
was significantly lower in the dsIAP group than the no-submergence control group (p = 0.0024).
....................................................................................................................................................... 83
Figure 3.10 Comparison of the mean log2 relative vha19 gene expression between the dsVHA19
and control groups: no-submergence control (no_sub_control), water (H2O), and 2.5μg/μl
double-stranded random stem (dsRS; does not match any transcript in the mountain pine beetle
transcriptome). A) At 24h (n=6), a one-way ANOVA calculated that vha19 gene expression was
significantly lower in the dsRS and dsVHA19 groups compared to the no-submergence control
(p = 0.03 and p = 0.044, respectively). B) At 48h (n=6), a Kruskal-Wallis test showed no
significant differences in relative vha19 gene expression between any of the group means (p =
0.09, χ2 = 6.49, df= 3). C) At 72h (n= 6), a one-way ANOVA test output showed that the vha19
relative expression was statistically significantly lower in the dsVHA19 group (n=4) than the nosubmergence control and dsRS groups (n=5) (p = 0.006 and p = 0.037, respectively). ............... 85
xiv

Figure 3.11 Comparison of the mean log2 relative mesh gene expression between the dsMESH
and control groups: no-submergence control (no_sub_control), water (H2O), and 2.5μg/μl
double-stranded random stem (dsRS; does not match any transcript in the mountain pine beetle
transcriptome). A) At 24h (n=6), a one-way ANOVA analysis reported no significant differences
between any of the groups (p = 0.502, F = 0.813, df = 3). B) At 48h (no_sub_control & H2O
n=6; dsRS & dsMESH n=5), a Kruskal-Wallis test calculated no statistically significant
differences between any of the group means (p = 0.8881, χ2 = 0.6364, df = 3). C) At 72h (n=6;
dsRS n=4), a Kruskal-Wallis test followed by a Dunn’s test indicated that the mean mesh
expression was significantly lower in the dsMESH group (n=5) than the no-submergence control
group (p = 0.024). ......................................................................................................................... 87
Figure 4.1 Arrangement of lodgepole pine (Pinus contorta) phloem punches in a sterile 24-well
plate creating “phloem homes” (C.I. Keeling and C.C Chiu, personal communication, 2022). The
two-layered adaption is shown with the top layer removed and placed below the well plate. ... 109
Figure 4.2 Set up for blue-dyed water translocation through lodgepole pine (Pinus contorta)
phloem trials. A) “Phloem sandwiches” in blue dyed water. Pieces of phloem are placed between
two moistened paper towels on the inside of glass squares and clipped together. B) Lodgepole
pine rounds placed in blue-dyed water immediately after being cut. ......................................... 113
Figure 4.3 Percent survival over 11 days of adult MPB fed 5μg of target dsRNA for two gene
targets (n=10): dsIAP and dsHSP. The survival of two negative controls: water (H2O) and a
double-stranded random stem (dsRS; does not match any transcript in the mountain pine beetle
transcriptome) was plotted alongside for comparison. ............................................................... 118
Figure 4.4 Progress of blue-dyed water translocated through lodgepole pine (Pinus contorta)
phloem in “phloem sandwiches” after A) 4h and B) 96h. .......................................................... 119
Figure 4.5 Translocation success of blue-dyed hpRNA-expressing yeast solutions through
lodgepole pine (Pinus contorta) phloem in the cut trunk after 96h. A) Presence of blue dye
around the circumference at the top B) Phloem separated from the rest of the tree round, showing
the presence of blue dye at the top and bottom. .......................................................................... 120
Figure 4.6 Phloem home trial after 13 days. A) Wells marked with white had the phloem
removed after MPB mortality. Lots of frass in wells indicates successful MPB chewing. B)
Removed top layer shows MPB burrow in the bottom layer. ..................................................... 121
Figure 4.7 Percent survival of adult MPB fed lodgepole pine (Pinus contorta) phloem painted
with different amounts of dsIAP- expressing yeast (n=18): 0.01mg/ml hpIAP (0.01_hpIAP),
0.05mg/ml hpIAP (0.05_hpIAP), and 0.1mg/ml hpIAP (0.1_hpIAP). The survival of MPB in two
negative controls: water (H2O) and 0.1mg/ml hpRS (0.1_hpRS; does not match any transcript in
the mountain pine beetle transcriptome) was included for comparison. .................................... 122
Figure 4.8 Comparison of the mean (n=6) of the log2 transformed relative iap gene expression
between 0.01mg/ml hpIAP (0.01_hpIAP), 0.05mg/ml hpIAP (0.05_hpIAP), 0.1mg/ml hpIAP
(0.1_hpIAP) and the control groups: water (H2O) and 0.1mg/ml hpRS (0.1_hpRS, n = 5) 72h
after initial exposure. Statistical analysis using a one-way ANOVA reported no significant
xv

difference between the mean log2 transformed relative iap gene expression among groups (p =
0.277, F = 1.359, df = 4). ............................................................................................................ 123
Figure 4.9 Percent survival of adult female MPB fed lodgepole pine (Pinus contorta) phloem
painted with different amounts of hpIAP-expressing yeast (n=18): 0.5mg/ml hpIAP (0.5_hpIAP),
1.0mg/ml hpIAP (1.0_hpIAP), and 5.0mg/ml hpIAP (5.0_hpIAP). The survival of MPB in two
negative controls: water (H2O) and 5.0mg/ml hpRS (5.0_hpRS; does not match any transcript in
the mountain pine beetle transcriptome) was included for comparison. Red arrow indicates the
first observation of fungus. ......................................................................................................... 124
Figure 4.10 Comparison of the mean log2 transformed relative iap expression between the
treatment controls and the negative controls at two different timepoints after initial exposure to
hpRNA. Statistical analysis was performed using a one-way ANOVA test. A) After 72h,
comparison of 0.5mg/ml hpIAP (0.5_hpIAP, n=5), 1.0mg/ml hpIAP (1.0_hpIAP, n=5), 5.0mg/ml
hpIAP (5.0_hpIAP, n = 6) and the negative controls water (H2O, n=5) and 5.0mg/ml hpRS (5.0_hpRS, n=5): iap expression is not significantly different (p = 0.674, F = 0.589, df = 4). B) After
120h, comparison of 0.5mg/ml hpIAP (0.5_hpIAP, n=2*), 1.0mg/ml hpIAP (1.0_hpIAP, n=4),
5.0mg/ml hpIAP (5.0_hpIAP, n = 5) and the negative controls water (H2O, n=6) and 5.0mg/ml
hpRS (5.0-_hpRS, n=6): iap expression is not significantly different (p = 0.495, F = 0.834, df =
3). * With only two biological repetitions, this treatment group was excluded from the statistical
analysis but plotted for visual observation.................................................................................. 125
Figure 4.11 Percent survival of adult MPB fed different amounts of hpIAP- expressing yeast
translocated through lodgepole pine (Pinus contorta) phloem (n=18): 0.01mg/ml hpIAP
(0.01_hpIAP), 0.05mg/ml hpIAP (0.05_hpIAP), and 0.1mg/ml hpIAP (0.1_hpIAP). The survival
of MPB in two negative controls: water (H2O) and 0.1mg/ml hpRS (0.1_hpRS; does not match
any transcript in the mountain pine beetle transcriptome) was included for comparison. ......... 126
Figure 4.12 Comparison of the mean (n=6) of the log2 transformed relative iap gene expression
between 0.01mg/ml hpIAP (0.01_hpIAP), 0.05mg/ml hpIAP (0.05_hpIAP), 0.1mg/ml hpIAP
(0.1_hpIAP) and the control groups: water (H2O) and 0.1mg/ml hpRS (0.1_hpRS, n = 5) 72h
after initial exposure. Statistical analysis using the Kruskal-Wallis test reported no significant
difference between the mean log2 transformed relative iap gene expression among groups (p =
0.4437, χ2 = 3.731, df = 4).......................................................................................................... 127
Figure 4.13 Percent survival of adult MPB fed lodgepole pine (Pinus contorta) phloem soaked in
different amounts of hpIAP- expressing yeast (n=18): 0.01mg/ml hpIAP (0.01_hpIAP),
0.05mg/ml hpIAP (0.05_hpIAP), and 0.1mg/ml hpIAP (0.1_hpIAP). The survival of MPB in two
negative controls: water (H2O) and 0.1mg/ml hpRS (0.1_hpRS; does not match any transcript in
the mountain pine beetle transcriptome) was included for comparison. .................................... 128
Figure 4.14 Comparison of the mean (n=6) of the log2 transformed relative iap gene expression
between 0.01mg/ml hpIAP (0.01_hpIAP), 0.05mg/ml hpIAP (0.05_hpIAP, n = 5), 0.1mg/ml
hpIAP (0.1_hpIAP) and the control groups: water (H2O, n = 4) and 0.1mg/ml hpRS (0.1_hpRS)
72h after initial exposure. Statistical analysis using the Kruskal-Wallis test reported no
significant difference between the mean log2 transformed relative iap gene expression among
groups (p = 0.0822, χ2 = 8.269, df = 4). ..................................................................................... 129
xvi

Figure 5.1 Multidimensional scaling (MDS) plots performed by the Bioinformatics Core at UC
Davis Genome Center. (A) The initial MDS plot shows a large separation along the first
dimension, which was determined to be a sex effect. (B) This sex effect was added as an
unknown variable to the formula. Females are represented by circles and males represented by
triangles. Microinjection samples are represented by A16M prefix, submergence samples by the
J22S prefix, and phloem-fed samples by PHPF prefix. Controls are listed with ‘C’ followed by
the last two digits of emergence year. Lastly, dsRS-treated samples are represented by the suffix
‘D’,water-treated samples by the suffix ‘W’, and dsIAP-treated samples with the suffix ‘I’. ... 147
Figure 5.2 Enriched (p < 0.05) GO terms from the comparison between adult MPB submerged in
dsRS and adult MPB not submerged in anything. Categories are: cellular component (CC),
biological process (BP), and molecular function (MF). Significance level is indicated by the
horizontal red line, any bar above the line indicates p < 0.05. A) Enriched GO terms associated
with up-regulated genes. B) Enriched GO terms associated with down-regulated genes. ......... 151
Figure 5.3 Enriched (p < 0.05) GO terms from the comparison between adult MPB submerged in
dsIAP and adult MPB not submerged in anything. Categories are: cellular component (CC),
biological process (BP), and molecular function (MF). Significance level is indicated by the
horizontal red line, any bar above the line indicates p < 0.05. A) Enriched GO terms associated
with up-regulated genes. B) Enriched GO terms associated with down-regulated genes. ......... 153
Figure 5.4 Enriched (p < 0.05) GO terms from comparison between adult MPB fed dsRS-treated
phloem (PHPF_D) and adult MPB not fed (C23). Categories are: cellular component (CC),
biological process (BP), and molecular function (MF). Significance level is indicated by the
horizontal red line, any bar above the line indicates p < 0.05. A) Enriched GO terms associated
with up-regulated genes. B) Enriched GO terms associated with down-regulated genes. ......... 156
Figure 5.5 Enriched (p < 0.05) GO terms from comparison between adult MPB fed water-treated
phloem (PHPF_W) and adult MPB not fed (C23). Categories are: cellular component (CC),
biological process (BP), and molecular function (MF). Significance level is indicated by the
horizontal red line, any bar above the line indicates p < 0.05. A) Enriched GO terms associated
with up-regulated genes. B) Enriched GO terms associated with down-regulated genes. ......... 158
Figure 5.6 Enriched (p < 0.05) GO terms from comparison between adult MPB fed dsRS-treated
phloem (PHPF_D) and adult MPB fed water-treated phloem (PHPF_W). Categories are: cellular
component (CC), biological process (BP), and molecular function (MF). Significance level is
indicated by the horizontal red line, any bar above the line indicates p < 0.05. There are no
enriched cellular components associated with the up- or down-regulated genes. A) Enriched GO
terms associated with up-regulated genes. B) Enriched GO terms associated with down-regulated
genes. .......................................................................................................................................... 160
Figure S1 Mortality of adult mountain pine beetle (Dendroctonus ponderosae, MPB) in the
microinjection trial. Survival of the beetles injected with angled (inj_AN) and side-delivery
(inj_SN) needles (Hamilton, Canada) were compared to the survival of non-injected (control)
beetles. The initial survival pattern along with the injection process with each needle, were
considered in the selection of t he selection of the best needle. ................................................. 209

xvii

Figure S2 Adult MPB percent survival in three different sucrose feeding treatment groups: no
treatment (group_1), submerged in a 1% sucrose solution (group_2), and force fed a vertically
suspended droplet (group_3). Mortality was recorded for 15 days. ........................................... 210

xviii

Acknowledgements
This project would not have been possible without the contributions of many individuals.
The processing of bolts took an army, so thank you to: Adam Folland, Hailey Mizera, Aalia
Suran, Sophia Turgeon, Cam Flinton, Doug Thompson, and Kennedy Boateng.
I extend appreciation to Sophia Turgeon, Andrew Mitchell, Adam Folland, and Nicole de Blois
for help with beetle care, and setting up bioassays. I would also like to thank Caitlin Pitt and the
Genetics Lab for access to RNA quantification programs and analysis of samples throughout the
study.
Additionally, thank you to Mriga Das, Meghan Jelen, and Flavia Pampolini at
Renaissance BioScience Corp. (RBSC) for sharing their knowledge and expertise in bioassay
development and trouble shooting. I also thank RBSC for their in-kind contributions and funding
though a Mitacs Accelerate internship. Thank you to Tanya Milner, Philip Batista, Celia Boone,
and the British Columbia Ministry of Forests for access to beetle-infested trees. Thank you to the
Ministry of Forests for financial contributions to this project.
This research was supported by: (1) Mitacs Accelerate Internship, (2) Renaissance
BioScience Corp., and (3) British Columbia Ministry of Forests. Thank you.
Thank you to my committee members for their guidance and support throughout this
project. Chris Snowdon, your expertise in RNAi and assistance in trouble-shooting bioassays
was invaluable. Chris Keeling, thank you for sharing your knowledge and expertise with phloem
homes and mountain pine beetles. I am thankful for the support and guidance provided by my
supervisors: Jeanne Robert and Brent Murray. Jeanne, thank you for: sharing your extensive
mountain pine beetle and research expertise, advocating for the beetles, taking me on a “beetle
picking” trip to Smithers, and for always being optimistic and encouraging (especially when
many obstacles were encountered in this project). Brent, thank you for tolerating my many
impromptu office visits, always helping with experimental planning, and helping me to talk
through ideas. To both of you, thanks for the jokes in meetings and chapter revision comments
(because we all need to remember to laugh by the time Fridays roll around).
Last but not least, I want to thank my family for their irreplaceable support and
encouragement throughout this research. To my parents: thank you for raising me to believe that
I can do anything I put my mind to.

xix

Chapter 1 - Introduction
At endemic levels, bark beetles are important disturbance agents in forests, increasing
diversity and productivity as a part of the natural forest development cycle (Dhar et al. 2016a;
Pettit et al. 2020). In British Columbia, bark beetles (Coleoptera: Curculionidae, Scolytinae) are
important drivers of mature tree mortality. Four notable bark beetle species are the: mountain
pine beetle (Dendroctonus ponderosae, MPB), spruce beetle (Dendroctonus rufipennis, SB),
Douglas-fir beetle (Dendroctonus pseudotsugae, DFB) and western balsam bark beetle
(Dryocetes confuses, WBBB) (BCMFLNRO n.d.). The MPB is arguably the most significant
insect affecting forests in western North America. Outbreaks negatively impact the local and
national economy and have complex impacts on the ecosystem including altered forest
compositions and forest fire probabilities (McCambridge et al. 1982; Simard et al. 2011; Morris
et al. 2015; Corbett et al. 2016; Dhar et al. 2016a; Audley et al. 2020). Currently, the main
constraint on MPB population range and numbers are cold temperatures in the winter (Safranyik
1998). With increasing temperatures, MPB populations exhibited unprecedented outbreak
magnitudes, establishing further north and threatening the naïve boreal forest of Alberta
(Cullingham et al. 2011; Janes et al. 2014). Advancing research towards new tools for MPB
population reduction is critical for future forest management and health. Molecular
advancements offer promise for a species-specific, non-toxic insecticide for pest management.
Developing a non-toxic, species-specific insecticide for MPB requires several
considerations. The biology of the species and the current management methods are important to
understand. This information, including life cycle, range expansion, and anticipated application
of the insecticide, impacts the MPB life stage that is targeted. Next, more complex associations
should be considered, including MPB population genetics and the taxonomic history of the
1

species. The pathway that is co-opted for this molecular-based insecticide, RNA interference
(RNAi), is a naturally occurring, anti-viral pathway found in eukaryotes, including fungi, plants,
and animals (Zhu and Palli 2020). While promising for pest management tools, there are
limitations to the method. This introductory chapter will cover the background of MPB,
including general biology, management, population genetics, and taxonomic history, as well as
the RNAi pathway and science behind the development of a non-toxic, species-specific
insecticide.
1.1 Mountain pine beetle biology and management
1.1.1 Mountain pine beetle life cycle and host attack
The mountain pine beetle progresses through five main developmental stages: eggs, four
larval instars, pupae, teneral adults, and finally into adults. This entire life cycle occurs under the
bark of the host trees (Howe et al. 2021; Chiu and Bohlmann 2022). The time required for the
MPB life cycle is usually one year, but in some instances, it occurs over two years (Cullingham
et al. 2019; Thompson et al. 2020; Chiu and Bohlmann 2022). This variation in timing can be
local or annual and is influenced by weather and climate, specifically the daily temperatures
(Bentz and Powell 2014; Thompson et al. 2020). Most MPB adults perish after mating and
laying eggs, but some adults are able to survive mild winters (Thompson et al. 2020; Koch et al.
2021). The life cycle progression is usually aligned seasonally so that the larvae overwinter in
hosts (Dhar et al. 2016a; Thompson et al. 2020; Chiu and Bohlmann 2022). The timing of the life
cycle is not only important for overwintering success, but also for attack success on host trees by
the new generation (Bentz and Hansen 2018; Wangen et al. 2024).
The preferred host genus for MPB is Pinus, with MPB able to colonize 14 known Pinus
spp., such as lodgepole pine (Pinus contorta) (Dhar et al. 2016a; Audley et al. 2020). Female

2

MPB are the first to attack a host, and release aggregation pheromones to recruit other male and
female MPB (Cullingham et al. 2019; Chiu and Bohlmann 2022). At endemic levels, MPB
typically select large and older or weakened trees to infest, as the tree defences are easier to
overcome (Janes et al. 2014; Dhar et al. 2016b; Wittische et al. 2019; Audley et al. 2020).
Overcoming tree defenses is assisted by microbes associated with MPB, including fungi (Paine
et al. 1997; Koch et al. 2021; Chiu and Bohlmann 2022). Tree mortality is caused by a
combination of the MPB gallery formation and phloem ingestion as well as nutrient blockages
caused by MPB-associated fungi (Koch et al. 2021). Particularly, blue stain fungi are thought to
contribute to tree mortality through invasion of the sapwood (Paine et al. 1997). Fungal
associates may also provide nourishment for MPB larvae (Paine et al. 1997; Morris et al. 2017;
Cullingham et al. 2019). At epidemic levels, MPB can infest younger, healthier trees as there are
enough beetles to overcome the stronger defences (Paine et al. 1997; Dhar et al. 2016b; Chiu and
Bohlmann 2022).
1.1.2 Mountain pine beetle outbreak dynamics
The MPB is a native, irruptive insect of western North America (Cullingham et al. 2019;
Howe et al. 2021; Koch et al. 2021; Wangen et al. 2024). Often, MPB outbreaks are periodic,
occurring every 25-40 years and lasting for approximately 10 years (Janes et al. 2014; Dhar et al.
2016a; Bleiker 2019). These outbreaks are often regulated by positive and negative feedback
loops (Raffa et al. 2008). Local beetle pressure and the presence of an endemic MPB population
are major drivers of epidemic-level MPB outbreaks (Howe et al. 2021; Koch et al. 2021).
Sporadic outbreaks can also occur if environmental conditions, such as drought, increase the
number of weakened pines in an area close to an endemic MPB population (Koch et al. 2021).
Recently, outbreaks promoted by MPB population pressure, forest management, and climate

3

changes have resulted in MPB range expansion and attacks on naïve hosts like Whitebark (Pinus
albicaulis Engelman) and Jack pine (Pinus banksiana Lamb.) (Cullingham et al. 2019; Wittische
et al. 2019; Howe et al. 2021).
1.1.3 Mountain pine beetle range expansion
Historically, the range of MPB in Canada was limited to British Columbia; Banff, the
southern Rockies, Kananaskis region, and Cypress Hills in Alberta; and a small population in the
Cypress Hills Interprovincial Park (CHIPP) in Saskatchewan (Bleiker 2019). In the early 2010s,
the range of MPB in British Columbia spread from southern areas into northeastern areas as well
as across most of Alberta (Janes et al. 2014; Morris et al. 2017). Molecular data also shows that
genomic differentiation is allowing for the beetles to disperse over longer distances and provides
adaptations to colder climates (Janes et al. 2014). More recently, the range has expanded into the
boreal forest and northwards, placing southeastern Yukon at future risk (Bleiker 2019). The
MPB range has also expanded into higher elevations, reaching new susceptible stands (Howe et
al. 2021; Chiu and Bohlmann 2022). Range expansion is attributed to compounding factors,
including climate change and forest management (Samarasekera et al. 2012; Dhar et al. 2016a;
Cullingham et al. 2019). The decrease in cold temperature spikes at critical timepoints in MPB
development, late spring and early fall, promote the overwintering success of MPB larvae
(Coggins et al. 2011). Additionally, warmer temperatures enable MPB success in higher latitudes
and elevations (Howe et al. 2021). Along with the warming temperatures, even-aged stands
provide more hosts to sustain MPB populations than mixed-age stands (Fettig et al. 2014). The
direction and mechanism of MPB range expansion is important to understand in order to predict
future progression and management resource allocation.

4

Molecular investigations are being used to determine the path of range expansion by
MPB populations into a previously uninhabited range and potential paths for further expansion.
Modelling using gene flow and connectivity indicates that the MPB populations in Hinton and
Edson, Alberta, originated from Jasper (Wittische et al. 2019). Trevoy et al. (2019) applied a
model using single‐nucleotide polymorphism (SNP) datasets and identified that the MPB
population in Jasper is an intermediate between the previously identified northern and southern
population clusters in British Columbia. Despite clustering in the northern and southern Alberta
populations, gene flow between them prevents population structure (Shegelski et al. 2021).
Mixing between the northern and intermediate populations could increase genetic diversity in the
beetles that expand eastward (Shegelski et al. 2021). Samarasekera et al. (2012) showed MPB at
the eastern epidemic edge locations have evidence for expansion. Wittische et al. (2019)
predicted routes of eastward expansion in Alberta and Saskatchewan that provide high genetic
connectivity and little resistance from elevation or climate. While it is uncertain whether the
genetic variation identified by Shegelski et al. (2021) will be advantageous or not to dispersing
MPB, it highlights the complexity of MPB population structure. Despite geographical separation
leading to genetic differences, MPB populations can respond similarly to management if other
factors are also similar (Samarasekera et al. 2012; Cullingham et al. 2019).
The impacts of the increasing outbreaks and presence of MPB in previously unaffected
areas is a concern for forest health and management. The MPB can be considered a native,
invasive pest (Ainslie and Jackson 2011; Wittische et al. 2019; Koch et al. 2021; Wangen et al.
2024). Though native to western North America, MPB populations have spread to the east across
Canada and the north in British Columbia and Alberta where it is an invasive species
(Cullingham et al. 2019; Shegelski et al. 2021). Naïve forest stands are at risk for future MPB

5

infestation, including the boreal forest and pine stands at higher elevations (Wittische et al. 2019;
Howe et al. 2021; Koch et al. 2021). With no acquired resistance to MPB, an infestation in these
stands would have a consequential impact (Howe et al. 2021; Koch et al. 2021).
1.1.4 Impacts of the mountain pine beetle
1.1.4.1 Economic decreases
Mountain pine beetles have affected over 18 million hectares in North America, with
approximately 71 thousand hectares of lodgepole pine mortality recorded in British Columbia in
the 2010s (Morris et al. 2015; Chiu and Bohlmann 2022). From 2000 to 2020, the area impacted
by the MPB outbreak was estimated at 20 million hectares (BCMFLNRO n.d.). Economically,
this accounted for more than half of the merchantable pine (Morris et al. 2015). The annual
allowable cut (AAC) is projected to decrease by over 30 per cent in the next 50 years, negatively
impacting the economy due to decreases in employment and production. It is also predicted that
there will be a loss of over $57 billion to the British Columbia Gross Domestic Product
(BCGDP) by 2054 (Corbett et al. 2016). Not only is MPB damage costly, but so are management
efforts. Mitigation of the MPB in Alberta has cost over $500 million, and restoration of forests in
British Columbia has required large sums from both the provincial and federal governments
(Burton 2006; Shegelski et al. 2021; Johnson 2024). Additionally, other forest products with high
economic value, such as the pine’s symbiont, the pine mushroom (Tricholoma magnivelare), will
be negatively impacted from the loss of mature pine trees and cause further economic strain at a
local scale (Dhar et al. 2016b).
1.1.4.2 Altered ecology
Ecologically, irruptive MPB outbreaks alter forest composition with the mortality of
mature host trees. Space is created in the canopy, decreasing competition with remaining plant

6

species and allowing increased understory growth (McCambridge et al. 1982; Dhar et al. 2016a;
Audley et al. 2020). After an outbreak, the dominant species in a stand is likely to change, even
temporarily, due to the impacted forest succession from the released growth of seedlings and
saplings (Andrus et al. 2020). Audley et al. (2020) reported a 47% recovery of pine growth
which led to the reinstatement of pine as the dominant species, but the mean number of live trees
14 years post-outbreak remained lower than pre-outbreak numbers. The mature pine tree
mortality caused by MPB also impacts stand age, decreasing average tree age (Hicke et al. 2013).
Nutrient cycles and soil characteristics are also altered, largely due to falling needles (Griffin and
Turner 2012; Reed et al. 2018). Wildfire probabilities are impacted, with a decrease in active
crown fire probability but an increase in passive crown fire and fire spread probabilities (Jenkins
et al. 2008; Simard et al. 2011). Mature Pinus mortality impacts the water cycle, causing
groundwater levels to fluctuate and alters seasonal water availability, affecting the forest stands
and the ecosystem services the forest provides (Dhar et al. 2016b).
1.1.4.3 Complex socio-ecological impacts
The socio-ecological impacts of MPB outbreaks show negative effects on recreation,
aesthetics, and cultural heritage (Dhar et al. 2016b; Morris et al. 2017, Bleiker 2019). With the
previous MPB outbreaks impacting 80% of the recreational trails and sites in central British
Columbia, users shared negative impressions. While some sites reported increased usage and no
closures, other sites reported short-term recreational losses due to the MPB outbreaks (Dhar et al.
2016b). While there are cumulatively minimal effects on the recreation in the forests after the
MPB outbreaks, there are negative impacts on the resulting forest aesthetics, though public
perception is complex (Dhar et al. 2016b). Additionally, property values are a large concern due
to MPB-mediated tree mortality (Morris et al. 2017). Consideration of the numerous economic

7

and ecological impacts from MPB outbreaks present challenges to forest managers, which is
further complicated by complex public perceptions.
1.1.5 Mountain Pine Beetle Management Methods
Managing MPB populations is difficult as the beetle life cycle occurs under the tree bark,
and controlling large scale outbreaks or large populations is not feasible (Dhar et al. 2016a,
Bleiker 2019). Current MPB management methods used in British Columbia are high in cost and
often ecologically deleterious (Dhar et al. 2016a; Taylor et al. 1997). Management approaches
are typically placed into two categories: direct or indirect control (Coggins et al. 2011; Fettig et
al. 2014).
Direct control is a reactive approach, initiated after infestation and is used to treat
symptoms and reduce the target MPB population (Coggins et al. 2011; Fettig et al. 2014). In
British Columbia, pest reduction harvesting (formerly “sanitation harvesting”) and salvage
logging or single-tree treatments are the main direct control approaches. Effectiveness of pest
reduction harvesting is limited due to the difficulty in quickly detecting infested trees. This
method has been proven to slow MPB population growth, but is costly and labour-intensive, as
over 50% of infested trees have to be removed annually to cease the MPB population increase
(Coggins et al. 2011; Fettig et al. 2014; Taylor et al. 1997). Salvage logging, or removal of
previously infested trees, does not impact MPB populations, but allows for the mitigation of
economic losses by using the trees for lumber (Bleiker 2019; Fettig et al. 2014). This technique
can have negative impacts on local wildlife (Dhar et al. 2016a). Single tree treatments used
various techniques to remove MPB from a tree or small group of trees. One popular technique
was the use of insecticides. While there was proof of decreased MPB survival, public perception

8

and off-target toxicity concerns have led to reduced applications and the discontinuation of some
of the insecticides (Fettig et al. 2014; Dhar et al. 2016a; Taylor et al. 1997).
Indirect control is considered a preventative approach, and include use of pheromone
baiting, stand thinning, and silvicultural techniques (Coggins et al. 2011). Stand thinning
decreases the number of susceptible hosts for MPB, promotes tree health via decreasing nutrient
competition, and increases wind speed within the stands, which impacts MPB dispersal (Coggins
et al. 2011; Fettig et al. 2014). Not without risks, thinning can create favourable conditions for
other woodboring insects and tree pathogens (Fettig et al. 2014). Clear cutting is another
management technique that can stagger the age of trees within a stand, also decreasing the
number of available hosts to MPB. One obstacle with this technique is the public perception that
cleared blocks negatively impact aesthetics (Fettig et al. 2014). Creating mixed-species stands
can lessen the number of host trees. This not only promotes a resilient forest, but also decreases
the probability of a large-scale MPB attack as stands with high host tree concentrations are
typically targeted (Coggins et al. 2011; Fettig et al. 2014). Though pheromones are listed as an
indirect approach, they are often used in conjunction with a direct management technique.
Attraction pheromones can concentrate MPB to a smaller area and cause fewer infested trees that
can be removed via pest reduction harvesting. However, this has a risk of spillover infestations,
where non-baited trees are colonized by MPB attracted to the area by the pheromones (Fettig et
al. 2014; Klutsch et al. 2017). Anti-aggregation pheromones can protect host trees from attack
while pest reduction harvesting removes infested trees. Slight improvement of results was
observed when both types of pheromones were used along with pest reduction harvesting. The
pairing of these tools is currently the most advised practice in the western United States of
America (Fettig et al. 2014). Currently, British Columbia is in the recovery phase, mitigating the

9

impacts of the previous outbreak, but MPB outbreaks are expected to recur (Bleiker 2019). There
is a need for improved methods to manage MPB populations, and molecular techniques show
promise but the intraspecific genetic diversity in MPB needs to be considered (Kyre et al. 2020;
Taylor et al. 1997).
1.2 Mountain pine beetle population genetics and structure
1.2.1 History of the taxonomic organization of the MPB species
Using molecular techniques for pest management introduces new obstacles, such as
genetic differences between populations. For MPB, the population genetics is of particular
concern as the species has shown post-zygotic isolation and the taxonomic structure of the
species has been, and is still investigated (Wood 1963; Bracewell et al. 2011; Trevoy et al. 2019;
CABI 2020). The history and genetic variation among populations could impact the responses to
molecular techniques for management (Samarasekera et al. 2012).
Two previously separate species Dendroctonus monticolae and Dendroctonus jeffreyi
were combined into the D. ponderosae species in 1963 (Wood 1963). Shortly after in 1968, D.
jeffreyi was classified as a separate species (CABI 2020). The changes in the taxonomic
groupings have led to investigations into the genetic variation within the D. ponderosae species,
especially among populations in different geographical regions. Genetic differences were found
to be highly correlated with geographical distances (Mock et al. 2007; Cullingham et al. 2012;
Samarasekera et al. 2012). Notable variation was found in populations around large desert areas,
and between northern and southern populations. However, there are exceptions to the geographic
and genetic distance correlation. The genetic composition of populations in British Columbia are
similar to the Idaho populations, despite the large geographical distance between them (Mock et
al. 2007). Two populations geographically closest to each other, California and Arizona, show

10

the most genetic differences. The Arizona population is more divergent than expected from
geography, and is along the previous speciation border between D. monticolae and D.
ponderosae (Mock et al. 2007). This congruency between the suspected genetic discontinuity
and the past speciation border, along with lack of geographical distance correlation, indicates
that the different MPB populations might be progressing toward speciation once again.
1.2.2 Genetic Variation among Mountain Pine Beetle Populations
Additional studies show genetic differences among populations in western North
America, with identification of distinct northern and southern clusters (Samarasekera et al.
2012). In Canada, there is a weak population structure signal between northern and southern
populations, attributed to frequent gene flow between clusters (Janes et al. 2014). Genetic
differentiation between the northern and southern clusters was low but significant (Samarasekera
et al. 2012). There were also sub-clusters within the two main clusters (Samarasekera et al.
2012). Though molecular markers did not indicate large divergence or enough of a decrease in
gene flow to support reproductive isolation, postzygotic isolation was found to occur via reduced
egg hatch in hybrid males (Bracewell et al. 2011). There appears to be potential for a
reproductive barrier between the Oregon and Idaho MPB populations, which was unexpected
due to the close geographical distance, similar morphology, and small genetic distance. The early
postzygotic barrier, male hybrid sterility, is thought to be recent and does not indicate that
speciation has started (Bracewell et al. 2011).
The geographical influence on MPB populations also affects phenotypic traits, including
body size and development time. Adult MPB size was found to decrease with increasing latitude
on both sides of the Great Basin Desert, as adult beetles on the eastern side were larger on
average than the beetles on the western side at the same latitudes (Bracewell et al. 2013).

11

Northern populations developed faster than southern populations, with clear genetic differences
in development time and adult size showing local adaptations (Bracewell et al. 2013). However,
despite the genetic and phenotypic differences, gene flow among populations is still frequent
enough to obscure any molecular signal of population-level genetic structure (Mock et al. 2007;
Bracewell et al. 2013; Janes et al. 2014). The increasing interest in the application of molecular
biology techniques to assist in management practices can be limited due to gene expression and
inter- and intra-population genetic differences (Kyre et al. 2020, 2024). These differences in gene
expression and genetics can cause different responses to invading genetic material (antiviral
response) and even pest management tactics. As such, genetic differences are important
considerations when using genetic-based methods for pest management (Kyre et al. 2024).
1.3 RNA interference (RNAi) use and limitations
1.3.1 Gene expression analysis
Information in a cell is stored in deoxyribonucleic acid (DNA) with coding segments
referred to as genes. The genes are turned into ribonucleic acid (RNA) via transcription.
Specifically, proteins are coded from a class of RNA molecules called messenger RNA (mRNA).
After the pre-mRNA strand is made, it undergoes modification via capping of the 5’ end, intron
splicing, cleavage of the 3’ end, and polyadenylation of the 3’ end (Jurado et al. 2014). The
mRNA strand is used as a template to create proteins through a process called “translation”. The
resulting proteins carry out the necessary functions for cell life. This entire process converting
information from DNA through to a functional product is referred to as gene expression (Anjum
et al. 2016).
Gene expression can be altered, with the transcription and translation, or expression, of
some genes being decreased or increased. This would also cause a decrease or increase in the

12

mRNA in the cell, and therefore an expected similar change in the functional gene product
amount. Differential gene expression allows for different cell types to exist and adaptations to
external and internal conditions (Gilbert 2000; Robert et al. 2016).
Gene expression is usually analyzed using real-time quantitative PCR (RT-qPCR) which
measures cDNA made from extracted RNA (Taylor et al. 2017). These results can be variable,
susceptible to contaminants, and require normalization to an internal control, often one or more
housekeeping, or reference, genes. Reference gene expression optimally remains stable among
cells and experimental conditions, and due to this stability, the selected reference genes often
have essential roles in the cell (Kyre et al. 2024). Digital droplet PCR (ddPCR) is increasing in
popularity for gene expression analysis due to improved efficiency. Compared to RT-qPCR,
ddPCR is less sensitive to inhibiting factors, more specific to small fold-changes of expression,
and does not require a standard curve to quantify the target gene copy number (Zmienko et al.
2015). Due to the improved efficiency and quantitative counts provided by ddPCR,
normalization to a reference gene is not always required for gene expression analysis (Taylor et
al. 2017). However, the use of at least one reference gene is recommended, optimally using two
or three reference gene assays run in duplex with the target gene assays (Coulter 2018).
Validation of a variety of reference genes to use in MPB gene expression analysis has been
conducted, providing a catalogue of reference genes to select from for this project (Fraser et al.
2017; Horianopoulos et al. 2018).
1.3.2 Ribonucleic acid interference (RNAi)
The use of the RNAi pathway is being increasingly applied to pest management strategies
due to target specificity and low production costs (Christiaens et al. 2020; Kyre et al. 2020).
RNAi is a naturally occurring anti-viral pathway that degrades invading genetic material

13

(Dowling et al. 2016; Christiaens et al. 2020). The RNAi pathway can be initiated by
exogenously introducing several variations of double-stranded RNA (dsRNA): open-ended short
interfering dsRNA (siRNA), open-ended long dsRNA (dsRNA), hairpin-type RNA (hpRNA)
with one closed end, or paperclip RNA (pcRNA) with two closed ends (Abbasi et al. 2020;
Hashiro and Yasueda 2022). Long dsRNA and hpRNA are typically over 200 nucleotides long,
much longer than the siRNA and pcRNA which range from 21-23 nucleotides (Abbasi et al.
2020). In order to cause gene suppression or knockout, the dsRNA or hpRNA must be an exact
match to the target mRNA for a minimum of 16 consecutive nucleotides, or 25 nucleotides with
few mismatches (Kyre and Rieske 2022; Hollowell et al. 2022).
There are two mechanisms for dsRNA that is ingested orally: clathrin-mediated
endocytosis and the systemic RNA interference deficient-1 (SID-1) transmembrane channelmediated uptake (Cappelle et al. 2016). One or both pathways have been demonstrated in insects
(Cappelle et al. 2016, Yoon et al. 2016). In the SID-1 uptake, transmembrane channels facilitate
the movement of dsRNA from the intestinal lumen into the cytosol (Winston et al. 2007;
McEwan et al. 2012). In clathrin-mediated endocytosis, the dsRNA is brought into the cytoplasm
by endosomes and released via acidification (Yoon et al. 2016). Eventually, in both pathways,
the RNase III-type Dicer-2 (Dcr-2) cuts the dsRNA strand into smaller pieces, also known as
small interfering RNA (siRNA). With help from other associated machinery components, like
R2D2, the siRNA is moved to the RNA-induced silencing complex (RISC), of which Argonaute2 is a critical component (Yoon et al. 2016; Christiaens et al. 2020; Kyre et al. 2020). Here, the
double strands are separated and one complementary strand is degraded while the other is used
as a template for the recognition of matching mRNA. Acting in a sequence specific manner, the
Argonaute component degrades the mRNA that matches the template (Yoon et al. 2016; Kyre et

14

al. 2020). As a result, translation is ceased or decreased, decreasing the amount of protein that
the mRNA codes for (Leelesh and Rieske 2020; Kyre et al. 2020). This process is highly
sequence specific, which decreases the possibility of off-target effects (Christiaens et al. 2020;
Kyre et al. 2020). This pathway can be co-opted to decrease or cease production of proteins to
increase understanding of the protein’s role within an organism. Alternatively, co-opting the
RNAi pathway can be used to cause rapid, targeted mortality by introducing dsRNA that mimics
mRNA, which codes for an essential protein, to the organism (Cooper et al. 2019). The RNAi
pathway has been extensively co-opted in many insect species. Successful RNAi initiation has
decreased target gene suppression in mosquitoes (Zhao et al. 2024; Girard et al. 2025), with
associated mortality to some targets (Stewart et al. 2023). Gene suppression via RNAi was
reported in Hemipteran insects like the brown planthopper (Li et al. 2025), the brown
marmorated stink bug (Halyomorpha halys) (Ghosh et al. 2018; Finetti et al. 2023), and the
Asian citrus psyllid (Ghosh et al. 2018). Additionally, RNAi was effective in crickets
(Modicogryllus siamensis) (Tamaki et al. 2013) and Drosophila flies (Saleh et al. 2006; Murphy
et al. 2016).
Gene expression analysis is an important part in RNA interference (RNAi) studies as it
confirms that the RNAi pathway was initiated alongside the mortality observations (Wallace and
Rieske 2023). For RNAi in bark beetles, most studies report suppressed gene expression
combined with the observed phenotypical response (Rodrigues et al. 2018; Leelesh and Rieske
2020; Kyre et al. 2020; Liu et al. 2021, 2022, 2022; Kyre and Rieske 2022; Pampolini and
Rieske 2023). Previous studies have reported rapid mortality of MPB after exposure to dsRNA
combined with decreased target gene expression levels (Kyre et al. 2020; Kyre and Rieske 2022).

15

1.3.3 Transcriptome analyses have discovered and identified RNAi pathway components in
insect species
Critical genes involved in the different RNAi pathways in insects have been identified,
including a group of Argonaute genes, dicer, Staufen, R2D2, and SID-1, among others (Zhao et
al. 2015; Yoon et al. 2016; Christiaens et al. 2020; Wallace and Rieske 2023). Important
components of the specific RNAi pathway likely used in insects, the siRNA pathway, have been
verified in Coleopteran beetles like the Colorado potato beetle (Leptinotarsa decemlineata) and
the six-spined ips (Ips calligraphus Germar) (Yoon et al. 2016; Wallace and Rieske 2023). In the
six-spined ips, the confirmation of the RNAi pathway components was in addition to beetle
mortality and gene suppression as a response to RNAi (Wallace and Rieske 2023). In MPB, the
RNAi machinery has not been investigated alongside bioassays testing the efficiency of RNAi. A
search of a mapped MPB transcriptome (GCF_000355655.1 DendPond male 1.0 rna from
genomic.fna) found the presence of some important RNAi components: Argonaute-2,
endoribonuclease dicer, and SID1. With many previous studies showing the effectiveness of
RNAi in MPB, and the presence of some critical components of the RNAi pathway confirmed in
a general MPB transcriptome, it is expected that MPB should be sensitive to RNAi. However,
the relationship between effective RNAi and the expression levels of core machinery in adult
MPB has not been investigated.
1.3.4 Species-specificity of RNAi
Using dsRNA to target an mRNA strand is species-specific and limits off-target effects
on other organisms that come into contact with the dsRNA (Kyre et al. 2019). This specificity is
due to the dsRNA/mRNA sequence similarity requirements. The dsRNA and target mRNA
sequences must be exactly the same for a minimum of 16 consecutive nucleotides, or with a few

16

differences in a longer sequence length, like 25 nucleotides (Kyre and Rieske 2022; Hollowell et
al. 2022). Targeting less-conserved genes can further increase the species-specificity of this
method (Whyard et al. 2009; Kyre et al. 2019). The species-specificity of RNAi has been shown
in many studies.
One study investigated the impact of using dsRNA designed for Halyomorpha halys on
Rhodnius prolixus (Finetti et al. 2023). There was no mortality or significant gene suppression
observed in the off-target species when exposed to any of the three gene targets, supporting the
species-specificity of the RNAi method in Hemiptera. Two genes, vATPase and highly
conserved tubulin (gTub23C) were tested for species specificity among four species: fruit flies
(Drosophila melanogaster), flour beetles (Tribolium castaneum), tobacco hornworms (Manduca
sexta), and pea aphids (Acyrthosiphon pisum) (Whyard et al. 2009). For both genes, only the
species for which the dsRNA sequence was designed for exhibited gene expression changes. For
the more conserved tubulin gene, this was attributed to using a less conserved region of the gene
(Whyard et al. 2009). Another study investigated the effects of dsRNA designed for southern
pine beetle (Dendroctonus frontalis, SPB) on other species associated with the Pinus spp. hosts:
pine sawfly (Neodiprion lecontei), eastern subterranean termite (Reticulitermes flavipes), and
six-spined ips (Ips calligraphus) (Hollowell et al. 2022). The tested non-congeneric species
transcriptomes showed little overlap with the SPB transcriptome. When treated with the SPB
dsRNA in bioassays, only the six-spined ips (Ips calligraphus) showed a change in gene
expression, but no difference in survival was observed (Hollowell et al. 2022). The other two
species also showed no mortality from dsRNA exposure (Hollowell et al. 2022). These findings
provide further support for the specificity of RNAi and the non-toxicity to off-target, noncongeneric species.

17

1.3.5 Limitations of RNAi
With variable outcomes from many different studies, it is difficult to predict what targets
will work without considering the other factors affecting RNAi responses like the target species
and life stage, the targeted genes, and the delivery method used to get the dsRNA to the insect
(Poreddy et al. 2017; Cooper et al. 2019; Leelesh and Rieske 2020). For example, effective gene
targets may vary depending on the study’s targeted insect life stage (Bingsohn et al. 2017; Liu et
al. 2021). Effective delivery methods can be species-specific, so that one method which elicits a
RNAi response in one species may not cause a response in another species (Finetti et al. 2023).
In this section, the rationale and specific examples behind these factors will be introduced.
1.3.5.1 Insect species
The increasing use of the RNAi pathway for insect and virus control, medicine, and to
explore functional characterization of proteins comes with challenges. Generally, species within
some insect orders like Diptera, Hemiptera, and Lepidoptera have variable RNAi responses.
Among reported non-successful responses, there are studies with successful RNAi-mediated
gene suppression in Lepidoptera species (Turner et al. 2006; Terenius et al. 2011). Other orders,
like Coleoptera, are generally considered sensitive to RNAi, with less variation among the RNAi
responses (Christiaens et al. 2020). However, there are exceptions to the generalization, often
due to the additional factors affecting RNAi efficiency.
1.3.5.2 Gene targets
The targeted genes in RNAi studies can be a source of variation. Currently, there is a
limited understanding about what makes certain gene targets more sensitive to RNAi compared
to others (Cooper et al. 2019). The current knowledge is limited due to variation in experimental
set up, limited knowledge about protein stability, and the gene target bias in experiments (Cooper

18

et al. 2019). Variation in the responses of insects to different gene target dsRNA is reported in
numerous studies (Bingsohn et al. 2017; Kyre et al. 2019, 2020; Liu et al. 2021, 2022; Kyre and
Rieske 2022). Other studies show gene suppression in all the targeted genes (Turner et al. 2006;
Zhu et al. 2011; Zhang et al. 2016; Rodrigues et al. 2018; Leelesh and Rieske 2020; Sun et al.
2021; Pampolini and Rieske 2023).
In studies investigating the lethality of target gene suppression on the insect, the same
targets are often tested. These studies aim to target essential genes that, when suppressed, should
cause rapid mortality. A popular gene target for this type of study is the inhibitor of apoptosis
(iap), a stress response gene that blocks cell death (Kyre et al. 2020). This target was used in
previous RNAi experiments on MPB and SPB, along with two other stress response genes: heat
shock protein (hsp) and shibire (shi) (Kyre et al. 2019, 2020; Kyre and Rieske 2022). One or
more of those targets were tested on other Coleopteran species, including the Emerald Ash Borer
(Agrilus planipennis, EAB) and the six-spined ips (Rodrigues et al. 2018; Leelesh and Rieske
2020; Wallace and Rieske 2023; Pampolini and Rieske 2023). While a few studies have looked
at other essential gene targets in Coleopteran insects, including Dendroctonus spp., there is a
need to further survey more gene targets to increase the knowledge and applicability of RNAi for
targeted insect mortality.
Many of the commonly tested genes are highly conserved among species due to their
critical roles (Reaume and Sokolowski 2011; Kyre and Rieske 2022). Silencing of homologous
genes in a congeneric species have been reported (Poreddy et al. 2017; Kyre and Rieske 2022).
Ingestion of material from a dsRNA-producing plant targeting a gene in the Lepidopteran insect
Manduca sexta silenced the target gene, and the respective homologous gene, in both M. sexta
and wild Manduca quinquemaculata (Poreddy et al. 2017). In the Dendroctonus genus, both

19

MPB and SPB exhibited silencing of the heat shock protein (hsp) gene when MPB-specific
dsHSP was ingested (Kyre and Rieske 2022). While these results show promise for RNAi as a
pest management tool for congeneric pests with similar niches, this could indicate that some offtarget species may be affected.
1.3.5.3 Insect life stage
The life stage of the insect can cause varying responses to RNAi, especially among larvae
and adults tested with the same gene target (Cooper et al. 2019; Leelesh and Rieske 2020).
Often, the starting gene expression levels vary at different developmental stages, as shown in the
Chinese White Pine beetle (Dendroctonus armandi) and the light brown apple moth (Epiphyas
postvittana) (Turner et al. 2006; Liu et al. 2021, 2022). In common fruit flies (Drosophila
melanogaster), larvae are not responsive to dsRNA delivered by injection or ingestion, whereas
the adults and embryos are sensitive to injections (Cooper et al. 2019). In Coleopteran insects,
the adult and larval responses to the same gene target often differ. In flour beetles (Tribolium
castenum), the RNAi pathway initiation was found to be stage-specific, causing mortality when
injected in larvae, but no mortality when injected in adults (Bingsohn et al. 2017). The varied
RNAi effectiveness among life stages in another Dendroctonus species was shown when dsRNA
was injected in D. armandi, resulting in the suppression of two out of three genes in adults, and
all three genes in larvae (Liu et al. 2021). As shown in the above examples, the responses of the
insect at different life stages can also be contingent on the dsRNA delivery method.
1.3.5.4 Delivery method for dsRNA
The delivery method of the dsRNA to the insect is yet another source of variability in
RNAi efficiency. Insects in the Diptera and Orthoptera orders showed sensitivity, and resulting
gene suppression, to RNAi when the dsRNA was injected, but not when it was fed (Baum et al.

20

2007; Cooper et al. 2019). In one study, the Hemipteran Halyomorpha halys nymphs showed
gene suppression with dsRNA applied topically, but did not cause gene suppression in Rhodnius
prolixus nymphs (Finetti et al. 2023). Rather, dsRNA had to be injected to elicit an RNAi
response (Finetti et al. 2023). Species such as the EAB and the western corn rootworm
(Diabrotica virgifera virgifera) in the Coleoptera order showed gene suppression after injection
or oral uptake of dsRNA, further corroborating the sensitivity of Coleopteran insects to RNAi
(Zhao et al. 2015; Rodrigues et al. 2018; Cooper et al. 2019). Another Coleopteran insect, the red
flour beetle (Tribolium castaneum), has only been injected with dsRNA in RNAi studies (Linz et
al. 2014; Bingsohn et al. 2017; Rodrigues et al. 2018). While the two main delivery methods are
microinjection and oral ingestion, absorption of the dsRNA is another method found to be
effective at initiating RNAi in Coleopteran insects (Baum et al. 2007; Leelesh and Rieske 2020;
Kyre et al. 2020).
In order to transition from lab-based to in situ-based application, adaptations to these
feeding methods are being tested and used. Some adaptations include expression in transformed
plants and microbe-mediated delivery, which help to increase the stability of the dsRNA in
natural settings (Cooper et al. 2019; Christiaens et al. 2020; Leelesh and Rieske 2020).
Successful delivery and RNAi initiation has occurred when dsRNA was expressed by bacteria
and fed to EAB larvae (Leelesh and Rieske 2020). Another microbe-mediated method with
successful delivery and RNAi initiation is through the ingestion of dsRNA-expressing yeast
(Duman-Scheel 2019). The dsRNA-expressing yeast shows promise for gene silencing and
altering the immune system in mammals (Duman-Scheel 2019). In insects, ingestion of dsRNAexpressing yeast has resulted in gene silencing and decreased health (Murphy et al. 2016). The
use of yeast progresses the applicability of RNAi as a pest management tool as it allows for an

21

inexpensive production and protects delivery of the dsRNA from degradation (Duman-Scheel
2019).
1.3.6 RNAi success in species closely related to MPB
Many species within the Coleoptera order are susceptible to RNAi with at least one
method of dsRNA delivery, and they often exhibit a robust sensitivity to more than one dsRNA
delivery method, such as injection, ingestion, or absorption (Zhao et al. 2015; Cooper et al. 2019;
Pampolini and Rieske 2023). The sensitivity to RNAi in Coleopteran insects is promising as bark
beetle (Coleoptera: Curculionidae: Scolytinae) population growth is supported by warming
climate (Cullingham et al. 2012; Bentz and Powell 2014; Dhar et al. 2016a). Gene function
studies have extensively used microinjection of dsRNA for to initiate RNAi-mediated gene
suppression in D. armandi (Wang et al. 2016; Sun et al. 2021; Liu et al. 2021, 2022; Liu and
Chen 2022). For the SPB, lethality investigations have used ingestion of dsRNA droplets (Kyre
et al. 2019, 2024; Kyre and Rieske 2022). In MPB, RNAi has been initiated in teneral adults
through microinjection and in emerged adults with a combination of oral ingestion and
absorption (Keeling et al. 2013; Kyre et al. 2020; Kyre and Rieske 2022). The ingestion of
dsRNA targeting essential genes elicited a mortality response in emerged adult MPB (Kyre et al.
2020; Kyre and Rieske 2022). The combination of ingestion and absorption of dsRNA by MPB
provides a step towards application as a MPB management tool in forests.
1.4 Proposed research
The MPB is an irruptive, native pest with important roles in forest development. Changes
in climate, including increasing temperatures and drought, are providing ideal conditions for
MPB population increases and consequential range expansion (Coggins et al. 2011; Howe et al.
2021). With naïve forest stands at risk, and increased tree mortality within the historical range,

22

outbreaks impact the ecosystem as well as the local and national economy (Morris et al. 2015;
Corbett et al. 2016; Dhar et al. 2016a; Audley et al. 2020). Combinations of direct and indirect
management strategies have shown success in restraining MPB population numbers, but are
expensive and labor-intensive (Coggins et al. 2011; Fettig et al. 2014). Use of RNAi as a pest
management tool is gaining momentum due to the cost-effective, species-specific nature (Kyre et
al. 2020). Developing an additional tool for forest managers to assist with MPB management is
crucial.
Results from RNAi studies can be impacted by factors such as the targeted insect species
and life stage, the gene targets, and the dsRNA delivery method. Applying a genetic-based
technique to MPB requires knowledge of population genetics due to the speciation history. At
this point, evidence of MPB population structure in Canadian provinces has not been identified
(Cullingham et al. 2012; Shegelski et al. 2021). This study aims to progress the development of
RNAi as a MPB management tool by addressing some of the above-mentioned factors. Different
delivery methods, separated into chapters, will be tested for proof-of-concept and advancing
towards in situ application. This research is the first to test the efficacy of hpRNA-expressing
yeast at initiating the RNAi pathway when orally ingested by adult MPB. In the fifth chapter, the
genome-wide impact of the tested delivery methods on the MPB will be investigated with a
transcriptome analysis. Novel gene targets will be tested throughout the study to identify more
gene targets that can be used for MPB mortality.
This project includes using two different dsRNA sources, provided by Renaissance
BioScience Corp. (RBSC). One source is an in vitro kit-synthesized dsRNA, hereafter referred to
as dsRNA, and the other source is hairpin RNA, hereafter referred to as hpRNA, expressed in a
proprietary RNAi production Saccharomyces cerevisiae strain. The dsRNA and hpRNA was

23

synthesized to individually target six essential genes in adult MPB. Two genes, the inhibitor of
apoptosis (iap) and the heat shock protein (hsp), are stress response genes previously successful
at RNAi initiation in MPB, along with other Coleopteran species (Kyre et al. 2019, 2020;
Leelesh and Rieske 2020). Four additional genes were selected by RBSC: V-type proton ATPase
subunit S1 (vha19), mesh protein (mesh), snakeskin protein (ssk), and tetraspanin 2a (tsp2a).
These genes were selected for their essential functions in molecule transport and gut structure, as
well as success in initiating RNAi in other Coleopteran insects (Baum et al. 2007; Hu et al.
2019). Three target genes: ssk, mesh, and tsp2a code for proteins that form a complex and
localize in the midgut of Drosophila species. Suppression of either one of the genes leads to
defects in the midgut structure and barrier function between cells (Jonusaite et al. 2020). This
complex is a part of the smooth septate junction, which regulates the transfer of molecules in the
intestinal and renal systems of arthropods (Hu et al. 2019). The mesh and tsp2a protein products
are also essential for Malpighian tubule epithelium establishment and function in Drosophila,
with mortality observed within one week of knockdown of tsp2a (Jonusaite et al. 2020;
Beyenbach et al. 2020). The ssk protein product is a membrane protein also involved in barrier
function in the intestines of insects (Hu et al. 2019). The vha19 target gene is predicted to code a
protein essential in the intestine and epidermal structure, with previous RNAi-mediated
suppression causing mortality in Caenorhabditis elegans (Zawadzki et al. 2012). A random
sequence, termed dsRS or hpRS that does not match any transcripts in the MPB transcriptome
(NCBI 2022), was developed by RBSC as a control for dsRNA introduction to MPB.

24

Chapter 2 - Use and evaluation of microinjection as a delivery method for target dsRNA to
initiate the RNAi pathway and test novel gene targets on emerged adult Dendroctonus
ponderosae.
2.1 Introduction
One of the main factors contributing to variable RNA interference (RNAi) efficiency
within and among insect species is the delivery method of the target double-stranded RNA
(dsRNA) (Cooper et al. 2019). Some insect orders, such as Coleoptera, display sensitivity to
orally ingested or absorbed dsRNA as well as to injected dsRNA. Other insect orders only show
gene suppression after injecting the dsRNA (Joga et al. 2016; Singh et al. 2017; Cooper et al.
2019). Microinjecting target dsRNA allows for higher certainty in the amount of dsRNA
delivered and often works with a smaller dose, approximately half of the lowest amount required
in feeding trials, to achieve a phenotypic response (List et al. 2022). Microinjection is a common
first step to test RNAi-mediated target gene suppression (Wang et al. 2016).
The initiation of RNAi using microinjection to deliver the target dsRNA has been used on
adult Dendroctonus species to increase understanding of the roles of specific genes. In Chinese
white pine beetles (Dendroctonus armandi), microinjecting dsRNA led to cytochrome P450 and
an olfactory co-receptor gene suppression (Zhang et al. 2016; Liu et al. 2022; Liu and Chen
2022). Microinjecting dsRNA into D. armandi achieved partial knockdown of a gene assumingly
unique to D. armandi, a type of olfactory receptor coreceptor, named DarmOrco, thought to
allow the olfactory receptor (OR) to assemble into the proper structure (Zhang et al. 2016). The
affected phenotype in the antennal response to odors was observed as D. armandi adults showed
less response to monoterpenes associated with plant hosts (Zhang et al. 2016). Emerged adult D.
armandi were injected with dsRNA for specific cytochrome P450 genes which led to knockdown
25

and increased sensitivity to (+)-α-pinene (Liu et al. 2022). In yet another microinjection study
with D. armandi, dsRNA was injected for successful RNAi initiation and gene suppression (Sun
et al. 2021). Beetle mortality in both injected and non-injected controls was less than in the
treatment groups, indicating that microinjection does not impact D. armandi physiology (Liu et
al. 2022).
The amount of dsRNA injected to achieve mortality or other phenotypic responses varies
depending on the study. A review recently quantified the smallest and largest dsRNA amounts
microinjected in different studies with different target insects that elicited a mortality response as
1.5E-05ng and 20μg (List et al. 2022). Injected amounts of 1.5E-05ng to 1.5E-03ng led to 75%
and 90% mortality in Tribolium castaneum, respectively (Bingsohn et al. 2017). Other studies
investigating the larval stage of T. castaneum injected a range of 500ng to 700ng delivered in
500nL (Linz et al. 2014). Wang et al. (2016) conducted a study with D. armandi larvae injected
with 0.1μM in 50nL of target dsRNA, a volume similar to what is injected in adult beetles. With
such a large difference between those extremes, most Dendroctonus spp. studies report amounts
between 100 - 200ng (Zhang et al. 2016; Sun et al. 2021; Liu et al. 2021, 2022; Liu and Chen
2022).
The targeted insect’s life stage is another source of RNAi variability. Microinjection has
successfully initiated the RNAi pathway in larval and adult insects (Bingsohn et al. 2017; Cooper
et al. 2019; Liu et al. 2021). The effective amount of dsRNA required for insect injection
depends on life stage. Larval D. armandi were injected with half the amount used for adult
injections (Liu et al. 2021). Target gene expression often varies between the larval and emerged
adult stages, impacting suppression success or quantity between the two life stages (Liu et al.
2021, 2022; Liu and Chen 2022). For example, adult D. armandi had suppressed gene expression

26

in two of the three targeted genes whereas larvae exhibited decreased gene expression in all three
target genes (Liu et al. 2021). An RNAi study with the red flour beetle (Tribolium castaneum),
showed similar results that varied with gene targets and beetle life stages (Bingsohn et al. 2017).
Using the amounts and volumes previously successful at initiating RNAi-mediated gene
suppression in the same life stage of a congeneric species as a guide is expected to help eliminate
some of the variables impacting insect response to injected dsRNA.
Microinjections in MPB (Dendroctonus ponderosae) are not as common for RNAi
initiation as they are in D. armandi, but have been successful. Keeling et. al (2013) reported
successful RNAi initiation when teneral adults were injected with 200ng of dsRNA and allowed
to complete development post-injection. The results showed 56–83% survival of injected beetles
and suppressed target gene expression in three diphosphate synthases (Keeling et al. 2013).
Teneral adults are a life stage right before emerged adults, and as such, emerged adult MPB may
exhibit different responses to microinjection. Additionally, targeting a gene that is intended to
have a lethal impact is another potential variable in MPB response compared to the previous
knockdown study.
The first objective of this study was to use microinjection to deliver dsRNA to emerged
adult MPB, testing the lethality of the six gene targets: inhibitor of apoptosis (iap), heat shock
protein (hsp), V-type proton ATPase subunit S1 (vha19), tetraspanin 2a (tsp2a), mesh protein
(mesh), and snakeskin (ssk). Two genes iap and hsp are stress response genes and have
previously elicited a lethal response in adult MPB (Kyre et al. 2020). The gene targets mesh, ssk,
and tsp2a form a protein complex in the midgut, and singular knockdown of tsp2a and mesh has
proven lethal to Drosophila melanogaster (Jonusaite et al. 2020; Beyenbach et al. 2020).
Suppressing the D. melanogaster gene ssk homolog in Diabrotica virgifera virgifera caused

27

larval mortality (Hu et al. 2019). Lastly, vha19 gene suppression in Caenorhabditis elegans and
Haemonchus contortus resulted in mortality (Zawadzki et al. 2012). The second objective is to
use microinjection to test the lethal specificity of MPB-specific dsRNA that matches the
sequences of MPB mRNA (MPB-dsRNA) on a congeneric species, the Douglas-fir beetle
(Dendroctonus pseudotsugae, DFB). The final objective is to test different concentrations of
dsIAP, termed a kill curve, in eliciting an RNAi response when microinjected into MPB. In all
repetitions of microinjection assays testing the six individual gene targets and dsIAP kill curve,
adult MPB and DFB mortality was high in the injection negative controls (water and dsRS) and
the injected dsRNA treatment groups. This was further corroborated by higher survival observed
in the non-injection control group. Gene expression analysis of one repetition showed a
potentially suppressed target gene, but it was not statistically significant and this finding was not
supported in the gene expression analyses of the other repetitions. The high rate of mortality in
all injected beetles, regardless of the injected liquid, indicates that microinjection is too invasive
and supports the use of other methods to test RNAi in emerged adult MPB.

28

2.2 Methods
Success of the microinjections will be based on the comparison of the survival of beetles
in the target groups to the negative control groups. To ensure that the mortality can be linked to
targeted gene suppression, gene expression will be quantified using digital droplet PCR
(ddPCR).
2.2.1 Subject collection
Lodgepole pine (Pinus contorta) trees were baited to attract MPB by the British
Columbia Ministry of Forests (BC MOF). Once successful colonization was confirmed, the
infested trees were cut down in early spring and shipped to the University of Northern British
Columbia (UNBC) campus in Prince George, British Columbia. The tree segments were then cut
into smaller pieces, or bolts, with a length of roughly 120cm for easier management and storage.
The ends of the bolts, and any areas where bark was missing, were covered with paraffin wax to
maintain the phloem moisture levels. Once the wax was set, the bolts were placed in plastic totes
with mesh-covered holes cut into the lids and sides to incorporate air flow while containing
emerging MPB adults. Totes were stored in a non-heat regulated shed in the yard of the
Enhanced Forestry Lab (EFL) on campus (Figure 2.1A-B). Exceptions to the storage were made
for thinner trees received from the Kootenays, B.C., that were left in longer segments and placed
in a mesh tent outside the shed due to space limits and the dry condition of the wood upon
delivery. Bolts were monitored regularly before the expected flight period. During the flight
period bolts were checked daily and emerged beetles collected, so collection dates are assumed
to be the same as the emergence dates. In 2022, bolts from Smithers, B.C. were used for assays
in sections 2.2.3, and 2.2.4. In 2023, bolts from Smithers, B.C., provided adult MPB for assays in
sections 2.2.5, 2.2.6, and 2.2.7.

29

A congeneric bark beetle, the Douglas-fir beetle (Dendroctonus pseudotsugae; DFB) was
live-trapped using pheromone-baited Lindgren funnel traps. Traps were set up at three locations
on the University of Northern British Columbia Prince George campus. Traps were baited with
the 3187 Douglas-fir beetle lures with three components: seudenol-frontalin, kairomone, and LR
ethanol (Synergy Semiochemicals Corp., 2023). The traps and lures were set up in areas with
low to no mature Douglas-fir trees around campus (Figure 2.1C). Traps were checked and DFB
collected daily, so collection dates are assumed to be within a few days of emergence.
A)

C)

B)

Figure 2.1 Subject collection methods. A) Mountain pine beetle-infested bolts in a modified plastic
tote. B) Totes containing MPB-infested bolts stored in non-temperature regulated shed at the Prince
George University of Northern British Columbia (UNBC) campus. C) Lindgren funnel trap with
Douglas-fir beetle lure components (seudenol-frontalin, kairomone, and LR ethanol) to attract and
collect live Douglas-fir beetles on UNBC Prince George campus.

30

2.2.2 Gene target dsRNA
This study tested two forms of dsRNA. The first was in vitro kit-synthesized long-dsRNA
(hereafter referred to as dsRNA). The dsRNA was synthesized to individually target six essential
genes (iap, hsp, vha19, tsp2a, mesh, and ssk) in adult MPB, with lengths of specific dsRNA
ranging from 200-341 nucleotides long (Tabe 2.1). The random sequence dsRNA, dsRS,
produced and provided by RBSC is 200bp long and does not match any transcripts in the MPB
transcriptome. The location of the long dsRNA within the gene sequence is provided (see
Appendix, Table S1).
Table 2.1 Information on the long dsRNA synthesized to target six essential genes in mountain pine
beetle (Dendroctonus ponderosae).

dsRNA
dsIAP
dsHSP
dsVHA19
dsTSP2A
dsMESH
dsSSK
dsRS

Length (nucleotides)
341
315
200
231
218
200
200

Accession
XM_019910372.1
XM_019906797.2
XM_019903780.2
XM_048663791.1
XM_048661387.1
XM_048663913.1
NA

The second form was heat-inactivated, hpRNA-expressing yeast (hereafter referred to as
hpRNA). The Saccharomyces cerevisiae strain used is a RBSC proprietary RNAi production
strain, and the hpRNA is genetically encoded through a sense-loop-anti-sense design which is
cloned between a constitutive yeast promoter and terminator in the pRS426 vector. The yeast
biomass, with the hpRNA encapsulated, was harvested by centrifugation, washed, heat killed
(75ᵒC for 5 minutes) and freeze dried. The stem of the hpRNA is the same length as the dsRNA
(Table 2.1) with the loop being approximately 80 nucleotides long between the inverted repeats

31

of the stem. Only the double-stranded (stem) region will be processed by dicer in the RNAi
pathway.
2.2.3 Microinjection Delivery Trial Method
All microinjections were performed using the UltraMicroPump3 with MICRO2T and
Microliter syringes (Hamilton; World Precision Instruments). We tested two different needles,
angled and side-delivery (Hamilton 7758-04: (26/2”/2)S and 7784-07: (26s/2”/5)S) to determine
the better needle for liquid delivery into adult MPB. The side delivery needles dispense the liquid
from a small hole in the side of the needle rather than at the tip like in the angled needles. Ten
beetles were assigned to each treatment group: control (no injection), angled needle, and sidedelivery needle. The age of beetles, based on collection dates, were kept as even as possible
among groups. Beetles were placed in a petri dish on ice prior to injection to anesthetize them
(Liu et al. 2021). Entomology forceps were used to immobilize one MPB at a time on an ice
block placed under a dissection microscope (Figure 2.2). The beetles were injected between the
second and third abdomen compartments, in-between the rear-most pair of legs, with 50nL of
distilled water (Zhang et al. 2016; Wang et al. 2016). To ensure room for the liquid, the needle
was inserted and slightly drawn back before injection (Linz et al. 2014). After injection, beetles
were placed in petri dishes with moistened filter paper and kept in a refrigerator at approximately
10°C to slightly reduce beetle activity after injection, aiming to allow the injection site to heal.
Beetles in the no-injection control group were placed directly into a petri dish with moistened
filter paper at approximately 10°C. MPB mortality was monitored daily, allowing beetles to
acclimatize to room temperature for approximately 20 minutes before checking mortality.

32

Figure 2.2 Microinjection set up using UltraMicroPump3 with MICRO2T and
Microliter syringes (Hamilton; World Precision Instruments). Emerged
adult mountain pine beetles (Dendroctonus ponderosae, MPB) are placed
on an ice block, immobilized with entomology forceps, and injected
between the second and third abdomen compartments.

2.2.4 Microinjection to Test Six Targets on Emerged Adult Mountain Pine Beetles (2022)
Following the microinjection trial (section 2.2.3), target in vitro synthesized dsRNA was
injected into adult mountain pine beetles (MPB) using the angled needles (Hamilton 7758-04:
(26/2”/2)S). Fifteen adult MPB were assigned to each treatment or control group: no-injection
control (beetles are not injected with anything), injected with distilled water, double-stranded
random stem (dsRS; does not match any transcript in the MPB transcriptome), dsIAP, dsHSP,
dsMESH, dsSSK, dsVHA19, and dsTSP2A. Beetle emergence dates in each group were kept as
close as possible, with each group composed of beetles from a three-week emergence range.
Within each experimental group, ten beetles were randomly selected for mortality observations
after treatment, and five beetles were assigned to be flash frozen 24h post-injection for gene
expression analysis. Each target dsRNA was diluted in RNase-free water to a concentration of
1μg/μl. Syringes and needles were changed between treatment groups, when possible, but due to
33

limited materials syringes were re-used after rinsing with water five times. Injection followed the
procedure outlined in the trial: beetles were placed on ice prior to injection, then immobilized on
an ice pack under a dissection microscope and injected between the second and third abdominal
segments. Each beetle was injected with 50nl, equating to 50ng of target dsRNA. After injection,
beetles were placed in a petri dish with moistened filter paper on ice. Once the fifteen beetles for
one target gene were injected, the petri dishes were placed in a fridge at approximately 10°C to
slightly reduce activity after injection. Beetles frozen for the gene silencing subset were flash
frozen in liquid nitrogen 24h post-injection and stored at -80°C. The mortality subset of beetles
was monitored daily; the moistened filter paper was changed every 48h or as needed (Kyre et al.
2020). Beetles were left at room temperature for approximately 10 minutes before mortality
counts. All adult MPB still alive 15 days post-injection were flash frozen in liquid nitrogen and
stored at -80°C.
2.2.5 Repetition of Microinjection to Test Six Targets on Emerged Adult Mountain Pine
Beetles (2023)
Following the microinjection trial (section 2.2.3), emerged adult mountain pine beetles
(MPB) were injected with 50nl of 1μg/μl target in vitro synthesized dsRNA within a week of
emergence. Prior to injection, adult MPB were sexed using auditory examination, where males
chirp when pressure is applied to the margins of the pronotum with thumb and forefinger
(Rosenberger et al. 2016). For increased accuracy, all beetles that did not chirp were re-tested to
catch formerly silent males (Rosenberger et al. 2016). Adult MPB were assigned to each
treatment group: no-injection control, dsRS, dsIAP, dsHSP, dsMESH, dsSSK, dsVHA19, or
dsTSP2A, keeping the collection dates of beetles in each group as similar as possible with each
group having an emergence day range of four days (four days for repetition one, two days for

34

repetition two, three days for repetition three). Within each group, ten beetles were randomly
assigned to mortality observations after injection, while five beetles were randomly assigned to
gene expression analysis. Males and females within each group were kept separately. Unlike in
the previous assay, after injection, beetles were placed in petri dishes lined with moistened filter
paper and stored vertically at 4°C for 72h, in an attempt to reduce activity during healing, then
moved to 11°C for the remaining duration of the assay. Beetle mortality was monitored daily and
filter paper changed every 48h or as needed. Beetles in the gene expression analysis group were
flash frozen in liquid nitrogen 72h after injection and stored at -80°C. This assay was repeated
two more times for a total of three repetitions.
2.2.6 Mountain Pine Beetle Microinjection iap Kill Curve
Optimal dosage of target dsRNA to elicit an RNAi response in injected adult mountain
pine beetles (MPB), will be determined using a “kill curve” assay with a three-step concentration
gradient of injected dsIAP. Beetles were sexed by auditory examination and assigned to one of
six treatment groups: no-injection control, H2O, dsRS (1.9μg/μl), dsIAP1 (1μg/μl), dsIAP2.5
(2.5μg/μl), dsIAP5 (5μg/μl). Within each treatment group, five males and five females were
assigned for mortality observation while three males and three females were assigned for gene
expression analysis. Males and females in the mortality observation groups were kept in separate
petri dishes. The previously outlined microinjection protocol was followed (section 2.2.3).
Beetles were injected with 50nl of liquid, equating to 50ng of dsRNA in dsIAP1, 125ng in
dsIAP2.5, and 250ng in dsIAP5. Beetles in the gene expression analysis group were flash frozen
in liquid nitrogen 48h after injection. Each assay was repeated three times and each repetition
consisted of beetles collected on the same day (repetition 1: June 25, repetition 2: June 26,
repetition 3: June 27) with testing done seven days after collection.

35

2.2.7 Microinjection of Douglas-fir Beetles, an Off-target Species, with Mountain Pine
Beetle Targets
The efficacy of the MPB-dsRNA was tested on an off-target, congeneric bark beetle
species, the Douglas-fir beetle (DFB). A BLASTn search was performed, but not informative as
to the sequence similarity among the MPB targets and DFB sequences as only cytochrome c
oxidase subunit I (COI) sequences are represented for DFB in NCBI (NCBI 2025). The collected
adult DFB were sexed based on elytral declivity (Jantz and Johnsey 1964). Beetles were assigned
to one of eight treatment groups: no-injection control, dsRS, dsIAP, dsHSP, dsSSK, dsMESH,
dsVHA19, or dsTSP2A. Within each treatment group, ten beetles (6 females, 4 males) were
assigned to the mortality observation group and five beetles (3 females, 2 males) were assigned
for gene expression analysis. Beetles were treated no longer than seven days after collection,
typically within 3-4 days. In vitro synthesized dsRNA was diluted to a concentration of 1μg/μl.
Adult DFB were injected with the same method and amount of dsRNA as adult MPB (section
2.2.3). Once injected, or immediately for the no-injection group, beetles were placed in a petri
dish lined with moistened filter paper and stored vertically at approximately 4°C for 72h, then
moved to approximately 11°C. Beetles were monitored daily for mortality, and the filter paper
replaced every 48h or as needed. Beetles in the gene expression group were flash frozen 72h
after microinjection and stored at -80°C. The assay was repeated three times. Entomopathogenic
fungal growth became a challenge, and impacted beetles were isolated into a separate petri dish
to try and prevent the spread to other beetles. The start of the fungal outbreak was recorded.

36

2.2.8 Gene expression analysis
2.2.8.1 RNA Extraction and cDNA synthesis
RNA was extracted from silencing beetles (n=5-6) using the RNeasy Plus Mini Kit
(Qiagen, Toronto, ON). The kit protocol was followed, using the entire adult beetle for
extraction. As an additional step, the QIAshredder (Qiagen, Toronto, ON) was used to further
homogenize the sample before the gDNA eliminator step. RNA was eluted twice with 50μl of
water each time. The first elute was used for downstream applications.
Eluted RNA was quantified with the Qubit 4 Fluorometer Broad Range RNA assay
(Thermo Fisher Scientific Inc., 2015) using 2-3μl of sample in 197-198μl of working solution.
The integrity of the RNA samples was determined using the Agilent RNA 6000 Nano Kit on the
Agilent Bioanalyzer 2100 (Agilent, Santa Clara, CA). This software allows for a quantification
of RNA integrity with an RNA Integrity Number (RIN), based on 18S and 28S peaks. However,
this value is not reliable for insect RNA as there is an endogenous break in the 28S rRNA
(Fabrick and Hull 2017). Heat-denaturing the samples at 70°C prior to running the RNA 6000
Nano chip causes the hydrogen bonds in the 28S break to dissociate, creating two peaks of
similar size that migrate closely to the 18S rRNA (Fabrick and Hull 2017). Thus, the RNA
quality was visually assessed using the electropherogram for each sample, showing little to no
degradation and the two peaks close together.
Samples that were assessed to be of good RNA quality were selected for the downstream
applications, starting with cDNA synthesis. The cDNA was synthesized using the iScript™
Reverse Transcription Supermix (Bio-Rad Laboratories (Canada) Inc., Mississauga, ON),
following the kit protocol. Input RNA, normalized to 500ng, was added to 4μl of the supermix,
and the reaction volume topped off to 20μl with nuclease-free water. Each treatment group

37

included a no-reverse transcriptase control (no-RT), where a supermix without RT replaced the
normal supermix in the protocol above, to ensure there was no DNA contamination in this step.
The samples were run through the following incubation steps: 25°C for five minutes, 46°C for 20
minutes, and 95°C for one minute. After the incubation, the synthesized cDNA was diluted 1:10
with TE buffer and stored at -20°C.
2.2.8.2 qPCR Assay and gBlock design
PrimeTime Std qPCR assays were designed for all six gene targets (iap, hsp, mesh,
vha19, tsp2a, and ssk) and for dsRS. These sequence-specific primers were designed using
PrimerQuest®, the Integrated DNA Technologies (IDT) primer design tool (IDT 2023). The
output of primers and probes were subjected to a BLASTn search to further confirm specificity
to the MPB transcriptome (NCBI 2023). Assays were designed outside of the dsRNA region,
spanned an exon-intron boundary, with the exception of iap that did not contain introns, and
were optimized for 60°C. Assays for the housekeeping or reference genes RNA Polymerase II
(RPII) and porphobilinogen deaminase (PBD), as internal controls were designed using the same
method as the six gene target assays (Table 2.2). Each target assay was resuspended to a
concentration of 20X and the reference gene assays were resuspended to a concentration of 40X
as per supplier protocol (IDT 2023).
A gBlock is a DNA sequence containing the primer and probe sequences for each of the
six gene target assays. The gBlock acts as a positive control for the digital droplet polymerase
chain reaction (ddPCR). The designed gBlock (IDT gBlocks™ Gene Fragments Entry 2023) was
resuspended as per the provided protocol. From the suspended concentration, the theoretical
copy number was used in a serial dilution. The diluted target gBlock was combined with the
diluted gBlock containing the primer and probe sequences for the two reference genes. For each

38

theoretical copy number value in the serial dilution of the target gBlock, the corresponding same
theoretical copy number value for the reference gBlock was mixed in.
Table 2.2 Primer and probe sequences for target genes and reference genes used in digital droplet PCR
(ddPCR) for expression analysis in adult mountain pine beetles (Dendroctonus ponderosae, MPB) after
dsRNA exposure.
Gene

Primer

Sequence

RPII

RPII - F
RPII - R
Probe
PBD - F
PBD - R
Probe
dsRS - F
dsRS - R
Probe
iap -F
iap - R
Probe
Hsp -F
Hsp – R
Probe
Tsp2a - F
Tsp2a - R
Probe
vha19 – F
vha19 – R
Probe
Mesh - F
Mesh - R
Probe
Ssk - F
Ssk - R
Probe

GACGTTGGAGCAGTTCAAAGAG
GGAAGAACACGAACATCTGGTC
/5HEX/CGACAAACC/ZEN/CAGCGAGAAGAGCG/3IABkFQ/
GGCTTCAATGTGTGTCCAGTG
CACCAAACCAACGAAAAGATGTTC
/5HEX/CGCCAATCT/ZEN/TATCACCGTTGCCG//3IABkFQ/
GGCAGTTAAAGTCGGGAGAATAG
TATCTAAGAGCCAGAGGGATGG
/56-FAM/CCGCAACAC/ZEN/ACAGTTTACCGCATT/3IABkFQ/
GGCCTTATTGGAGGCATCTT
TTGGCGATCTCTCGGTTTG
/56-FAM/ATCCGGGTA/ZEN/GATTGCGGACATTCG/3IABkFQ/
GAAACTGCCGAGGCTTACTT
ACGGTCATACCAGCAATGATAC
/56-FAM/AGCGTCGTT/ZEN/GAAATAAGCAGGCAC/3IABkFQ/
CCATGCTCGTCGCCTTTATTA
GGTAGGTGTCAGCTTGTTCTTC
/56-FAM/TGCTTGGAT/ZEN/GAGGACAATAGAAACGACC/3IABkFQ/
AGTTCAACCAACGTCCTACAG
AGCCCAGACCAAATTGGAATA
/56-FAM/CGACTCCCA/ZEN/GGACCAGGTCATCTA/3IABkFQ/
GAAGGAGGAGTTCCAGCTTATG
GCGTAACCTCGTCCAGATAAAT
/56-FAM/ACGGCACAA/ZEN/GAAGTTGGGAGTACA/3IABkFQ/
GCACTACTGGCATGGTTATCT
ATGACGCTATCAACGAGGTAAA
/56-FAM/AAGACAGGT/ZEN/TGGTCTCGCTTTGGG/3IABkFQ/

PBD
dsRS
iap
hsp
tsp2a
vha19
mesh
ssk

2.2.8.3 Linear Dynamic Range Determination and Assay Optimization
All six assays were run on a temperature gradient to confirm the optimal annealing
temperature. The temperature range used to test the assays was 52°C -62°C. An initial test was
performed to ensure that each of the six gene target assays worked well when duplexed with each

39

reference gene. Each gene assay was run twice, duplexed once with each housekeeping gene.
The annealing temperature for future assays was set to 58°C.
To set the linear dynamic range (LDR) of digital droplet polymerase chain reaction
(ddPCR), both reference genes were run individually with serial dilutions of the mixed gBlock
containing primer and probe sequences for all six gene targets and the two reference genes. A
range of 400,000copies/μl to 0.4copies/μl in 10-fold dilutions were run with the iap assay
duplexed with each reference gene in duplicate.
2.2.8.4 Digital Droplet PCR Conditions
With the ddPCR conditions tested and optimized, the frozen beetle cDNA for gene
expression analysis was run with the reference genes. Assays were run in duplex, pairing each
target assay with a reference gene. A no-template control (NTC) and positive control using water
and the mixed gBlock, respectively, was run with each assay combination. Each beetle’s cDNA
was run twice for the target of interest, with a different reference gene each time. This allowed
for duplicated runs of the gene of interest for each biological repetition, and for each reference
gene to be used once on each biological repetition.
A master mix was made for each assay combination, consisting of reagent amounts for a
total volume of 24μl per well for as many wells as planned. Each well contained 12μl 2X
Supermix for probes with no dUTPs (Bio-Rad Laboratories (Canada) Inc., Mississauga, ON), 1μl
of the respective gene target, 0.5μl of the respective reference gene, 2.4μl of sample, and 8.1μl of
water to reach 24μl total volume. A no-template control (NTC) was included to ensure that there
is no contamination in the reagents and a positive control was included to ensure that the
reagents were working. For the NTC and positive controls, the sample was replaced with water
and gBlock, respectively.
40

Once loaded, the plate was sealed and placed in the Automated Droplet generator (BioRad Laboratories (Canada) Inc., Mississauga, ON). About 20,000 droplets are made per well,
and the new plate was sealed and placed in a thermocycler at the following conditions: 95°C for
10 minutes to activate the polymerase, followed by 45 rounds of 95°C for 30 seconds
(denaturation step) and 58°C for one minute (annealing step). The 45 rounds were followed by
98°C for 10 minutes to deactivate the enzymes and remained at 4°C until removed from the
thermocycler. The droplet reader was used to obtain the end-point quantification of the
amplification, and results were viewed with QX Manager Software Standard version 1.1 (BioRad Laboratories (Canada) Inc., Mississauga, ON).
2.2.8.5 Statistical Analysis
The droplet count data was processed, visualized, and initially analyzed by the QX
Manager Software and the manual baseline set around 2000 to ensure negative or incomplete
amplification droplets were not included in the positive droplet count. Once all wells were
clearly quantified, data was exported in a CSV file. For each sample, each value of the target
gene was normalized to the reference genes: the average of the two target gene counts was
divided by the geometric mean of the reference gene counts (Livak and Schmittgen 2001;
Vandesompele et al. 2002; Zmienko et al. 2015). The resulting relative gene expression data was
log2 transformed before statistical analysis for improved data distribution, symmetry, and easier
interpretation (Rieu and Powers 2009; Taylor et al. 2017). Once transformed, data was checked
for normality. If data was normally distributed, a parametric test comparing means was
performed. If only two means, or two treatment conditions (i.e. one control and one test) were
being compared, a Student’s two-sided t-test was performed. This allowed detection of upregulation as a potential response to dsRNA delivery (Zawadzki et al. 2012; Haller et al. 2019;

41

Wallace and Rieske 2023). If more than two means, or treatment groups (i.e. two controls and
two tests) were being compared, a one-way ANOVA test was used, followed by a Tukey HSD
test if the ANOVA test was significant (p < 0.05). For the experiments where the data was not
normally distributed, the Student’s t-test was replaced with the Mann-Whitney U test and the
ANOVA test was replaced with the non-parametric Kruskal-Wallis test followed by the Dunn’s
test if significant (p < 0.05). Data analysis was performed in R Statistical Software (v4.3.1; R
Core Team 2023). Data was visualized using a boxplot showing the gene expression in a log2
base scale of the target gene relative to the geometric mean of the two reference genes with the
“ggplot” package (Wickham 2016).

42

2.3 Results
2.3.1 Microinjection Trial
In the microinjection trial, the angled needles were more effective than side-delivery
needles for adult MPB injections. The side-delivery needles were relatively blunt, making it
difficult to penetrate the exoskeleton. The side-delivery needles also needed to be injected farther
into the beetle to ensure liquid delivery, which increased the invasiveness of the procedure.
Survival of the beetles was 70% at seven days post-injection for the angled needles, like
the no-injection control group, and 40% for the needles with a side-delivery. However, after
seven days, the mortality rate increased for the angled needles, with no survival by 13 days postinjection. In contrast the survival rate of the beetles injected with the side-delivery needle and the
no-injection control groups were at 20% survival 13 days post injection (See Appendix, Figure
S1).
2.3.2 Six targets on emerged MPB adults (2022)
All targets showed high mortality 14 days after microinjection; dsVHA19, dsSSK and
dsIAP showed 100% mortality by day 14. However, the negative controls showed high levels of
mortality by day 14 as well, with 50% survival in the no-injection control, 100% mortality in the
beetles microinjected with water, and 10% survival in those microinjected with dsRS (Figure
2.3).

43

Figure 2.3 Percent survival over 14 days of emerged adult mountain pine beetles (Dendroctonus
ponderosae, MPB) microinjected with 50ng of target double-stranded RNA (dsRNA) for six gene targets
(n=10): dsIAP, dsHSP, dsVHA19, dsTSP2A, dsMESH, and dsSSK. The survival of three negative
controls: no-injection control (no_inj_control), water (H2O), and a double-stranded random stem (dsRS)
was plotted alongside for comparison.

2.3.2.1 Gene Expression Analysis: RNAi pathway initiation for the iap gene target
The mean relative iap gene expression of the dsRS injected group is higher than the other
three treatment groups (Figure 2.4). The data conformed to a normal distribution after a log2
transformation. A one-way ANOVA test was conducted to statistically compare the means
among the different treatment groups, and results show there is significant difference between
the mean of at least one of the treatment groups (p = 0.00242, df = 3, F = 7.455). Using Tukey’s
post hoc test, the dsRS injected group mean log2 relative iap expression was significantly higher
than the non-injection control, the water, and the dsIAP groups (p = 0.009, p = 0.04, and p =
44

0.002, respectively) (Figure 2.4). There are no significant differences of the mean iap gene
expression between beetles in the non-injected control group, the water group, or the dsIAP
group.

Figure 2.4 Comparison of the mean (n=5) of the log2 transformed relative iap gene expression between
the dsIAP and control groups 24h post-microinjection. Statistical analysis using a one-way ANOVA
indicated that the iap gene expression in the double-stranded random stem (dsRS) treatment group is
significantly different compared to the other three group means (p = 0.00242, df = 3, F = 7.455).

2.3.3 Six targets on emerged MPB adults (2023)
The percent survival remained high for the first seven days post-microinjection. The noinjection survival rate remained above 80% for the duration of the assay, while the other negative
control, dsRS injection, showed survival rates similar to the gene target treatments (Figure 2.5).
At the end of the assay, the lowest survival rate was observed in the dsTSP2A treated beetles. In
all other targets there was over 50% survival of beetles at ten days post-microinjection.

45

Figure 2.5 Mean average percent survival (± 1SE) over 14 days of adult mountain pine beetle
(Dendroctonus ponderosae, MPB) microinjected with 50ng of double-stranded RNA (dsRNA) for six
gene targets (n=10): dsIAP, dsHSP, dsVHA19, dsTSP2A, dsMESH, and dsSSK. The survival of the
negative controls (n=10), no-injection control (no_inj_control) and double-stranded random stem (dsRS),
were recorded and plotted alongside for comparison.

2.3.3.1 Gene Expression Analysis: RNAi pathway initiation for iap and tsp2a gene targets
After a log2 transformation, the data was normal allowing for use of the parametric oneway ANOVA test to compare the group means. There was no significant difference in tsp2a gene
expression among treatment and control groups (p= 0.581, df = 2, F = 0.569) (Figure 2.6A).

46

Similarly, there was no statistically significant difference among the group means for iap gene
expression (p= 0.916, df = 2, F = 0.088) (Figure 2.6B).

Figure 2.6 Comparison of the mean (n= 5) log2 difference of log2 target gene expression
between treatment and control groups 72h post-microinjection. Statistical analysis using the
one-way ANOVA test showed no significant difference among group means. A) tsp2a gene
target, p= 0.581, df = 2, F = 0.569 B) iap gene target, p= 0.916, df = 2, F = 0.088

2.3.4 MPB iap Kill Curve
By day seven, the percent survival in all injected groups (H2O, dsRS, dsIAP1, dsIAP2.5,
and dsIAP5) was below 25% (Figure 2.7). The no-injection control group had an average percent
survival above 50%. The group with the lowest survival rate was dsIAP5, with 250ng of dsIAP
delivered. This was followed by the two negative control groups of water and dsRS. The two
negative control groups that were injected with non-target liquids had low mean adult MPB
survival (Figure 2.7).

47

Figure 2.7 Average percent survival (± 1SE) over seven days of adult mountain pine beetle
(Dendroctonus ponderosae, MPB) microinjected with dsIAP at three concentrations (n=10): 50ng
(dsIAP1), 125ng (dsIAP2.5), or 250ng (dsIAP5). The survival of the negative controls, no-injection
control (no_inj_control), double-stranded random stem (dsRS), and water (H2O) were plotted
alongside for comparison

2.3.5 Microinjection of Douglas-fir Beetles, an Off-target Species, with Mountain Pine
Beetle Targets
After seven days, no large amount of mortality was observed in any of the treatment
groups (Figure 2.8). The survival of the non-injected DFB is higher than all the other treatment
groups, remaining above 75% for 16 days. The dsRS negative control survival is similar to the
survival in the gene target treatment groups. The gene target groups dsIAP, dsSSK, dsVHA19,

48

dsMESH, and dsTSP2A show survival rates of 10% or lower by 18 days post-injection (Figure
2.8). Around day eight, entomopathogenic fungi began to appear on some beetles.

Figure 2.8 Average percent survival (± 1SE) of adult Douglas-fir beetles (Dendroctonus pseudotsugae,
DFB) over 18 days microinjected with 50ng of dsRNA for six gene target MPB-dsRNA (n=10): dsIAP,
dsHSP, dsVHA19, dsTSP2A, dsMESH, and dsSSK. Average percent survival of the negative controls, noinjection control (no_inj_control) and double stranded random stem (dsRS, does not match any transcript
in the mountain pine beetle transcriptome), was plotted for comparison.

49

2.4 Discussion
2.4.1 Microinjection Trial: needle selection
Needle type affects microinjection success. In the first eight days post-injection, the
beetles injected with the angled needle showed similar survival with the non-injected control
beetles, but after eight days exhibited increased mortality. Meanwhile the beetles injected with
the side-delivery needle matched the non-injected control mortality starting after eight days (See
Appendix, Figure S1). However, the side-delivery needle caused more mortality than the other
two treatments in the first eight days. With a blunt end, the side-delivery needle did not easily
pass through the exoskeleton of the beetles, making the injection longer and more difficult.
Additionally, the liquid delivery was variable because the opening was not at the tip; this
required invasive insertion of the needle into the beetle. The angled needle was therefore selected
for subsequent target dsRNA delivery as it caused less initial mortality and allowed a less
invasive injection compared to the blunt side-delivery needle (Linz et al. 2014).
2.4.2 Mountain pine beetle microinjections
2.4.2.1 Adult MPB mortality obscured by negative control mortality
The first adult MPB injection experiment showed high mortality in all beetles injected,
regardless of whether they were injected with target dsRNA or the negative controls of water
(H2O) and dsRS (Figure 2.3). The only negative control group that maintained high survival was
the group that was not injected at all. These mortality observations may be influenced by random
mortality, although the same mortality trend was observed in subsequent repetitions (Figure 2.5).
The mean mortality of the control group injected with dsRS is once again right in the middle of
all the treatment groups, with just above 50% survival (Figure 2.5). Microinjecting 50ng of
dsRNA into adult MPB is lower than the 150-200ng used in D. armandi microinjections in
50

previous literature, but any evidence of a potential phenotypic response or gene suppression was
obscured by the high mortality.
2.4.2.2 Gene expression analysis: target gene suppression is not apparent in most
repetitions
As with mortality, gene expression analyses did not reveal a difference among the
treatment and control groups. Visually, the iap gene expression in the beetles injected with water
looks slightly higher than the non-injection and dsIAP group, indicating that the injection method
may be a stressor for the beetles. The significant increase of mean log2 iap expression in the
dsRS group was unexpected, and can provide support for a MPB stress response to
microinjection. Another explanation could be that dsRS is impacting MPB physiology. In a study
on Adalia bipunctata and Coccinella septempunctata, mortality has been observed in beetles
treated with a dsRNA-based control (dsGFP) that does not match any transcripts, attributed to a
general immune stimulation or overwhelmed RNAi system (Haller et al. 2019). Increases in gene
expression have been shown in target genes after dsRNA delivery (Turner et al. 2006; Haller et
al. 2019). Though the reported increase in gene expression responses in the previous studies were
in insects treated with target dsRNA, and not a negative control dsRNA, this may indicate that
the expression of iap is increased after injection with any dsRNA sequence. The inclusion of a
water control shows that the injection of dsRNA is not the main factor causing mortality, as
beetles injected with just water show similar mortality. Therefore, it is possible that the gene
expression increase in the dsRS group was not enough to cause a phenotypic response, but
highlights a possible interaction. As a stress response gene, iap inhibits apoptosis, or cell death
by blocking specific enzymes involved in the process (Verhagen et al. 2001). Up-regulation of
iap in MPB larvae has been found as a response to stressful stimuli, such as overwintering

51

(Robert et al. 2016). If the dsIAP group is assumed to have had the same initial increase in iap
expression as the dsRS group, the iap gene may have been suppressed, thus reducing the relative
gene expression back to baseline levels (Figure 2.4). An increase followed by a decrease in gene
expression after dsRNA exposure has been reported when targeting the EposPBP1 gene in light
brown apple moths (Epiphyas postvittana) (Turner et al. 2006). Additionally, fluctuating gene
expression levels over a five day duration, with a decrease from day one to day three and
increase from day three to day five was reported in Coccinella septempunctata when targeting C.
septempunctata vATPase A and Diabrotica virgifera virgifera vATPase A (Haller et al.
2019).Though the gene expression responses occurred over a longer time period than captured in
our study, an iap gene allele in northern MPB populations has efficient up-regulation, and could
account for the fast response in iap expression (Horianopoulos et al. 2018). The iap gene target
was selected for gene expression analysis as it was previously suppressed in adult MPB (Kyre et
al. 2020) and, as such, iap has been treated as a positive control for the assays in this study.
The findings from the second bioassay quantifying tsp2a and iap expression disagree
with the iap assay response in the first bioassay. The mean relative log2 iap expression looks
fairly similar among the three treatment groups (Figure 2.6B). These new repetitions do not show
increased iap gene expression in the dsRS group, contradicting the inferred results from the
initial assay. Sampling time point may affect gene expression analysis (Zhao et al. 2015; Sun et
al. 2021; Liu et al. 2022; Liu and Chen 2022). In previous studies on Agrilus planipennis, no
gene suppression was observed 24h post-injection, but was found from day two to day six (Zhao
et al. 2015). Other studies in D. armandi found the RNAi mediated gene suppression 24h postinjection, but saw further decreases in gene expression by 72h post-injection (Liu et al. 2022). In
D. ponderosae, the suppression has been detected 17 days after teneral adults were injected

52

(Keeling et al. 2013). In this study, no difference in gene expression between control and
treatment groups was observed at 24h or 72h post microinjection.
2.4.3 Increased dosage of dsRNA showed similar responses to previous assays
The kill curve tested the amount of dsRNA for iap in a range previously successful at
initiating an RNAi response both in relative gene expression and phenotype in D. armandi (Sun
et al. 2021; Liu et al. 2022; Liu and Chen 2022). The resulting average mortality from the three
kill curve assays corroborates the previous mortality observations with all targets. The mortality
rate of the beetles in this kill-curve microinjection experiment appeared more rapid in all
treatment and control groups than what was observed in the other microinjection bioassays. All
injected beetles, regardless of treatment, showed 75-90% mortality. It is important to note that
the non-injected beetle survival was also lower in these assays than in previous ones. This
indicates that there may have been other variables impacting the mortality of the injected beetles
as well. Physiological differences between reared and caught insects have been noted, including
body size and energy reserves (Huho et al. 2007). Although the MPB in the bioassays were
sourced from wild population larvae, they were captured upon emergence and did not have a
flight period, much like laboratory-reared insects. However, these physiological differences
would be impacting all the tested MPB, and survival of the non-injected control in the initial
microinjection bioassay remained high (Figure 2.5). A major difference between the bioassay
trials is that the adult MPB used in these bioassays emerged weeks later in the emergence period
than the MPB in the previous microinjection bioassays. This suggests that delayed emergence
could be connected to decreased fitness levels in adult MPB. Increased dosage in the kill curves
produces similar mortality to previous injection assays.

53

2.4.4 Microinjection of DFB with MPB targets elicits mortality in negative control and
target dsRNA groups.
Microinjecting adult DFB with six MPB targets was used to investigate the speciesspecificity of the gene targets. Douglas-fir beetle mortality showed high survival rates for the
initial seven days post-injection. While this was also the case in the 2023 MPB injection assays,
the average mortality of the DFB assays differs from the MPB assays as the dsRS negative
control mortality rate is closer to the no-injection group mortality rates (Figure 2.8). Therefore,
the microinjection method may not be as lethal to adult DFB as for MPB. The average survival
of the target groups also remains high in the initial week after microinjection, indicating that the
delivery of MPB dsRNA targets is not lethal in an off-target, congeneric species.
At day eight post-injection, a white fungus tentatively identified as an entomopathogenic
fungi, Beauvaria spp., appeared on the Douglas-fir beetles (Zimmermann 2007). The
identification was made using the appearance of the white colonies coming from within the adult
beetles as well as the fact that this fungus is commonly found on soil and indoor plants
(Zimmermann 2007). This was not entirely unexpected as some Beauvaria spp. are pathogens to
Coleopteran species and Dendroctonus spp. are associated with many microbes, including
fungus (Paine et al. 1997; Klepzigl et al. 2001; Zimmermann 2007). Both MPB and the southern
pine beetle (Dendroctonus frontalis) phoretically carry fungi in the mycangia (Klepzigl et al.
2001; Chiu and Bohlmann 2022). This suggests that trapped emerged DFB adults also carry
associated fungi. Due to these factors, fungal infections in bioassays with beetles is a concern
(Whitney and Spanier 1982). The fungus may have impacted the health of the treated beetles,
acting as a confounding variable to the impacts of microinjection and MPB-dsRNA on the adult
DFB mortality.

54

2.4.5 Feasibility of microinjection as a delivery method for MPB
Our results shed new light on the effectiveness of microinjection in adult Dendroctonus
species. Effectiveness of RNAi via microinjection delivery may be dependant on a myriad of
factors including the insect’s life stage, species, amount of dsRNA, and target genes (Cooper et
al. 2019; List et al. 2022). Microinjection has been used extensively to knockdown genes in order
to understand their role in D. armandi adults, with high survival rates from the method (Zhang et
al. 2016; Liu et al. 2021, 2022; Liu and Chen 2022). One possible explanation for the difference
in beetle survival in these studies compared to this study is the needle size used for injection. We
used a large, 26-gauge needle, whereas the D. armandi injections used a 32-gauge needle (Sun et
al. 2021; Liu et al. 2021, 2022; Liu and Chen 2022). With the 26-gauge needle having an outer
diameter (OD) twice as large as the 32-gauge needle, this would cause more damage to the
injected beetles. Within our study, there were differences in the survival of adults from two
congeneric species, D. ponderosae and D. pseudotsugae, after microinjection. This might
indicate that different bark beetle species could have a better response to microinjection than D.
ponderosae.
Successful RNAi initiation via microinjection has been achieved in the teneral adult life
stage of D. ponderosae (Keeling et al. 2013). The teneral adult life stage precedes the adult stage
when MPB emerge from the phloem (Chiu and Bohlmann 2022). At this life stage, the
exoskeleton is not as hard, making microinjection easier (Chiu and Bohlmann 2022, C.I.
Keeling, personal communication, 2024). Keeling et al (2013) used smaller needles, suggesting
that the large needles used in our study increased injected MPB mortality. The needles used on
teneral adult MPB are much smaller than the needles used in D. armandi microinjection, which
may indicate that MPB are more susceptible to injury from microinjection than congeneric

55

species (Keeling et al. 2013; Sun et al. 2021; Liu et al. 2021, 2022; Liu and Chen 2022). While
this study may have found a potential indication of iap suppression in one repetition of MPB
injections, this was not found in subsequent injections.
Another difference in this study compared to previous studies that can cause variation in
the RNAi response is the amount of dsRNA delivered. For the target survey, 50ng of dsRNA was
delivered using a concentration of 1μg/μl. Though D. armandi studies typically delivered more
dsRNA to the target insect, smaller amounts have been successful at causing decreased gene
expression and showing the phenotypic response in other insects (Bingsohn et al. 2017). When
the small dsRNA doses were increased, the observation of the phenotypic response occurred
faster after microinjection and had slightly increased mortality from 75% to 90% (Bingsohn et al.
2017). The microinjection assays in this study were monitored longer to account for the
possibility of a delayed phenotypic response. The use of a kill curve with the most promising
gene target, iap, based on previous success in MPB, accounted for the possibility of an
inadequate amount of dsRNA delivered in initial assays. With 50ng, 125ng and 250ng delivered,
these amounts were now in the range of even more studies that found successful RNAi initiation
(Keeling et al. 2013; Zhao et al. 2015; Sun et al. 2021; Liu et al. 2022; Liu and Chen 2022).
Lastly, a large factor credited with causing variable RNAi responses are the genes that
are targeted for suppression or knockdown (Cooper et al. 2019). To address that variable in this
study, two of the six tested gene targets were selected due to previous success at RNAi initiation
resulting in gene suppression and rapid mortality in MPB and other insects (Leelesh and Rieske
2020; Kyre et al. 2020; Wallace and Rieske 2023). The other four targets were selected based on
RNAi initiation success in other insect species, and having essential roles in the cell, aiming to
broaden the applicable gene targets for MPB mortality (Zhao et al. 2015; Yoon et al. 2016; Hu et

56

al. 2019). As such, two of the four targets are expected to elicit a response in MPB. The other
four show promise to elicit a response, but have not been previously tested in D. ponderosae.
With no indication of the RNAi response in the phenotype, and confounding death likely
attributed to the invasive delivery via microinjection, the data suggests that the RNAi pathway is
not being initiated and that the microinjection method is too invasive.

57

2.5 Conclusion
With four repetitions testing six gene targets via microinjection in emerged adult MPB,
the mortality of injected negative control groups and target dsRNA groups were similar. High
survival was only observed in the non-injected control groups, indicating that the method of
microinjection, rather than the specific target dsRNA, caused the observed mortality. Gene
expression analysis showed a potential, though obscured, successful suppression of the iap gene
in one repetition. However, no further evidence was found in the gene expression analysis for
subsequent repetitions, subverting the possible RNAi success. The lack of RNAi-mediated
mortality was further corroborated by the MPB kill curve that investigated higher amounts of
dsIAP delivered. The mortality trend was the same, with injected groups, including the negative
controls of water and dsRS, showing high mortality. Lastly, microinjection of MPB-dsRNA into
an off-target, congeneric species, DFB, led to better initial survival in the injected negative
control groups. No rapid mortality was observed in treatment groups, indicating that there was no
RNAi initiation. Despite being a gold standard for RNAi initiation in many insects,
microinjection is not often used in D. ponderosae, especially in emerged adults. Therefore, the
data from this study supports the use of alternative methods to investigate RNAi as a pest
management tool in MPB.

58

Chapter 3 - Testing novel targets for RNAi-mediated gene suppression and mortality in
emerged adult Dendroctonus ponderosae via oral delivery.
3.1 Introduction
Co-opting the naturally occurring, anti-viral RNA interference (RNAi) pathway shows
promise as a cost-effective and species-specific insecticide for pest management (Cooper et al.
2019; Christiaens et al. 2020). Studies have reported successful RNAi-initiation and mortality in
agricultural and forest pests (Rangasamy and Siegfried 2012; Kyre et al. 2019, 2020; Haller et al.
2019; Pampolini and Rieske 2023). The species-specificity allows the researcher to target a
single species for RNAi-mediated mortality (i.e. targeted mortality) due to the double-stranded
RNA (dsRNA) and messenger RNA (mRNA) requirements (see Chapter 1, section 1.3.4).
Delivering dsRNA via microinjection and oral ingestion are the main methods used by
researchers to investigate RNAi responses in different species to different gene targets (Baum et
al. 2007; Leelesh and Rieske 2020; Kyre et al. 2020; List et al. 2022).
Microinjection allows for direct delivery and certainty in the dsRNA dose to an insect
(List et al. 2022). Microinjecting Dendroctonus armandi has initiated an RNAi response to
elucidate gene functions. However, results from adult MPB microinjection assays suggest that it
is an invasive procedure (see Chapter 2, section 2.3.2 and 2.3.4). Additionally, microinjection is
constricted to laboratory application due to the method requirements (see Chapter 2, section
2.2.1) and requires trapping and removing adult MPB from the forest stands. Removing MPB
from the stands negates the purpose and cost-effective benefits of applying RNAi as a pest
management tool.
Laboratory-based oral ingestion is less invasive than microinjection and has previously
initiated RNAi in Coleopteran insects (Rangasamy and Siegfried 2012; Rodrigues et al. 2018;
59

Haller et al. 2019). Western corn rootworm (Diabrotica virgifera virgifera, WCR) adults were
fed an artificial diet containing 0.5μg or 1μg of dsRNA targeting vacuolar ATPase (vATPase)
(Rangasamy and Siegfried 2012). Mortality was higher in WCR adults that ingested vATPase
dsRNA and significant vATPase suppression was observed at 24h, 48h, and 72h when compared
to water and dsRNA controls (Rangasamy and Siegfried 2012). There was no significant
difference in gene suppression or mortality between beetles fed 0.5μg or 1μg of dsRNA
(Rangasamy and Siegfried 2012). In another study, larvae from two different ladybird species,
Adalia bipunctata and Coccinella septempunctata, ingested 4μl of a sucrose solution containing
2μg/μl or 0.25μg/μl of respective species-specific dsRNA targeting vATPase A (Haller et al.
2019). Increased mortality and decreased vATPase A expression was observed in the 2μg/μl
groups when compared to non-dsRNA fed and nonsense dsRNA fed controls (Haller et al. 2019).
Oral ingestion of dsRNA targeting shibire (shi) and heat shock protein (hsp) genes by emerald
ash borer (Agrilus planipennis, EAB) neonates led to dosage-dependent mortality (Rodrigues et
al. 2018). Higher mortality occurred in neonates after feeding on 10μg/μl than neonates that fed
on 1μg/μl (Rodrigues et al. 2018). In another study, spraying 500μg of in vitro synthesized
dsRNA onto seedlings infested with EAB eggs decreased gallery area and cambial ingestion in
the seedlings and caused a decrease in hsp expression in larvae (Pampolini and Rieske 2023).
Delivering dsRNA orally initiated systemic RNAi responses in Dendroctonus species.
Adult southern pine beetles (SPB, Dendroctonus frontalis) ingested a vertically suspended
droplet of a sucrose solution containing 10μg of dsRNA (Kyre et al. 2019; Kyre and Rieske
2022). A significant decrease in heat shock protein (hsp) and shibire (shi) expression, but not
inhibitor of apoptosis (iap) expression, was observed after dsRNA droplet ingestion by SPB.
Higher mortality was observed in all three treatment groups compared to the control groups

60

(Kyre et al. 2019). Mountain pine beetle (MPB, Dendroctonus ponderosae) adults were
submerged up to the posterior end of the pronotum in 2.5μg/μl dsRNA, allowing for dsRNA
ingestion and absorption (Kyre et al. 2020). After dsRNA ingestion/absorption, MPB mortality
was higher, and the hsp, shi, and iap expression decreased significantly, in the dsHSP, dsSHI,
and dsIAP groups compared to the control (Kyre et al. 2020). Successful RNAi initiation via oral
ingestion of dsRNA is critical, as dsRNA ingestion will be required for future in situ
applications. However, using in vitro synthesized dsRNA for oral ingestion can be limited by
dsRNA instability (Cooper et al. 2019). After successful RNAi initiation is achieved (“proof-ofconcept”), finding a more stable dsRNA delivery method for in situ application is an essential
step towards using RNAi as a pest management tool.
Stability can be improved using microbial vectors, like bacteria and yeast (Cooper et al.
2019; Christiaens et al. 2020; Leelesh and Rieske 2020). A strain of Escherichia coli expressing
dsRNA caused successful mortality and gene suppression compared to the control (non-dsRNA
expressing bacteria) in Emerald Ash Borer (Agrilus planipennis Fairmaire) neonates when
targeting hsp and shi genes (Leelesh and Rieske 2020). Successful RNAi initiation via dsRNAexpressing bacteria was also achieved in Colorado potato beetle larvae (Leptinotarsa
decemlineata Say, CPB) larvae (Zhu et al. 2011). Decreased expression of β-Actin (Actin),
Protein transport protein sec23 (Sec23), Vacuolar ATP synthase subunit E (vATPaseE), Vacuolar
ATP synthase subunit B (vATPaseB), and Coatomer subunit beta (COPβ) was observed after
CPB larvae ingested 200μl of dsRNA-expressing bacteria. Knockdown of Actin, Sec23, and
COPβ was more efficient after dsRNA-expressing bacteria ingestion than after in vitro
synthesized dsRNA ingestion, but not in vATPaseE or vATPaseB (Zhu et al. 2011). Gene
suppression in all five treatment groups was associated with decreased survival when compared

61

to the control (Zhu et al. 2011). Another microbial vector for dsRNA delivery is yeast, usually a
Saccharomyces cerevisiae strain (Duman-Scheel 2019). In Spotted Wing Drosophila
(Drosophila suzukii), dsRNA-expressing S. cerevisiae targeting vacuolar H+ ATPase 26 kD
subunit (Vha26) and y-tubulin 23C (yTub23C) caused a decrease in movement, indicating a
decrease in health (Murphy et al. 2016). A lethal response was observed in D. suzukii after in
vitro synthesized vha26 and yTub23C dsRNA was ingested but not after dsRNA-expressing
yeast ingestion (Murphy et al. 2016). In addition to microbial vectors, other production platforms
have been successful.
A proprietary cell-free platform used to produce dsRNA has been approved in the United
States of America for use as a biopesticide for CPB (Rodrigues et al. 2021). Significant
suppression of PSMB5, a gene that codes for a subunit of the proteasome beta molecular
machine, was observed 24h after ingestion of dsPSMB5 (255×10−5g/L) on a potato leaf.
Expression of PSMB5 and the amount of the coded protein, was consistently decreased at 24h
through to 72h post-ingestion (Rodrigues et al. 2021). While RNAi has been previously
approved in transgenic corn targeting the western corn rootworm (Reinders et al. 2023), recent
United States Environmental Protection Agency (EPA) approval for foliar application of RNAi is
groundbreaking for the progression of RNAi as a pest management tool for other insects.
Oral delivery using the submergence method will be used to test lethality of six gene
targets using dsRNA: inhibitor of apoptosis (iap), heat shock protein (hsp), V-type proton
ATPase subunit S1 (vha19), tetraspanin 2a (tsp2a), mesh protein (mesh), and snakeskin (ssk). In
addition, vector-mediated hpRNA delivery to MPB via a strain of S. cerevisiae will be tested for
the first time. Two genes, iap and hsp, are stress response genes and have previously elicited a
lethal effect on adult MPB through the RNAi pathway (Kyre et al. 2020). The other four targets

62

are novel targets for RNAi in MPB, with three forming a complex critical to epithelial structure
in the gut and vha19 is involved in proton transport (Izumi et al. 2012, 2016; Zawadzki et al.
2012; Hu et al. 2019; Jonusaite et al. 2020; Beyenbach et al. 2020).

63

3.2 Methods
3.2.1 Subject Collection
Subject collection was previously described (see Chapter 2, section 2.2.1). The majority
of MPB used in the following assays were from Smithers, BC and emerged naturally, except
where otherwise noted (section 3.2.2). In 2022, bolts from Smithers, B.C., provided adult MPB
for assays in sections 3.2.2, 3.2.3, and 3.2.5. In 2023, emerged MPB were collected from bolts
from Smithers, B.C. and used in the assays described in 3.2.4, 3.2.6, and 3.2.7. Lastly, in 2024
bolts were received from Smithers, B.C., and emerged MPB were used in the section 3.2.8 assay.
All emerged MPB were collected, and MPB exhibiting lower health (missing appendages,
extremely lethargic) were excluded from assays.
3.2.2 Sucrose Bioassay – Method Test
Adult MPB were collected as they emerged and some extracted from galleries to
randomly assort the beetles into three groups of ten beetles. Each group was assigned a
treatment: no treatment (negative control), submergence in 1% sucrose solution, and droplet
suspension of the 1% sucrose solution. The no-treatment group was placed in a petri dish lined
with moistened filter paper and stored at 23°C in the dark.
Beetles in the submergence group were placed in enough 1% sucrose solution in a 0.6ml
microcentrifuge tube to reach the posterior end of the pronotum (Kyre et al. 2020), a range of 57μl, depending on MPB size. Beetles were held in place with a compressed piece of Kimwipe,
preventing them from backing out of the sucrose solution. Beetles were left submerged for 12h at
23°C in the dark. After the 12h period, beetles were removed from the tubes and placed in a petri
dish lined with moistened filter paper and placed back in the dark at 23°C.

64

Beetles in the droplet suspension group were held to a 1μl drop of the 1% sucrose
solution that was on a vertical plastic material (weigh boat held vertically). Beetles were held in
place with entomological forceps until the drop was gone. After feeding, beetles were placed in a
petri dish lined with moistened filter paper and stored at 23°C in the dark. Beetles in all three
treatment groups were monitored daily for mortality.
3.2.3 Blue-dyed Sucrose Bioassay
To qualitatively determine the ingestion efficiency of the submergence and droplet
suspension delivery methods, the 1% sucrose solutions were dyed with blue food colouring. Two
drops of dye were added to 1ml of 1% sucrose solution. Emerged adult MPB were randomly
assorted into two groups of ten: one group was submerged in the dyed sucrose solution and the
second group was fed using the droplet suspension method. For each group, the previously
outlined methods (section 3.2.2) were followed.
At 24h after initial exposure, beetles were dissected to record the presence or absence of
blue dye in their guts. A few untreated beetles were dissected to act as a negative control for the
colour of the guts. This 24h assay was independently performed twice.
Further refinement of the submergence method was tested, using a 0.2ml PCR tube rather
than the 0.6ml tube (Figure 3.1). Other than this change, previous protocols were followed,
though less liquid was needed to reach the posterior end of the pronotum in the smaller tube
(section 3.2.2).

65

Figure 3.1 A submerged adult mountain pine
beetle (Dendroctonus ponderosae, MPB) in bluedyed 1% sucrose solution. Beetles were
submerged in liquid to the posterior end of the
pronotum for 12h.

After 12h of submergence, the beetles were removed and placed in a petri dish lined with
a moistened filter paper and put in a dark incubator at 23°C. Beetles were dissected 24h after
initial exposure to the blue-dyed sucrose solution, and the presence or absence of blue dye in the
gut was recorded.
3.2.4 Submergence Trial – feeding status
After observations that beetles ingest the moistened filter paper, the potential effect on
uptake of target liquids was investigated. Twenty-four emerged adult MPB collected four and
three days before the assay were distributed among treatments to ensure that both collection
dates were represented in each group. Twelve beetles were assigned to the “starved” group,
while the other twelve beetles were assigned to the “fed” group. Within each group, there were
three treatments: water, 0.05mg/ml and 0.1mg/ml heat-inactivated, hpRS-expressing yeast.
66

Beetles in the “starved” group were placed in petri dishes without filter paper. These petri dishes
were placed in a box with moistened paper towel to provide moisture for MPB without direct
contact. Beetles in the “fed” group were placed in petri dishes lined with moistened filter paper.
Beetles were kept either “starved” or “fed” for five hours before submergence. Beetles were
submerged in the three assigned treatments to the posterior end of the pronotum for 12h. Beetles
were removed and placed into petri dishes with moistened filter paper and stored in the dark at
23°C. The presence or absence of liquid remaining in the tube after12h was recorded. Mortality
of the beetles was tracked for 16 days.
3.2.5 Submergence target dsRNA Assay
The kit-synthesized dsRNAs for six gene targets were tested on adult MPB using the
submergence method. Concentrations of the dsRNA were as close to 2.5μg/μl as possible: IAP
(2μg/μl), HSP (1.8-2.1μg/μl), mesh (1.99-2.1μg/μl), tsp2a (1.9μg/μl), vha19 (1.9-2μg/μl), ssk (22.1μg/μl), and dsRS (2-2.1μg/μl). Emerged adult MPB collected from four different dates within
a week of the assay were evenly distributed among the seven treatments, and the two sub-groups
within each treatment, to ensure that each collection date was represented. Within each treatment
group, ten beetles were assigned to the mortality observation group and five beetles were
assigned to the gene expression analysis group. The previously outlined protocol (section 3.2.3)
was followed for the submergence of MPB. The volume of the liquid added ranged from 5-6μl.
Gene expression beetles were flash frozen in liquid nitrogen 24h after initial dsRNA exposure
and stored at -80°C. Beetles in the mortality observation groups were monitored daily until 100%
mortality was observed in all treatment groups. Filter paper in the petri dishes was changed every
48h.

67

3.2.6 Female Submergence Assay
Female adult MPB emerged from bolts kept in cold storage at 6°C for about four months
to delay beetle emergence were assigned to one of six different treatments: dsIAP (2.5μg/μl),
dsVHA19 (2.5μg/μl), hpRNA-expressing yeast solutions (heat-inactivated yeast mixed with
distilled water) of 0.05mg/ml hpIAP, 0.1mg/ml hpIAP, 0.05mg/ml hpVHA19, 0.1mg/ml
hpVHA19. Three controls were also included: 0.1mg/ml hpRS, dsRS (2.5μg/μl), and water.
Emerged adult MPB collected three and four days before the assay were evenly distributed
among treatments to ensure that both collection dates were represented in each group. Within
each treatment group, ten beetles were assigned to the mortality observation group and six were
assigned to the gene expression analysis group. The previously described submergence protocol
was followed (section 3.2.3/3.2.4). The volume of the liquid added ranged from 3-5μl. Gene
expression beetles were flash frozen in liquid nitrogen 72h after the initial dsRNA exposure and
stored at -80°C. Beetles in the mortality observation group of each treatment were monitored
daily and mortality recorded until 100% mortality was achieved in all treatment groups.
3.2.7 Male Submergence Assays
Male adult MPB emerged from bolts previously cooled to delay beetle emergence (see
section 3.2.6) were assigned to one of seven treatments: dsMESH (2.5μg/μl), 0.05mg/ml hpIAP,
0.1mg/ml hpIAP, 0.05mg/ml hpMESH, 0.1mg/ml hpMESH, and 0.1mg/ml hpRS; and water.
Emerged adult MPB collected from four different dates within five days of the assay were evenly
distributed among the seven treatments, and the two sub-groups within each treatment, to ensure
that each collection date was represented for the first repetition. In the second repetition,
emerged adult male MPB collected from nine different dates within nine days of the assay were
evenly distributed among the seven treatments. Within each treatment group, ten beetles were

68

assigned to the mortality observation group and six were assigned to the gene expression analysis
group. The previously described submergence protocol was followed (section 3.2.3/3.2.4). The
volume of the liquid added ranged from 3-5μl. Gene expression beetles were flash frozen in
liquid nitrogen 72h after initial dsRNA exposure and stored at -80°C. Beetles in the mortality
observation group of each treatment were monitored daily and mortality recorded until 100%
mortality was achieved in all treatment groups.
3.2.8 Submergence Assay to test three targets on emerged adult mountain pine beetle
(2024)
Thirty-four emerged female adult MPB were assigned to one of the control or treatment
groups: no-submergence control, water (H2O), dsRS (2.5μg/μl), dsIAP (2.5μg/μl), dsVHA19
(2.5μg/μl), and dsMESH (2.5μg/μl). Within each treatment group, ten beetles were assigned to
the mortality observation group and six beetles were assigned to each of the following gene
expression analysis groups: 24h, 48h, 72h, and 96h post-submergence. Emerged adult MPB
collected one and two days before the assay were evenly distributed among treatments to ensure
that both collection dates were represented in each group. Beetles were submerged in the
assigned target (or not submerged for the no-submergence control group) as described in
previous methods (section 3.2.3/3.2.4). The volume of the liquid added ranged from 3-6μl.
However, some alterations were made to the storage conditions of the beetles for the assay
duration are as follows. Once submerged, beetles were placed under a cardboard box at room
temperature (approximately 20°C). After 12h, beetles were removed and placed on petri dishes
as previously detailed (section 3.2.3/3.2.4). Petri dishes were stored vertically and returned to the
dark at room temperature (approximately 20°C). Filter paper was changed daily. Gene
expression beetles in each group within each treatment were flash frozen in liquid nitrogen at the

69

set post-submergence time and stored at -80°C. Beetles in the mortality observation group of
each treatment were monitored and mortality recorded daily for 14 days. Below is a summary of
the submergence assays performed in this chapter for review (Table 3.1).
Table 3.1 Brief summary of the submergence assay methods performed on emerged adult mountain pine
beetles (Dendroctonus ponderosae, MPB) in this study.

Assay

Section

Blue-dyed
sucrose method
test
Feeding status
trial

1.2.2 and 1.2.3

Submergence
assay

1.2.5

Female
Submergence
assay

1.2.6

Male
Submergence
assay
2024
Submergence
assay

1.2.7

1.2.4

1.2.8

dsRNA/hpRNA
targets
NA

MPB sex (M/F)

MPB age

NA

< 3 days

Water,
0.05mg/ml, and
0.1mg/ml hpRSexpressing yeast
solutions
dsIAP, dsHSP,
dsTSP2A,
dsVHA19,
dsMESH, dsSSK
dsIAP,
dsVHA19,
hpIAP,
hpVHA19
dsMESH,
hpIAP, hpMESH

mixed

3-4 days

NA

4-7 days

F

3-4 days

M

2-5 days

dsIAP,
dsVHA19,
dsMESH

F

1-2 days

3.2.9 Gene Expression Methods
The gene expression analysis method follows the protocol outlined (see Chapter 2,
section 2.2.8). Briefly, RNA was extracted from selected samples using the RNeasy Plus Mini
Kit (Qiagen, Toronto, ON). The use of a QIAshredder (Qiagen, Toronto, ON) step was added to
70

the kit protocol, prior to the gDNA eliminator step. The resulting extractions were quality
checked using the Agilent RNA 6000 Nano Kit on the Agilent Bioanalyzer 2100 (Agilent, Santa
Clara, CA). From samples with good quality (for definition of good quality: Chapter 2, section
2.2.8.1), cDNA was synthesized using the iScript™ Reverse Transcription Supermix (Bio-Rad
Laboratories (Canada) Inc., Mississauga, ON) following kit protocol and normalizing RNA input
to 500ng. The cDNA was used in ddPCR where each sample was run twice, once with each
housekeeping gene (Chapter 2, section 2.2.8.2). Each reaction consisted of: 12μl 2X Supermix
for probes with no dUTPs (Bio-Rad Laboratories (Canada) Inc., Mississauga, ON), 1μl of the
respective gene target assay, 0.5μl of the respective reference gene assay, 2.4μl of the sample
cDNA, and 8.1μl of water to reach 24μl total volume. For the no-template control (NTC) and
positive control, the cDNA was replaced with water and gBlock, respectively (Chapter 2, section
2.2.8.2). The Thermocycler conditions were: 95°C for 10 minutes to activate the polymerase,
followed by 45 rounds of 95°C for 30 seconds for the denaturation step and 58°C for 1 minutes
for the annealing step. The 45 rounds were succeeded by a step of 98°C for 10 minutes to
deactivate the enzymes and remained at 4°C until removed from the thermocycler. The droplet
reader was used to obtain the end-point quantification of the amplification, and results were
viewed with QX Manager Software Standard version 1.1 (Bio-Rad Laboratories (Canada) Inc.,
Mississauga, ON).
For each sample, each target gene value was normalized to the reference genes by
dividing the average target gene counts by the geometric mean of the reference gene counts,
similar to the principle of the double delta Ct method with RT-qPCR (Livak and Schmittgen
2001; Bio-Rad Laboratories 2007; Zmienko et al. 2015). The resulting normalized data was log2
transformed and data was checked for normality using the Shapiro-Wilk test alongside visual

71

confirmation using histograms and Q-Q plots. For normally distributed data, the parametric oneway ANOVA test comparing means was performed, followed by a Tukey HSD test if the
ANOVA test was significant (p < 0.05). Data was visualized using a boxplot showing the
relative gene expression in a log2 base scale of the target gene.

72

3.3 Results
3.3.1 Sucrose bioassay test
Survival of adult MPB in the second and third groups remained high for eight days after
treatment with a 1% sucrose solution. The no treatment control group (group_1) showed earlier
mortality, with 50% survival by day eight compared to the 100% and 90% survival in the second
and third groups, respectively (see Appendix, Figure S2). After the ninth day, survival in all
three groups decreased rapidly.
3.3.2 Blue-dyed sucrose bioassay test and feeding status results
No uptake using the vertical droplet suspension was observed in two trials (see Appendix,
Table S2 and S3). Uptake in the first submergence trial was 20%. Uptake increased to 40% in the
second trial. With an uptake in 60% of beetles in the last trial, the submergence method was used
for assays testing target genes for RNAi-mediated gene suppression (see Appendix, Table S4).
3.3.3. Impact of feeding status on target liquid uptake
Uptake of the target liquid was not observed to change whether the moistened filter paper
was present or absent. After 12h of submergence, most of the liquid was gone from the tubes and
any remaining liquid was a very small amount behind the head of the beetle. Some subjects had
even more liquid remaining, but this occurred in both yeast treatments in “starved” and “fed”
groups. All beetles were alive for 72h post submergence, and by day 16, MPB mortality was
similar among the “starved” and “fed” groups (see Appendix, Table S5).
3.3.4 Submergence target dsRNA Assay – Six targets (2022)
The adult MPB mortality in the treatment groups was gradual, with all groups showing
50% or higher survival six days after dsRNA exposure (Figure 3.2). Survival rates declined after
seven days, with dsMESH showing 20% survival. Survival in the dsRS group remained 50% or
73

higher for seven days, but decreased beginning on day eight. In all treatment groups 100%
mortality was reached by day 11.

Figure 3.2 Percent survival over 11 days of adult mountain pine beetles (Dendroctonus
ponderosae, MPB) (n = 10) submerged in dsRNA for six gene targets: dsIAP, dsHSP,
dsVHA19, dsTSP2A, dsMESH, and dsSSK and the control dsRS.

3.3.4.1 Gene expression analysis: Submergence target dsRNA Assay – Six targets (2022)
Two gene targets, dsHSP (t = -1.1787, df = 7.3002, p = 0.2755) and dsTSP2A (W = 9, p
= 0.5476), showed no statistically significant difference than the negative control (Figure
3.3B&D). Beetles treated with dsIAP showed a lower mean iap expression than the beetles
treated with dsRS, the negative control (t = -3.2484, df = 6.9886, p = 0.01412) (Figure 3.3A). In
the three other treatment groups, dsMESH (t = 4.4964, df = 4.2431, p = 0.009468), dsVHA19 (t
= -5.5759, df = 5.834, p = 0.00155), and dsSSK (t = -5.0566, df = 5.3101, p = 0.003299), the

74

treated beetles showed a higher mean target gene expression than the beetles in the negative
control group (Figure 3.3C&E-F).

Figure 3.3 Comparison of the mean (n = 5) of the log2 transformed relative target gene expression
between the treatment and negative control (dsRS) group 24h after submergence in dsRNA. Statistical
analysis was performed using a Student’s t-test (A-C, E-F) or a Mann-Whitney-Wilcoxon Test (D).
Significance codes are: ‘***’ < 0.001; ‘**’ < 0.01; ‘*’ < 0.05 A) iap gene (t = -3.2484, df = 6.9886, p =
0.01412), B) hsp gene (t = -1.1787, df = 7.3002, p = 0.2755), C) vha19 gene (t = -5.5759, df = 5.834, p =
0.00155), D) tsp2a gene (W = 9, p = 0.5476), E) mesh gene (t = 4.4964, df = 4.2431, p = 0.009468), and
F) ssk gene (t = -5.0566, df = 5.3101, p = 0.003299).

75

3.3.5 Female Submergence Assay
The mortality of adult female MPB in each group occurred quickly, with 50% or
higher mortality by day five post-submergence (Figure 3.4). Complete mortality was observed in
all groups by day ten. The 0.05mg/ml hpVHA19 (vha19_0.05) treatment group had 100%
mortality six days after submergence. The mortality of female MPB in the three negative control
groups showed similar patterns as the dsRNA treatment groups (Figure 3.4).

76

Figure 3.4 Percent survival over 11 days of adult female mountain pine beetles (Dendroctonus
ponderosae, MPB) (n = 10) submerged in kit-synthesized dsRNA or heat-deactivated, dsIAP- and
dsVHA19-expressing yeast solutions of different concentrations: 0.05mg/ml hpIAP (0.05_hpIAP),
0.1mg/ml hpIAP (0.1_hpIAP), 0.05mg/ml hpVHA19 (0.05_hpVHA19), 0.1mg/ml hpVHA19
(0.1_hpVHA19) and kit-synthesized dsIAP (dsIAP) and dsVHA19 at 2.5μg/μl (dsVHA19). The survival
of two negative controls: water (H2O) and a random sequence expressed in a 0.1mg/ml yeast solution
(0.1_hpRS) and kit-synthesized (2.5μg/μl (dsRS) were recorded and plotted alongside for comparison.

3.3.5.1 Gene expression analysis: Female submergence assay – 2023
A one-way ANOVA test found no statistically significant differences in the mean log2
relative gene expression between the treatment and control groups for both target genes: iap (p =
0.581, F= 0.7777, df= 5) and vha19 (p = 0.485, F= 0.903, df= 4) (Figure 3.5). For both gene
targets, there was no difference in the mean log2 relative gene expression between different

77

concentrations of the hpRNA-expressing yeast solutions or between the dsRNA or hpRNA. After
quality control measures, the kit-synthesized dsVHA19 (2.5μg/μl (dsVHA19)) treated group was
down to two biological repetitions and was excluded from the statistical analysis but plotted for
visual observation (Figure 3.5).

Figure 3.5 Comparison of the mean log2 transformed relative target gene expression between the
treatment controls and the negative controls 72h after submergence in dsRNA or hpRNA. Statistical
analysis was performed using a one-way ANOVA test. A) Comparison of 0.05mg/ml hpIAP
(0.05_hpIAP, n=4), 0.1mg/ml hpIAP (0.1_hpIAP, n=3), dsIAP at 2.5μg/μl (dsIAP, n=4), and the
negative controls water (H2O, n=3), dsRS (dsRS, 2.5μg/μl, n=5), 0.1mg/ml hpRS (0.1_hpRS, n=3): iap
expression is not significantly different (p = 0.581, F= 0.7777, df= 5) B) Comparison between
0.05mg/ml hpVHA19 (0.05_hpVHA19, n=4), 0.1mg/ml hpVHA19 (0.1_hpVHA19, n=6), dsVHA19 at
2.5μg/μl (dsVHA19, n=2*), and the negative controls water (H2O, n=3), dsRS (dsRS, 2.5μg/μl, n=5),
and 0.1mg/ml hpRS (0.1_hpRS, n=3): vha19 expression is not significantly different (p = 0.485, F=
0.903, df= 4). * With only two biological repetitions, this treatment group was excluded from the
statistical analysis but plotted for visual observation.

3.3.6 Male Submergence Assays
Adult male MPB mortality was observed in the treatment and negative control groups.
By day seven post-submergence, all groups showed 50% or less survival (Figure 3.6). By day
fourteen, 100% mortality was observed in all the groups. In 0.1mg/ml hpMESH (0.1_hpMESH),

78

100% mortality was observed by day nine, followed by complete morality in the water (H2O)
and 0.05mg/ml hpMESH (0.05_hpMESH) groups by day 11.

Figure 3.6 Percent survival over 14 days of adult male mountain pine beetles (Dendroctonus ponderosae,
MPB) (n = 10) submerged in: 0.05mg/ml hpIAP (0.05_hpIAP), 0.1mg/ml hpIAP (0.1_hpIAP), 0.05mg/ml
hpMESH (0.05_hpMESH), 0.1mg/ml hpMESH (0.1_hpMESH), or dsMESH at 2.5μg/μl (dsMESH). The
survival of two negative controls: water (H2O) and 0.1mg/ml hpRS yeast solution (0.1_hpRS; does not
match any transcript in the mountain pine beetle transcriptome) was recorded and plotted alongside for
comparison.

3.3.6.1 Gene expression analysis: Male submergence assay – 2023
A comparison of group means using the Kruskal-Wallis test showed that there was no
statistically significant difference in the mean log2 relative gene expression between the
treatment and control groups for both gene targets: iap (p = 0.5977, χ2 = 1.88, df= 3) and mesh (p
= 0.5663, χ2= 2.9495, df= 4) (Figure 3.7). There was also no difference between the varying

79

concentrations of the hpRNA-expressing yeast solutions within each target. For the mesh target,
there was no statistically significant difference between beetles submerged in dsRNA or hpRNA
(Figure 3.7).

Figure 3.7 Comparison of the mean log2 transformed relative target gene expression between the
treatment controls and the negative controls 72h after submergence in dsRNA. Statistical analysis was
performed using the Kruskal-Wallis test. A) Comparison between 0.05mg/ml dsIAP (0.05_dsIAP,
n=5), 0.1mg/ml dsIAP (0.1_IAP, n=5) and the negative controls water (H2O, n=5) and 0.1mg/ml
dsRS (0.1_dsRS, n=5): iap expression is not significantly different (p = 0.5977, χ2 = 1.88, df= 3). B)
Comparison between yeast solutions 0.05mg/ml dsMESH (0.05_dsMESH, n=5), 0.1mg/ml dsMESH
(0.1_mesh, n=6) and kit-synthesized dsMESH at 2.5μg/μl (ndsMESH, n=4) to the negative controls
water (H2O, n=5) and 0.1mg/ml dsRS (0.1_dsRS, n=5): mesh expression is not significantly different
(p = 0.5663, χ2= 2.9495, df= 4).

Though obscured by variable data, the mean log2 relative mesh expression does appear
slightly higher in the kit-synthesized treatment group (dsMESH), similar to the previous
submergence results from 2022 (see section 3.3.4.1, Figure 3.3E).
3.3.7 Submergence assay testing three targets on emerged adult mountain pine beetle
(2024)
The mortality of adult female MPB in the dsRNA-treated groups dsVHA19 and dsMESH
was higher than the adult female MPB mortality in the negative control groups and the dsIAP
treatment group (Figure 3.8). The lowest survival was observed in the dsMESH group with only
80

10% survival eight days post-submergence. This was followed by dsVHA19 with 30% survival
and dsIAP with 40% survival. Between day seven and eight in the no-submergence control
(no_sub_control), survival dropping from 70% to 40%. Similarly, survival in the dsRS control
group decreased from 80% to 50% between day seven and eight. High survival, 90%, was
observed in the water control group throughout the assay (Figure 3.8). Mortality after eight days
post-submergence was likely impacted by fungus visible on deceased beetles.

Figure 3.8 Percent survival over eight days of adult female mountain pine beetle (Dendroctonus
ponderosae, MPB) (n = 10) submerged in kit-synthesized dsRNA for three gene targets: iap
(dsIAP), vha19 (dsVHA19), and mesh (dsMESH) at a concentration of 2.5μg/μl. The survival of
three negative controls: no-submergence control (no_sub_control), water (H2O), and 2.5μg/μl
double-stranded random stem (dsRS; does not match any transcript in the mountain pine beetle
transcriptome) was recorded and plotted alongside for comparison.

81

3.3.7.1 Gene expression analysis - submergence assay testing three targets on emerged
female adult mountain pine beetle (FS24)
3.3.7.1.1 Relative iap gene expression
A comparison between dsIAP and the control groups at 24h post-submergence using
a one-way ANOVA indicated that the mean of at least one group was significantly different than
the others (p < 0.0001, F = 22.41, df = 3) (Figure 3.9A). Tukey’s HSD test identified that the
mean log2 relative iap expression in two controls, water (p = 0.01) and dsRS (p = 0.00013), was
significantly lower than in the no-submergence control. In dsIAP, the mean log2 relative iap
expression was significantly lower than the no-submergence control and water groups (p <
0.0001 and p = 0.001, respectively), but not the dsRS group (p = 0.104).

82

Figure 3.9 Comparison of the mean log2 relative iap gene expression between the dsIAP and control
groups: no-submergence control (no_sub_control), water (H2O), and 2.5μg/μl double-stranded random
stem (dsRS; does not match any transcript in the mountain pine beetle transcriptome). Statistical analysis
using the one-way ANOVA test showed significant differences among at least one of the group means at
each time point. A) At 24h (n = 6), iap gene expression in H2O (p = 0.01) and dsRS (p = 0.00013) groups
were significantly lower than the no-submergence control group. Expression of iap in dsIAP was
significantly lower than no-submergence control and H2O (p < 0.0001 and p = 0.001, respectively). B) At
48h (n=6), iap expression in the H2O (n=5) and dsIAP groups was significantly lower than the nosubmergence control group (p = 0.03 and p = 0.004, respectively). C) At 72h (n = 6; dsRS n=5), iap
expression was significantly lower in the dsIAP group than the no-submergence control group (p =
0.0024).

The same method at 48h post-submergence calculated that at least one of the group’s
mean relative log2 iap expression was different than the others (ANOVA; p = 0.0053, F = 5.836,
df= 3) (Figure 3.9B). The subsequent Tukey’s HSD test identified a significantly lower iap
expression in two groups, H2O (p = 0.03) and dsIAP (p = 0.004), compared to the no
submergence control. The iap expression in the dsIAP group was not significantly different from
the other two control groups: H2O or dsRS (p = 0.851 and p = 0.232, respectively).
The one-way ANOVA comparison of means between treatment groups 72h postsubmergence also showed that there was a difference in at least one of the group means from the
83

other groups (p = 0.0045, F = 6.054, df = 3) (Figure 3.9C). Tukey’s HSD test reported that the
relative log2 iap expression in the dsIAP group is significantly lower than in the no-submergence
control (p = 0.0024). Once again, the iap expression in the dsIAP group is not significantly
different from the other two controls: H2O and dsRS (p = 0.0759 and p = 0.117, respectively).
A one-way ANOVA comparing the relative mean iap log2 expression within each
treatment group over the three time points indicated no significant difference: no submergence
control (p = 0.97, F = 0.031, df = 2), water (p = 0.348, F = 1.139, df = 2), dsRS (p = 0.107, F =
2.638, df = 2), and dsIAP (p = 0.254, F = 1.505, df = 2).
3.3.7.1.2 Relative vha19 gene expression
A one-way ANOVA comparison of mean relative log2 vha19 expression between the
treatment groups 24h post-submergence reported that at least one group’s mean was different
than the others (p = 0.0243, F = 3.889, df=3) (Figure 3.10A). Tukey’s HSD test showed a
significant decrease in the relative log2 vha19 gene expression in the dsRS and dsVHA19 groups
when compared to the no-submergence control group (p = 0.03 and p = 0.044, respectively).
There is no statistical difference between the vha19 expression in dsVHA19 compared to H2O (p
= 0.922) or dsRS (p = 0.998). At 48h post-submergence, a Kruskal-Wallis test showed no
significant difference in the mean relative log2 vha19 expression between the different treatment
groups (p = 0.09, χ2 = 6.49, df = 3) (Figure 3.10B).

84

Figure 3.10 Comparison of the mean log2 relative vha19 gene expression between the dsVHA19 and
control groups: no-submergence control (no_sub_control), water (H2O), and 2.5μg/μl double-stranded
random stem (dsRS; does not match any transcript in the mountain pine beetle transcriptome). A) At 24h
(n=6), a one-way ANOVA calculated that vha19 gene expression was significantly lower in the dsRS and
dsVHA19 groups compared to the no-submergence control (p = 0.03 and p = 0.044, respectively). B) At
48h (n=6), a Kruskal-Wallis test showed no significant differences in relative vha19 gene expression
between any of the group means (p = 0.09, χ2 = 6.49, df= 3). C) At 72h (n= 6), a one-way ANOVA test
output showed that the vha19 relative expression was statistically significantly lower in the dsVHA19
group (n=4) than the no-submergence control and dsRS groups (n=5) (p = 0.006 and p = 0.037,
respectively).

The comparison at 72h post-submergence revealed that at least one group’s mean was
significantly different than the other’s (ANOVA; p = 0.00855, F = 5.397, df = 3) (Figure 3.10C).
A Tukey’s HSD test showed the mean relative log2 vha19 expression was significantly lower in
the dsVHA19 group than in the no-submergence and dsRS controls (p = 0.006 and p = 0.037,
respectively), but not from the H2O control (p = 0.186).
A Kruskal Wallis test comparing the mean log2 relative vha19 expression at the three
time points in the dsVHA19 treatment group and a one-way ANOVA comparison for the control

85

groups showed no significant differences: no submergence control (p = 0.311, F = 1.263, df = 2),
water (p = 0.24, F = 1.573, df =2), dsRS (p = 0.628, F = 0.481, df = 2), dsVHA19 (p = 0.1881, χ2
= 3.3419, df = 2).
3.3.7.1.3 Relative mesh gene expression
Expression of the third target gene, mesh, between the dsMESH and control groups
compared at different times post-submergence showed variable results (Fig 3.11). The one-way
ANOVA test at 24h post-submergence showed no significant difference in the mean relative log2
mesh expression between any of the treatment and control groups (p = 0.502, F = 0.813, df = 3)
(Figure 3.11A). At 48h, a Kruskal-Wallis comparison of means also showed no significant
differences in the mean relative log2 mesh expression between any of the treatment and control
groups (p = 0.8881, χ2 = 0.6364, df = 3) (Figure 3.11B). There is large variation in the mesh
expression in the dsMESH group at 48h and 72h.

86

Figure 3.11 Comparison of the mean log2 relative mesh gene expression between the dsMESH and
control groups: no-submergence control (no_sub_control), water (H2O), and 2.5μg/μl double-stranded
random stem (dsRS; does not match any transcript in the mountain pine beetle transcriptome). A) At 24h
(n=6), a one-way ANOVA analysis reported no significant differences between any of the groups (p =
0.502, F = 0.813, df = 3). B) At 48h (no_sub_control & H2O n=6; dsRS & dsMESH n=5), a KruskalWallis test calculated no statistically significant differences between any of the group means (p = 0.8881,
χ2 = 0.6364, df = 3). C) At 72h (n=6; dsRS n=4), a Kruskal-Wallis test followed by a Dunn’s test
indicated that the mean mesh expression was significantly lower in the dsMESH group (n=5) than the nosubmergence control group (p = 0.024).

At 72h post-submergence, a Kruskal-Wallis test indicated that the mean relative log2
mesh expression in at least one group is different from the others (p = 0.03193, χ2 = 8.8095, df =
3) (Figure 3.11C). The post-hoc Dunn’s test further identified that the mesh expression in
dsMESH is significantly lower than the no-submergence control (p = 0.024). However, it is not
significantly different than the other two controls: water (p = 1.00) or dsRS (p = 1.00).
Comparing the mean log2 relative mesh expression in each treatment or control group
at the three different time points using a one-way ANOVA showed a significant difference in at
least one time point in the no submergence control (p = 0.0276, F = 4.603, df = 2). A Tukey’s

87

post hoc test revealed a significant difference in the mean log2 relative mesh expression in the
no-submergence control group at 48h compared to the 72h (p = 0.0225). In the other treatment
and control groups, no statistically significant differences over time were reported: water (p =
0.482, F = 0.767, df = 2), dsRS (p = 0.0729, F = 0.324, df = 2), dsMESH (p = 0.289, F = 1.366,
df = 2).

88

3.4 Discussion
3.4.1 Submergence is the optimal method for orally delivering liquid to adult MPB
Feeding emerged adult MPB a 1% sucrose solution increased their survival compared to
adult MPB that were not fed. After emergence, MPB are not fed before assays, thus the ingestion
of sugar may have boosted survival over the testing period, further supported by metabolic
responses this delivery method (see Chapter 5, section 5.4.5.1). In natural settings, recently
emerged MPB have increased lipid stores for flight that can be broken down for energy when
food sources are not available (Evenden et al. 2014; Jiang et al. 2019a; Chaudhari et al. 2025).
The method of ingestion affects uptake success in adult MPB. Two methods have been
used for laboratory-based feeding in Dendroctonus spp.: vertical droplet suspension for southern
pine beetles (D. frontalis) and submergence for MPB (Kyre and Rieske 2022). After testing each
method on emerged adult MPB, the submergence method had the most uptake, 60%, in beetles
(see Appendix, Table S3). The uptake efficiency is not impacted by the presence or absence of
moistened filter paper, despite observations that MPB chew and potentially ingest the paper. In
both “starved” and “fed” beetles, most or all of the liquid was gone from the tubes after 12h.
Tubes with remaining liquid were observed in both “fed” and “starved” scenarios. These trials
indicate that not every beetle submerged in the target liquid may absorb or ingest the liquid.
Uptake of the target liquid can be monitored by the observation of whether any liquid is left in
the tube after 12h of MPB submergence. However, this is not always accurate as MPB that did
not have blue dye in their guts came from tubes with no liquid remaining. This makes
considering the uptake success when interpreting results complicated. Without more information
on this variation, sample removal is not reasonable. Therefore, the uptake success is likely

89

impacting the RNAi initiation results. Investigations into specific uptake success are
recommended with future use of this delivery method.
3.4.2 Successful RNAi initiation in four of six gene targets
For six days after exposure to target dsRNA, adult MPB mortality was lower than
expected. In a previous study, mortality in adult MPB exposed to target dsRNA showed 50%
mortality after 4 days (Kyre et al. 2020). Kyre et al. (2020) also reported that adult MPB
mortality remained low in the negative control group. In our study, MPB mortality in the
negative control (dsRS) group was similar to the treatment groups (Fig 3.2). A study delivering
dsIAP, dsHSP, and dsSHI orally to Ips calligraphus showed similar mortality with a negative
control, dsGFP, causing more than 50% mortality by day six (Wallace and Rieske 2023).
However, dsIAP and dsSHI showed higher mortality than the control and dsHSP, indicating the
lethality of those two targets (Wallace and Rieske 2023). In this assay, we were unsuccessful in
identifying target genes as the absence of rapid mortality in the MPB exposed to the six
individual targets and similar mortality in the negative control suggests that these targets were
not lethal to adult MPB.
An RNAi response in treated MPB led to a small, but statistically significant decrease in
iap expression in the dsIAP group compared to the dsRS group (Figure 3.3A). The difference
between the dsIAP and control group is similar to the changes reported in previous MPB RNAi
studies as well as in Ips calligraphus (Kyre et al. 2020; Wallace and Rieske 2023). Interestingly,
Kyre et al. (2020) reported MPB mortality caused by the gene expression change, which was not
observed in our study (Figure 3.2). A BLASTn search (NCBI 2024) resulted in a 99.71% match
between the dsRNA sequence introduced to the adult MPB and all five iap gene transcript
variants. These sequence matches exceed the minimum 16-25 exact nucleotide match

90

requirement for RNAi initiation (Kyre and Rieske 2022; Hollowell et al. 2022). Therefore, the
absence of a lethal effect from an RNAi-mediated decrease in iap gene expression can likely be
attributed to an impartial knockdown.
The increase in target gene expression 24h after adult MPB were exposed to dsVHA19,
dsMESH, and dsSSK when compared to the dsRS control was unexpected, but not
unprecedented. An RNAi study on Ips calligraphus reported increased shibire gene expression
72h post-dsSHI exposure and decreased iap expression after dsIAP exposure, similar to our
study (Wallace and Rieske 2023). These two genes have different essential functions in the cell,
as iap is a stress response gene and shibire is involved in communication through the central
nervous system in insects (Kyre and Rieske 2022). The three target genes showing increased
relative gene expression in our study, mesh, ssk, and vha19 are also not involved in stress
response but rather in smooth septate junction structure of the endodermally-derived epithelia
and molecule transport in insects, respectively (Baum et al. 2007; Izumi et al. 2016; Hu et al.
2019). Contrary to our study, successful reduction in a ssk homolog’s expression and associated
beetle mortality was achieved 48h after western corn rootworm (Diabrotica virgifera virgifera)
were exposed to dsRNA (Hu et al. 2019). Additionally, RNAi-mediated vha19 suppression was
achieved in Haemonchus contortus larvae, though this study reported an increase in other gene
expression after dsRNA delivery (Zawadzki et al. 2012). The increase was reported in the two
genes mitr-1 and noah-1, with roles in the mitochondria (energy metabolism and respiration) and
an extracellular matrix component homolog, respectively (Zawadzki et al. 2012). Similarly,
another study investigating a different vATPase in Adalia bipunctata and Coccinella
septempunctata reported increased target gene expression after exposure to dsRNA and the
expression levels varied among different time points (Haller et al. 2019).

91

Unexpectedly, the remaining two genes tested in our study, hsp and tsp2a, did not exhibit
any significant gene expression differences from the controls. In a different study testing RNAi
via oral delivery of dsRNA to MPB, hsp caused mortality and significant gene suppression (Kyre
et al. 2020). Feeding MPB-specific dsHSP to a congeneric species, the southern pine beetle
(Dendroctonus frontalis, SPB), also resulted in hsp suppression (Kyre and Rieske 2022). The
opposite, feeding SPB-specific dsHSP to MPB, also resulted in a reduction in hsp expression
(Kyre and Rieske 2022). Successful hsp suppression was reported in SPB, and when different
populations were tested, two of three populations showed significant reductions in hsp
expression with one population showing no difference in hsp expression compared to the control
(Kyre et al. 2019, 2024). These different responses among different populations suggests that the
lack of hsp suppression in our study might be due to population sensitivity. In another forest pest,
Ips calligraphus, there was also no difference in hsp expression between the dsHSP and control
groups, similar to our study’s findings (Wallace and Rieske 2023). As this study is the first to
test tsp2a as a target for MPB mortality via RNAi, there are no direct studies to compare our
results to. However, tsp2a has been suppressed in Drosophila using RNAi and, as it forms a
complex with mesh and ssk, tsp2a was predicted to be a lethal target in MPB (Izumi et al. 2016;
Xu et al. 2019). With no gene expression response, this could be another population-sensitive
target, or confounding factors could be responsible, like inefficient dsRNA uptake (see section
3.3.2/3.4.1).
3.4.3 Absence of an RNAi response when submerging adult female mountain pine beetles in
hpRNA-expressing yeast solutions
The mortality in all groups, including the three control groups of water (H2O), heatinactivated, hpRS-expressing yeast (0.1_hpRS) and in vitro dsRS (dsRS) was high. Mortality

92

started between day one to day three in all groups which is earlier than expected for both the
negative controls and for an RNAi response in MPB or SPB (Kyre et al. 2019, 2020). A similar
mortality trend was reported in Ips calligraphus, where the beetle mortality in the controls was
also high early on in the assay and successful RNAi initiated gene suppression was still reported
(Wallace and Rieske 2023). While similar, the mortality from our study shows more mortality
earlier on in the bioassay than the Ips calligraphus bioassay. Comparable mortality in all groups
indicates that the dsRNA and hpRNA was not lethal to adult female MPB. The observed
mortality was likely caused by other confounding variables.
One possible variable impacting the results is the female adult MPB condition. First,
larvae were kept at cooler temperatures in the spring/early summer to delay development and
emergence, essentially manifesting quiescence (Bentz and Hansen 2018). Development
temperature is an important variable when rearing insects, and can impact insect performance
(Huho et al. 2007; Sørensen et al. 2012). Beetles acclimatized to cooler temperatures tend to
have decreased performance at higher temperatures (Sørensen et al. 2012). During the cooling
period, MPB were stored at approximately 6°C and were allowed to develop at ambient summer
temperatures after, then kept at a mid-range temperature of 23°C during the bioassay. Thus, it is
not expected that the cooling period should have a large physiological impact on emerged MPB
as this manipulated a naturally occurring dormancy. Second, there is a negative correlation
between the time since emergence from the bolts and MPB flight fitness (Evenden et al. 2014).
While these females recently emerged, they did emerge from the bolts later in the season, and
this may also negatively affect the fitness, and therefore the survival of MPB during the assay.
Ultimately, the cause of mortality of MPB in all the groups in the bioassay is likely due to poor
beetle condition.

93

No significant differences in gene expression between the treatment and control groups
corroborates the absence of an RNAi response predicted from the mortality trend. The group
treated with in vitro dsIAP (dsIAP) looks to have a lower mean relative log2 iap expression than
the other groups, but this is not significant. Unexpectedly, the group treated with hpIAPexpressing yeast (0.1mg/ml hpIAP, 0.1_hpIAP) appears to have a higher mean relative log2 iap
expression than the other groups, but once again this is not a significant difference. No difference
between the relative iap expression between the treatment and control groups has also been
reported in other studies on SPB (Kyre et al. 2019). Success of iap suppression in SPB varies by
population as well, with no difference in iap expression between the treated and control groups
in the New York, USA population and statistically significant differences in iap expression
between treatment and control groups in the other two populations from Mexico (Kyre et al.
2024). Suppression of iap appears to be species-specific, as dsRNA designed for MPB is
ineffective at initiating successful RNAi in SPB, and the same was reported for SPB-designed
dsRNA in MPB (Kyre and Rieske 2022). Possible explanations for the lack of iap suppression in
our study could once again be linked to the use of a northern MPB population compared to
southern populations. This is further supported by the presence of an iap allele with efficient upregulation in northern populations, which may affect the iap knockdown success (Horianopoulos
et al. 2018).
The relative log2 vha19 expression looks very close among the treatment and control
groups. In a previous submergence bioassay in this study, vha19 expression in the in vitro
dsVHA19 group was significantly higher than in the control in vitro dsRS group (see section
3.3.4.1/3.4.2). However, vha19 has been successfully suppressed using RNAi in two worm
species: Haemonchus contortus larvae and Caenorhabditis elegans (Zawadzki et al. 2012).

94

Targeting vATPase A in Adalia bipunctata and Coccinella septempunctata had variable results,
with gene suppression and in one instance an increase in gene expression (Haller et al. 2019).
Further investigations into vha19 as a lethal target for adult MPB are required to reach an
improved conclusion.
3.4.4 No RNAi initiation when submerging adult male mountain pine beetles in hpRNAexpressing yeast solutions
As the first trial using heat-inactivated, hpRNA-expressing yeast on adult male MPB, this
experiment focused on two gene targets: iap and mesh. The average adult male MPB mortality
from two repetitions was higher than expected in the two control groups: water (H2O) and
0.1mg/ml of hpRS-expressing yeast (hpRS_0.1). Both hpIAP treatment groups did show more
mortality than the hpRS group by day six, but two out of the three dsMESH/hpMESH groups
showed less mortality than both control groups by day six. Beetles in the 0.1mg/ml hpMESHexpressing yeast treatment had more mortality than the hpRS control. Considering the mortality
data, the hpRNA expressed and delivered to the adult male MPB by heat-inactivated yeast did
not cause targeted mortality. Additionally, the MPB mortality in the water control group suggests
that the observed mortality could be due to confounding factors, such as cold storage and late
emergence, similar to observations in the female submergence bioassays (see section 3.4.5).
Gene expression analysis further confirmed that all treatments were unsuccessful at
achieving an RNAi response. The mean relative log2 expression in the hpRNA-expressing yeast
groups for each target are similar to one another and to the controls. Interestingly, the mean
relative log2 expression of the mesh gene in the dsMESH group is higher than the mean relative
log2 expression in the hpMESH-expressing yeast and control groups (Fig 3.5). While not
statistically significant, this pattern matches what was reported in the previous submergence

95

assay where exposure to dsMESH via submergence led to a statistically significant increase in
mesh expression in adult MPB (section 3.3.4.1, see Fig 3.3E). In the first submergence bioassay,
the gene expression was quantified at 24h post-submergence, whereas in the male MPB bioassay
the gene expression was quantified after 72h. Therefore, this suggests that the pattern of higher
mean mesh expression is consistent over a 72h period post-submergence. Increases in gene
expression has been observed after 72h in Ips calligraphus (Wallace and Rieske 2023). The
expectation that increased mesh expression is stable over time is plausible, but fluctuating gene
expression levels over the duration of a bioassay have been reported in Adalia bipunctata and
Coccinella septempunctata (Haller et al. 2019). With the non-statistically significant increase in
mesh gene expression in the male MPB bioassay, it is also possible that mesh expression
decreases over time after the initial increase at 24h post-submergence. Without quantifying the
gene expression in the same bioassay over consecutive timepoints, the actual pattern of gene
expression cannot be determined.
3.4.5 Successful RNAi initiation in female adult mountain pine beetles submerged in in vitro
dsRNA with gene expression quantified at consecutive time points
The mortality of adult female MPB remained low for the first three days in all control
groups and in the dsIAP and dsVHA19 groups, more akin to expectations based on mortality
observations from other MPB studies (Kyre et al. 2020). Beetle mortality in the dsIAP group was
similar to the no submergence control group, once again suggesting that the dsIAP treatment is
not lethal to adult female MPB. With higher survival percentages in two out of three controls,
this bioassay better displays the effects of target dsRNA than previous bioassays that appeared to
have confounding variables impacting MPB mortality (section 3.3.5/3.3.6). With rapid mortality

96

evident in two treatment groups, it appears that the dsMESH and dsVHA19 had a lethal effect on
adult female MPB.
3.4.5.1 RNAi-mediated iap suppression
Our study is the first to incorporate multiple negative controls with MPB submergence,
and the results show the importance as it can influence the interpretation. For example, iap
expression in the dsIAP group was significantly different than in the dsRS group after 24h in an
earlier bioassay (see section 3.3.4.1, Figure 3.3) but is only significant from the no submergence
control and water groups, not dsRS, after 24h in this assay. This study is the first to quantify iap
gene expression in treatment groups over three time points. The mean log2 relative iap
expression in the dsIAP group does not significantly change over time and neither do any of the
controls, contradicting an earlier assumption that iap expression was changing over 24h (See
Chapter 2, section 2.4.2.2). Though there is a significant decrease in iap expression, it is not a
complete knockdown and is not associated with MPB mortality. Additionally, the variability in
gene expression among the four bioassays in our project suggests that iap may not be a reliable
lethal target for RNAi in adult female MPB.
3.4.5.2 RNAi-mediated vha19 suppression
The pattern of relative log2 vha19 expression in the dsVHA19 group is not significantly
different over the 72h quantification period, but when compared to the controls the significance
does change over time. Interestingly, the vha19 expression in each of the control groups over
time is also not different. The lower vha19 expression in the dsVHA19 treatment compared to
the no submergence control at 24h, no difference from any controls at 48h, and lower vha19
expression in the dsVHA19 treatment compared to the no submergence control and dsRS at 72h
indicates that the differences are significant but slight. It does appear that the slight vha19

97

suppression changes are contributing to MPB mortality, unlike what was observed in dsIAP.
Conversely, in an earlier bioassay, dsVHA19 treatment led to increased vha19 expression in
MPB at 24h (section 3.3.4). No significant difference was found between female MPB in the
dsVHA19 groups and control groups in yet another previous submergence assay (section 3.3.5),
adding to the variation in MPB gene expression response to dsVHA19.
Other studies investigating a different vATPase gene also showed varying levels at
different time points. In Adalia bipunctata the expression of vATPase A was stable over time
when measured every 48h, and in Coccinella septempunctata, vATPase A was stable for low
dsRNA doses (0.25μg/μl) and more variable with higher (25μg/μl) doses (Haller et al. 2019). In
some cases, with a high or low dose, the variation among time within the same treatment group
was not significant, like in our study. However, in other target and dose combinations, the
variation within a treatment group over time was significant (Haller et al. 2019). In our study,
only one dosage with no off-target species testing was performed, which are factors that likely
impacted the vha19 expression variation over time. In MPB, dsVHA19 appears to be a possible
lethal target, but still shows variation among bioassays and even within the bioassays at different
time points.
3.4.5.3 Delayed response in adult female MPB to dsMESH delivery
The absence of a difference in the mean relative log2 mesh expression at 24h and 48h post
dsMESH exposure was unexpected when compared to the rapid mortality of MPB treated with
dsMESH. By 72h, the mean log2 relative mesh expression was lower than the no-submergence
control. This gene expression difference coincides with the first MPB mortalities in the dsMESH
group; however, gene suppression is expected to have been detected before. This is based on
Kyre et al. (2020) observing gene suppression in adult MPB 24h post-dsRNA exposure when

98

mortality began days later, though mesh was not one of the tested targets. No response in MPB
mesh expression at 24h contradicts the findings of a previous bioassay in this study that reported
increased mesh expression after 24h (section 3.3.4.1). However, in a male MPB assay, no mesh
expression changes were reported after 72h (section 3.3.6).
Our study is the first to test dsMESH on adult MPB, but mesh has been targeted in other
studies investigating Coleopteran insect larvae (Hu et al. 2016; Petek et al. 2020). In Diabrotica
virgifera virgifera, reducing mesh expression via ingestion of dvssj2 (mesh homolog) in larvae
caused mortality (Hu et al. 2016). Similarly, a study testing mesh as a target for Leptinotarsa
decemlineata reported increased larvae growth impairments and mortality after dsMESH
ingestion in both laboratory and field trials (Petek et al. 2020). These findings support our study
with observed adult MPB mortality when treated with dsMESH. However, Petek et al. (2020)
did not report mesh expression quantification, there is no way to compare the trend observed in
the time series. While there appears to be a correlation between adult female MPB mortality and
reduced mesh expression, the results are variable like in the other two targets in this bioassay.
3.4.6 dsRNA uptake success
The findings from this study show variable results in all gene targets that were tested in
more than one bioassay and over time in the last bioassay. It also showed MPB mortality when
treated with dsMESH but mesh suppression was only observed starting at 72h post-submergence.
One explanation for the variable results is that the quantified gene expression changes observed
are due to chance. This is plausible in the vha19 target as repeated testing showed variation with
no discernable pattern, and gene expression was found to increase in one assay and slightly
decrease in another. However, another explanation for the variable gene expression, and even
mortality, is the dsRNA or hpRNA uptake efficiency by MPB when submerged. In early trials

99

using a coloured sucrose solution, only 60% of MPB had confirmed uptake. This means that
gene expression can be skewed as most beetles are still alive when frozen, and a subset of these
may have not successfully ingested the dsRNA. Additionally, when observing mortality,
treatments with survival that is higher than expected might be due to some MPB not ingesting
the treatment. Future studies should compare gene expression in the deceased MPB to the alive
ones to see if this theory holds merit.

100

3.5 Conclusion
This study tested two previously successful targets and four novel targets on emerged
adult mountain pine beetles (Dendroctonus ponderosae, MPB) by submerging the beetle in
liquid dsRNA. This study is also the first to test heat-inactivated, hpRNA-expressing yeast as a
delivery method for dsRNA to MPB. Four out of six targets tested on adult MPB showed
significant gene expression differences. The first, dsIAP, caused decreased gene expression in
two of the four bioassays it was tested in. The next three, dsMESH, dsSSK, and dsVHA19
showed up-regulation in adult MPB in an initial submergence assay. In two subsequent assays
for each target, dsMESH only triggered any gene suppression in one and dsVHA19 only
decreased gene expression in one assay. The yeast-expressed hpMESH and hpVHA19 did not
elicit and RNAi response when tested in assays alongside dsMESH and dsVHA19. The
remaining two targets: dsHSP and dsTSP2A did not cause gene expression changes. As a first for
MPB responses to RNAi, the last bioassay quantified gene expression patterns over time in adult
females. With no significant changes in gene expression within treatment groups over time,
target gene knockdown appears stable over three days. The submergence method elicits an RNAi
response, with success impacted by beetle condition and uptake efficiency.

101

Chapter 4 - Investigating the effectiveness of delivering heat-inactivated, hpRNAexpressing yeast through phloem to adult mountain pine beetles.
4.1 Introduction
Laboratory-based studies providing support for RNAi efficacy in insects have mainly
used microinjection or forced oral ingestion (Turner et al. 2006; Keeling et al. 2013; Zhao et al.
2015; Zhang et al. 2016; Wang et al. 2016; Rodrigues et al. 2018; Kyre et al. 2019; Haller et al.
2019; Kyre et al. 2020; Liu and Chen 2022; Wallace and Rieske 2023). Microinjection and some
oral ingestion methods, like submergence, are not applicable for field-based tests or, ultimately,
use in in-situ applications due to the method protocols and treatment of individual beetles (see
Chapter 2, section 2.3.2 and Chapter 3, sections 3.2.2/3.2.3). Switching from these strictly
laboratory-based methods to methods that can be applied in situ is important for the next step of
testing RNAi as a pest management tool. However, the dsRNA delivery method can affect RNAi
initiation, and further testing would be required in this intermediate step before in situ
application (Cooper et al. 2019). Studies have started to investigate the RNAi response when
dsRNA is delivered by associating it with a natural or artificial diet (Hu et al. 2016; Ghosh et al.
2018; Pampolini and Rieske 2023). Additionally, the response of insects fed microbe-expressed
dsRNA associated with a diet have been studied (Zhu et al. 2011; Murphy et al. 2016; Leelesh
and Rieske 2020).
Association of dsRNA to either a natural or artificial diet has been shown to successfully
initiate an RNAi response in insects. Green beans were used to entice ingestion of dsRNA by the
brown marmorated stink bug (Halyomorpha halys) nymphs as 0.017μg/μL vitellogenin or
0.067μg/μL of juvenile hormone acid O-methyltransferase dsRNA was moved through the beans
using capillary action (Ghosh et al. 2018). After feeding on green beans for five days, with diet
102

replacement at day three, a significant decrease in the expression of both targeted genes was
reported (Ghosh et al. 2018). Additionally, dsRNA delivered to Asian citrus psyllid (Diaphorina
citri) and glassy-winged sharpshooter leafhopper (Homalodisca vitripennis) via foliar sprays,
translocation into tissues from root soaks, tissue absorption, or trunk injections of cultivated
Citrus sinensis x Poncirus trifoliata crosses led to RNAi-mediated gene suppression (Ghosh et
al. 2018).
Associating dsRNA with diets has also been effective for RNAi initiation in Coleopteran
insects. Successful RNAi was reported after using a foliar spray on the natural diet of the
emerald ash borer (Agrilus planipennis) (Pampolini and Rieske 2023). Green ash seedling stems
and leaves were sprayed with 500μg of dsHSP, which caused decreased hsp expression when
ingested by EAB larvae. Decreased gallery area and tissue consumption were also reported
(Pampolini and Rieske 2023). An artificial diet was used to entice ingestion of dsRNA (1.5μg/μl)
targeting Drosophila ssk and mesh orthologs in western corn rootworm (Diabrotica virgifera
virgifera) first instar larvae (Hu et al. 2016). As a result, significant gene suppression in the ssk
ortholog was reported, while the gene expression analysis results for the mesh ortholog were not
reported. In a second study using an artificial diet and dsRNA (167ng/μl) targeting the ssk
homolog feed to western corn rootworm (Diabrotica virgifera virgifera) first instar larvae,
successful RNAi response was achieved, as determined by decreased mRNA and protein levels
associated with increased mortality compared to the control treatment (Hu et al. 2019). Another
study reported vacuolar ATPase (vATPase) suppression and increased mortality in western corn
rootworm adults fed 0.5μg or 1μg of dsRNA associated with an artificial diet (Rangasamy and
Siegfried 2012). While the use of a natural or artificial diet in laboratory-based settings appears

103

to be effective, the instability of in vitro synthesized dsRNA in in situ applications remains a
concerning variable.
Many RNAi studies use microbes to produce and deliver the dsRNA, increasing dsRNA
stability and reducing production costs (Duman-Scheel 2019; Hashiro and Yasueda 2022). Some
vehicles that have been successful at RNAi initiation in insects include bacteria and yeast.
Transformation of a vector in Escherichia coli led to successful production of dsRNA and
downstream RNAi response when fed to neonate emerald ash borer larvae (Leelesh and Rieske
2020). An increase in larval mortality alongside decreased target gene expression was reported
(Leelesh and Rieske 2020). Similar success was also reported in Colorado potato beetle larvae
after eating potato leaves covered in heat-killed, dsRNA-expressing bacteria (Zhu et al. 2011).
Gene expression of all five targets, β-Actin (Actin), Protein transport protein sec23 (Sec23),
Vacuolar ATP synthase subunit E (vATPaseE), Vacuolar ATP synthase subunit B (vATPaseB),
and Coatomer subunit beta (COPβ), was significantly decreased and increased mortality
observed compared to the controls (Zhu et al. 2011). Additionally, the heat-killed, dsRNAexpressing bacteria was cheaper to produce and caused larger gene suppression than in vitro
synthesized dsRNA for three, Actin, Sec23, and COPβ, of the five targets (Zhu et al. 2011). In
contrast, for Drosophila suzukii larvae, in vitro synthesized dsRNA was more efficient than
Brewer’s yeast (Saccharomyces cerevisiae) expressing the dsRNA when ingested (Murphy et al.
2016). However, the dsRNA-expressing yeast still impacted D. suzukii fitness (Murphy et al.
2016). Two of these studies used in vitro or microbe-mediated dsRNA associated with a natural
diet for delivery to targeted insects (Zhu et al. 2011; Pampolini and Rieske 2023).
Using dsRNA delivered to MPB via a natural or artificial diet has not been investigated.
One obstacle is that emerged and flying adult MPB typically select large pine trees (Dhar et al.

104

2016a), which are not optimal for a laboratory study of this nature. However, MPB have been
reared post-injection using simulated tree cortex conditions (Keeling et al. 2013). Keeling et al.
(2013) reared teneral adult MPB to full adults using layers of phloem punches in the wells of a
24-well plate, with a small amount of baker’s yeast and one beetle added to each well (Keeling et
al. 2013). This method was coined “phloem homes” (C.I. Keeling and C.C Chiu, personal
communication, 2022) and provided natural diet and living conditions for MPB ingestion and
development.
In this study, the phloem homes method was adapted to deliver heat-inactivated, hpIAPexpressing yeast to MPB. The objective of the study was to test the efficacy of heat-inactivated,
hpRNA-expressing yeast associated with lodgepole pine (Pinus contorta) phloem to initiate an
RNAi response in adult MPB. Only one target, iap, was chosen based on the previous gene
suppression observed in the submergence assays (Chapter 3, section 3.3.4 and 3.3.7.1). Three
different yeast solutions and phloem associations were used: yeast solutions painted on to
phloem (PHP), yeast solutions translocated through the phloem (PHT), and phloem soaked in
yeast solutions (PHS). Within each association, different hpIAP-expressing yeast solution
concentrations were tested, along with two negative controls for comparison. After initially
testing each association type, no MPB mortality or iap expression changes were observed
between the treatment and control groups in the gene expression analysis. A second attempt at
painting higher concentrations of the hpIAP-expressing yeast solutions onto the phloem (PHP24)
yielded MPB mortality, but was later obscured by fungus. With high MPB survival in the
negative controls, and the start of a lethal response in MPB to targets, this method shows promise
for dsRNA delivery to MPB.

105

4.2 Methods
4.2.1 Subject Collection
Subject collection was previously described (see Chapter 2, section 2.2.1). The majority
of MPB used in the following assays were from Smithers, BC and all emerged naturally. In
2023, emerged MPB were collected from bolts from Smithers, B.C. and used in the assays
described in 4.2.3.1, 4.2.3.3, and 4.2.3.4. Lastly, in 2024 bolts were received from Smithers,
B.C., and emerged MPB were used in the section 4.2.3.2 assay. All emerged MPB were
collected, and MPB exhibiting obvious physical ailments or lower health (missing appendages,
extremely lethargic) were excluded from assays.
4.2.2 Ground Phloem Feeding Trails
4.2.2.1 Phloem Preparation
Phloem was removed from a young (approximately 10 years old) lodgepole pine (Pinus
contorta) and the outer bark was removed, limiting the contamination from microorganisms
present in the bark in the final ground phloem (Whitney and Spanier 1982). Phloem sheets were
frozen at -25°C overnight and cut into small pieces the following morning. The pieces were
further processed in a coffee grinder for approximately 30s. The resulting ground phloem was
moved to a mortar with liquid nitrogen and a pestle was used to further grind the phloem. The
ground phloem was stored in the freezer at -25°C.
4.2.2.2 Feeding Assay Trial
A feeding assay, developed by modifying the submergence assay (see Chapter 3, section
3.2.3/3.2.5) was tested using ground phloem to entice ingestion of dsRNA targets. Emerged adult
MPB were assigned to one of three treatment groups (n=10): (1) submergence in a blue-dyed 1%
sucrose solution, (2) ground phloem soaked with blue-dyed 1% sucrose solution, or (3) blue106

dyed 1% sucrose solution-soaked filter paper placed between the beetle and the phloem. Beetles
in the first treatment group were submerged for 12h following the previously described protocol
(see Chapter 3, section 3.2.3) and stored in the dark at 23°C.
In the second treatment group, ground phloem was compacted to the bottom of 0.2ml
PCR tubes. The compacted phloem was then soaked with 6μl of the blue-dyed 1% sucrose
solution and an adult MPB was added to the tube and kept confined with a piece of compressed
Kimwipe. The tube was kept horizontal and beetles were left in the tubes for 12h in the dark at
23°C.
The third treatment group of soaked filter paper between the beetle and the phloem
involved compacting phloem into the bottom of a 0.2ml PCR tube. A punch of filter paper was
soaked with 6μl of dyed sucrose solution and placed atop the compacted phloem, ensuring it
covered the top of the phloem and was snug to the tube all around with no phloem on top of or
showing beside the filter paper. An adult MPB was then added to the tube and its movement
constricted with a compressed piece of Kimwipe. The beetle was left in the tube, with the tube
placed horizontally, for 12h in the dark at 23°C.
In all three treatment groups, beetles were removed after 12h, placed in petri dishes lined
with moistened filter paper, and returned to the dark for two hours. After the two hours, beetles
were dissected to observe the presence or absence of blue dye within the gut.
The third method, soaked filter paper on top of ground phloem, was repeated once more,
with modification to the composition of the phloem and filter paper. Once the phloem was
compressed to the bottom of a 0.2ml PCR tube, 4μl of water was added to the phloem for greater
adherence to the punched-out piece of filter paper that was placed on top. Blue food colouring
was then directly added to the filter paper and a light layer of phloem placed on top of the filter

107

paper to weigh it down and further entice the beetle to ingest the dyed filter paper. Beetles
(n=10) were placed horizontally in the dark at 23°C and checked twice at 2h intervals. After 4h,
beetles were dissected to observe the presence or absence of blue dye in the beetle midgut.
The soaked phloem method was also repeated once more, incorporating similar
modifications as the filter feeding method. Ground phloem was compacted into a 0.2ml PCR
tube and 2μl of blue food colouring dye added directly onto the phloem. Beetles (n=10) were
placed in the horizontal tubes and left for 4h in the dark at 23°C. Beetles were removed from the
tubes and placed in a petri dish with moistened filter paper. After 0.5h, beetles were dissected to
observe the presence or absence of blue dye.
4.2.2.3 Feeding Assay – dsRNA targets IAP and HSP
Following the methods previously outlined (see section 3.2.2), ground phloem was
compressed into the bottom of a PCR tube, with one side slightly higher than the other for an
angled finish. The in vitro synthesized dsIAP, dsHSP, and control dsRS were normalized to 5μg
and the calculated volume of dsRNA, a range of 2.5-2.7μl, was added to the top of the phloem.
To the controls, 2.5μl of distilled water was added to the phloem. Forty emerged adult MPB
collected four to nine days before the assay were distributed among treatments, and the two subgroups within each treatment, to ensure that all collection dates were represented in each
treatment. In each treatment group, ten beetles were assigned to the mortality observation group,
and five beetles were assigned to the gene expression analysis group. Beetles were kept in the
horizontally-placed tubes, in the dark at 23°C for 4h. After, beetles were removed and placed on
moistened filter paper in petri dishes in the dark. Beetles in the gene expression groups were
flash frozen 24h after initial exposure to the dsRNA targets, and stored at -80°C. Beetles in the
mortality observation groups were checked daily, with the filter paper changed every 48h.

108

4.2.3 Phloem home feeding trials
To set up phloem homes, phloem was harvested from a lodgepole pine tree and the outer
bark was removed from some pieces of phloem. Phloem was punched with a 12mm leather
punch, and bottom layers had a small crescent removed to allow room for the beetle and avoid
squishing the beetle with the top layer. Twelve wells of a 24-well plated were filled with two
pieces, or layers, of phloem. This phloem still had the bark attached, and pieces were stacked so
that the phloem faced the middle. The other 12 wells were filled with three pieces, or layers, of
phloem, with two pieces having the outer bark removed. These two were placed in the well first,
and topped with the third piece containing outer bark with the bark facing the top, or outside, of
the stack (Figure 4.1).

Figure 4.1 Arrangement of lodgepole pine (Pinus contorta) phloem punches in a sterile 24-well plate
creating “phloem homes” (C.I. Keeling and C.C Chiu, personal communication, 2022). The twolayered adaption is shown with the top layer removed and placed below the well plate.

To investigate MPB survival in the phloem homes, twelve adult MPB (six females and
six males) were assigned to each phloem composition type and placed under the top layer of
phloem in the assigned well. Adult MPB were sexed using auditory examination, where males
109

chirp when pressure is applied to the margins of the pronotum with thumb and forefinger
(Rosenberger et al. 2016). For increased accuracy, all beetles that did not chirp were re-tested to
catch formerly silent males (Rosenberger et al. 2016). A moistened Kimwipe was placed on top
of the well plate under the lid. The plate was placed in the dark at 20°C and checked daily for 14
days, recording beetle mortality, wood quality, and beetle chewing progress. The Kimwipe was
changed daily.
4.2.3.1 Phloem home – yeast solutions painted on phloem (PHP)
Freshly harvested phloem with the bark still attached was punched with a 15mm leather
punch, to better fit the wells than in the trials (see section 4.2.2), making enough phloem discs
for two per well in a 24-well plate per treatment. Using solutions consisting of heat-inactivated,
hpRNA-expressing yeast and water, a total of five treatments were tested: water and 0.1mg/ml
hpRS as controls, 0.01mg/ml hpIAP, 0.05mg/ml hpIAP, and 0.1mg/ml hpIAP. Each treatment
was painted on to 48 pieces of phloem twice, for a total of two coats of assigned solution. Adult
MPB were added on top of the first piece of phloem in the plates, with one beetle per well.
Emerged adult MPB collected from five different dates within a week of the assay were evenly
distributed among the five treatments, and the two sub-groups within each treatment, to ensure
that each collection date was represented. Within each treatment, 18 beetles (14 females, four
males) were assigned to the mortality observation group, and six (three females, three males)
were assigned to the gene expression analysis group. The top piece of phloem was gently placed
on top of the first piece and the beetle, with the bark facing out. A dry Kimwipe was placed on
top of the wells, under the plate lid. Plates were stored in a dark incubator at 21-23°C. Beetle
mortality, wood quality, and chewing progress of beetles were checked daily for 15 days. The

110

beetles assigned to gene expression analysis were flash frozen in liquid nitrogen 72h after initial
exposure to the treated phloem.
4.2.3.2 Phloem home – yeast solutions painted on phloem 2024 (PHP24)
The previously outlined procedure for painting yeast solutions onto phloem was
followed, with a few alterations (refer to section 4.2.2.1). Concentration of the heat-inactivated,
hpRNA-expressing yeast and MilliQ water solutions were increased for the control and treatment
solutions: MilliQ water, hpRS (5mg/ml), hpIAP50 (0.5mg/ml), hpIAP100 (1mg/ml), and
hpIAP500 (5mg/ml). Emerged adult MPB collected from three different dates within four days
of the assay were evenly distributed among the five treatments, and the two sub-groups within
each treatment, to ensure that each collection date was represented. Male beetles were used
within two days and females were used within five days. Beetles were sexed as previously
described (see section 4.2.3.1) and a pair of beetles (a male and a female) were added to each
well. All males were removed after 48h. Twelve females were assigned to the mortality
observation group, six were assigned to the 72h post-exposure gene silencing group, and six
were assigned to the 120h post-exposure gene silencing group. Plates were stored under a
cardboard box (i.e. in the dark) at room temperature, fluctuating around 20°C. Beetle mortality,
wood quality, and chewing progress of beetles were checked daily for 14 days. The beetles
assigned to gene expression analysis groups were flash frozen in liquid nitrogen at the designated
time (72h or 120h) after initial exposure to the treated phloem. The treated phloem was replaced
three days into the assay with fresh treated phloem.
4.2.3.3 Phloem home – phloem soaked in yeast solutions (PHS)
A quick trial to determine the optimal soaking time of phloem punches in liquid was
performed with water. Freshly harvested phloem was punched into 15mm diameter discs and

111

fully submerged in water. Punches were checked after 1, 4, 7, 24, and 48h of soaking. The
thoroughness of the soaking into the middle of the disc, as well as the phloem integrity (firm or
flaccid) was checked and recorded.
After the optimal soaking time for phloem integrity and thoroughness of soaking into the
disc was determined to be 24h, four solutions of heat-inactivated, hpRNA-expressing yeast at
different concentrations were made and enough phloem punches for one plate (48 plus extra for
insurance) soaked in the solutions. Enough punches for one plate were soaked in water as a
control. In total, five treatments were applied to the phloem for 24h: water, 0.1mg/ml hpRS,
0.01mg/ml hpIAP, 0.05mg/ml hpIAP, and 0.1mg/ml hpIAP.
After soaking for 24h, phloem punches were placed into the wells of the 24-well plates
for each treatment. Phloem was briefly air dried to remove excess moisture before a beetle was
added to each well. Emerged adult MPB collected from three different dates within a week of the
assay were evenly distributed among the five treatments, and the two sub-groups within each
treatment, to ensure that each collection date was represented. Beetles were sexed as outlined
previously (section 4.2.3.1) and within each treatment, 18 beetles (14 females, four males) were
assigned to the mortality observation group and six (females) were assigned to the gene
expression analysis group. Plates were stored in the same conditions as PHP assay (section
4.2.2.1). Beetle mortality, wood quality, and chewing progress of beetles were checked daily for
14 days. The beetles assigned to gene expression analysis were flash frozen in liquid nitrogen
72h after initial exposure to the treated phloem.

112

4.2.3.4 Translocated yeast solutions through the phloem
4.2.3.4.1 Translocation Trials – water and yeast
Phloem removed from a young lodgepole pine (Pinus contorta) tree was used in a
modification of “phloem sandwiches”. Phloem pieces were placed between two pieces of damp
paper towel lining the inner sides of 6-inch x 6-inch glass plates. All components were put
together and held in place with large binder clips. These “sandwiches” were placed upright in a
Tupperware container with the bottom edge of the phloem submerged 1cm into the water dyed
with blue food colouring (Figure 4.2A). A fan was used to move air over the sandwiches,
inducing capillary uptake. The phloem was checked and blue dye progress up the strip measured
after 4h and after soaking overnight.
A)

B)

Figure 4.2 Set up for blue-dyed water translocation through lodgepole pine (Pinus contorta) phloem trials.
A) “Phloem sandwiches” in blue dyed water. Pieces of phloem are placed between two moistened paper
towels on the inside of glass squares and clipped together. B) Lodgepole pine rounds placed in blue-dyed
water immediately after being cut.

A second method tested translocation through a young pine tree trunk cut into rounds and
the freshly cut edge placed immediately into blue-dyed water to prevent sap sealing the phloem
(Figure 4.2B). A fan was used to move air above the rounds, promoting capillary action. The
113

rounds were checked daily for three days for presence of dye at the top or along the bark on the
side.
After trials with blue-dyed water, new rounds were used to test the translocation of heatinactivated, hpRNA-expressing yeast solutions through the phloem. Rounds were placed in one
of four different yeast solutions: 0.1mg/ml hpRS, 0.01mg/ml hpIAP, 0.05mg/ml hpIAP, and
0.1mg/ml hpIAP, with one or two rounds per treatment. The rounds were left in the solutions
under a fan for four days, topping up the solutions daily.
Digital droplet PCR (ddPCR) was used to confirm the presence of hpRNA in the bottom,
middle, and top portions of the rounds. Total RNA was extracted from the lodgepole pine (Pinus
contorta) punches using the Qiagen RNeasy PowerPlant kit with on-column DNase digestion
following manufacturer protocols (Qiagen, Toronto, ON). There were some exceptions to the
protocol. Lysis buffer was prepared and aliquoted into bead tubes before adding the sample.
Samples were homogenized using a bead beater for two minutes in one-minute intervals. The oncolumn DNase treatment was performed after the PM5 wash step (step 10) of the RNeasy
PowerPlant kit protocol and digestion time was increased from 15 to 18 minutes. Extracted RNA
was quantified with the Qubit 4 Fluorometer High Sensitivity Assay (Thermo Fisher Scientific
Inc., 2015) and the integrity was checked using the Agilent RNA 6000 Nano Kit on the Agilent
Bioanalyzer 2100 (Agilent, Santa Clara, CA). All samples were of acceptable quality for
downstream applications. Next, cDNA was synthesized using the iScript™ Reverse
Transcription Supermix (Bio-Rad Laboratories (Canada) Inc., Mississauga, ON), following the
kit protocol. Input RNA was normalized to 300ng. Each section (top, middle, and bottom)
included a no-reverse transcriptase control (no-RT), where a supermix without RT replaced the
normal supermix, to ensure there was no DNA contamination in this step. The cDNA was used

114

for ddPCR with the designed dsRS assay (see Chapter 2, section 2.2.8.2, Table 2.2). Positive and
negative controls were included using gBlock and water, respectively.
4.2.3.4.2 Phloem home – yeast solutions translocated through the phloem (PHT)
The treated phloem with the bark still attached was carefully removed and punched with
a 15mm leather punch, making enough phloem discs for two per well in a 24-well plate per
treatment. Punches taken from the bottom of the rounds were the bottom layer in each well, and
the top pieces in the wells were taken from the top of the round. Sample phloem punches from
the bottom, middle, and top of the rounds were frozen for later analysis to confirm the success of
translocation of the yeast through the phloem.
Using solutions consisting of heat-inactivated, hpRNA-expressing yeast and water, a total
of five treatments were tested: water and 0.1mg/ml hpRS as controls, 0.01mg/ml hpIAP,
0.05mg/ml hpIAP, and 0.1mg/ml hpIAP. Adult MPB were added on top of the first piece of
phloem in the plates, with one beetle per well. Emerged adult MPB collected from eight different
dates within ten days of the assay were evenly distributed among the five treatments, and the two
sub-groups within each treatment, to ensure that each collection date was represented. Beetles
were sexed as previously described (section 4.2.3.1) and in each treatment group, 18 beetles
(water, 0.1mg/ml hpRS, and 0.01mg/ml hpIAP: 14 females, four males; 0.05mg/ml hpIAP and
0.1mg/ml hpIAP: 13 females, five males) were assigned to the mortality observation group and
six (three females and three males) were assigned to the gene expression analysis group. Plates
were prepared and stored in the same conditions as previously outlined (see sections
4.2.2.2/4.2.2.3). Beetles assigned to gene expression analysis were flash frozen in liquid nitrogen
72 hours after initial exposure to the treated phloem.

115

4.2.4 Gene expression analysis
The gene expression pipeline has been described in Chapter 2 (section 2.2.8) and
summarized in Chapter 3 (section 3.2.9).

116

4.3 Results
4.3.1 Phloem Preparation and Feeding Trial Results
Trials conducted to study the uptake of target fluid show more MPB were ingesting the
target liquid in the soaked phloem method compared to the other two methods (Table 4.1).
Refinement of the method to soak phloem with the target liquid had an uptake of 90%, similar to
prior results and showing the highest uptake percentage.
Table 4.1 A tally of the best uptake success among the different trials (determined by the presence or
absence of blue dye in MPB adult (n = 10) guts) 12h after exposure to the blue-dyed 1% sucrose solution.

Submerged
Soaked phloem
Soaked filter on phloem

Blue-dye present
5
9
6

Blue-dye absent
5
1
4

4.3.2 Mortality of MPB fed dsRNA-soaked ground phloem
Mortality of MPB fed 5μg of each target dsRNA, including the controls, was similar over
the 11 days (Figure 4.3). For the first six days, mortality in all groups was less than 50%, but
increased greatly after this.

117

Figure 4.3 Percent survival over 11 days of adult MPB fed 5μg of target dsRNA for two
gene targets (n=10): dsIAP and dsHSP. The survival of two negative controls: water
(H2O) and a double-stranded random stem (dsRS; does not match any transcript in the
mountain pine beetle transcriptome) was plotted alongside for comparison.

4.3.3 Translocation trials
Translocation of water and yeast solutions in tree rounds was a better method than
translocation through phloem sandwiches. After four hours, blue dye was observed 2-6cm up the
phloem pieces in the sandwiches, though the presence was inconsistent along the width of the
piece. The translocation distance also appeared to differ among the different pieces. After 96h, it
appeared that the translocation had moved entirely up the height of the phloem piece, though the
progress still appeared inconsistent based on the blue dye (Figure 4.4).

118

A)

B)

Figure 4.4 Progress of blue-dyed water translocated through lodgepole pine (Pinus contorta) phloem in
“phloem sandwiches” after A) 4h and B) 96h.

Pine rounds showed more consistent translocation when placed in four different yeast
solutions: 0.1mg/ml hpRS, 0.01mg/ml hpIAP, 0.05mg/ml hpIAP, and 0.1mg/ml hpIAP (Fig 4.5).
Successful translocation in the rounds was determined by blue dye showing around the
circumference on the tops of the rounds. Blue dye was present at the top of the rounds after 96h,
and presence of hpRNA was detected with ddPCR in cut outs from the bottom, middle, and top
of the phloem after translocation.

119

A)

B)

Figure 4.5 Translocation success of blue-dyed hpRNA-expressing yeast solutions through lodgepole
pine (Pinus contorta) phloem in the cut trunk after 96h. A) Presence of blue dye around the
circumference at the top B) Phloem separated from the rest of the tree round, showing the presence
of blue dye at the top and bottom.

4.3.4 Phloem home trial
An initial trial was conducted to determine the MPB survival and phloem longevity in the
phloem homes. When placed in the phloem homes, most females had burrowed into the phloem
after two days. After about ten days, the wood quality declined, appearing slimy. However, no
fungus was present on the MPB. Some beetles escaped from the designated well, indicating that
the phloem punches should be larger.
Mortality of MPB in the three or two layered wells was similar with four and five deaths
over 13 days, respectively. The two layered set up was used for further phloem homes as it
appeared to promote burrowing, and therefore chewing, among female MPB (Figure 4.6).

120

A)

B)

Figure 4.6 Phloem home trial after 13 days. A) Wells marked with white had the phloem removed after
MPB mortality. Lots of frass in wells indicates successful MPB chewing. B) Removed top layer shows
MPB burrow in the bottom layer.

4.3.5 Phloem home – yeast solutions painted on phloem (PHP)
4.3.5.1 Repetition one: mortality and iap expression analysis
All targets and controls showed high survival rates over the 14-day duration of the assay (Figure
4.7). Mortality was highest, with approximately 23%, in the beetles treated with the lowest
concentration of hpIAP-expressing yeast solution: 0.01mg/ml hpIAP (0.01_hpIAP). There was
no MPB mortality in the control group 0.1mg/ml hpRS (0.1_hpRS), and approximately 6%
mortality in the water (H2O) group.

121

Figure 4.7 Percent survival of adult MPB fed lodgepole pine (Pinus contorta) phloem
painted with different amounts of dsIAP- expressing yeast (n=18): 0.01mg/ml hpIAP
(0.01_hpIAP), 0.05mg/ml hpIAP (0.05_hpIAP), and 0.1mg/ml hpIAP (0.1_hpIAP). The
survival of MPB in two negative controls: water (H2O) and 0.1mg/ml hpRS (0.1_hpRS;
does not match any transcript in the mountain pine beetle transcriptome) was included for
comparison.

A one-way ANOVA test reported that there was no statistically significant difference in
the mean log2 relative iap gene expression between any of the treatment and control groups (p =
0.277, F = 1.359, df = 4) (Figure 4.8).

122

Figure 4.8 Comparison of the mean (n=6) of the log2 transformed relative iap gene
expression between 0.01mg/ml hpIAP (0.01_hpIAP), 0.05mg/ml hpIAP (0.05_hpIAP),
0.1mg/ml hpIAP (0.1_hpIAP) and the control groups: water (H2O) and 0.1mg/ml hpRS
(0.1_hpRS, n = 5) 72h after initial exposure. Statistical analysis using a one-way ANOVA
reported no significant difference between the mean log2 transformed relative iap gene
expression among groups (p = 0.277, F = 1.359, df = 4).

4.3.5.2 Second repetition: mortality and iap expression analysis
Mortality of female adult MPB was higher in the second PHP assay that tested higher
hpIAP-expressing yeast concentrations (Figure 4.9). After three days, all three hpIAP treatment
groups showed mortality, along with the hpRS group (5.0_hpRS). On day four, MPB mortality in
the three treatment groups was higher than in the control groups. The difference in MPB
mortality between the treatment and control groups increased on day five. By day six, fungus
was present on MPB and MPB mortality in the controls increased. The mortality observations
were stopped on day eight due to the fungal growth.

123

Figure 4.9 Percent survival of adult female MPB fed lodgepole pine (Pinus contorta)
phloem painted with different amounts of hpIAP-expressing yeast (n=18): 0.5mg/ml hpIAP
(0.5_hpIAP), 1.0mg/ml hpIAP (1.0_hpIAP), and 5.0mg/ml hpIAP (5.0_hpIAP). The
survival of MPB in two negative controls: water (H2O) and 5.0mg/ml hpRS (5.0_hpRS;
does not match any transcript in the mountain pine beetle transcriptome) was included for
comparison. Red arrow indicates the first observation of fungus.

The mean relative log2 transformed relative iap gene expression in a small subset of
tested adult female MPB did not show any gene expression changes at two different time points
after the initial exposure (Figure 4.10). After quality control measures, the 0.5mg/ml hpIAP
(0.5_hpIAP) treated group was down to two biological repetitions and was excluded from the
statistical analysis but plotted for visual observation. A one-way ANOVA test reported that there
was no statistically significant difference in the mean log2 transformed relative iap gene
expression between any of the treatment and control groups at 72h (p = 0.674, F = 0.589, df = 4)
and 120h (p = 0.616, F = 0.678, df = 4) after female adult MPB were initially exposed to hpIAPexpressing yeast. Additionally, none of the groups show significant differences in mean log2
transformed relative iap gene expression between the two time points as reported by a Student’s

124

t-test: water (t = 0.27954, df = 7.1547, p-value = 0.7877), 5.0 mg/ml hpRS (t = 0.22968, df =
4.9837, p-value = 0.8275), 1.0 mg/ml hpIAP (t = 1.3946, df = 5.397, p-value = 0.2178), and 5.0
mg/ml hpIAP (t = 0.14672, df = 7.6486, p-value = 0.8871).

Figure 4.10 Comparison of the mean log2 transformed relative iap expression between the
treatment controls and the negative controls at two different timepoints after initial
exposure to hpRNA. Statistical analysis was performed using a one-way ANOVA test. A)
After 72h, comparison of 0.5mg/ml hpIAP (0.5_hpIAP, n=5), 1.0mg/ml hpIAP
(1.0_hpIAP, n=5), 5.0mg/ml hpIAP (5.0_hpIAP, n = 6) and the negative controls water
(H2O, n=5) and 5.0mg/ml hpRS (5.0-_hpRS, n=5): iap expression is not significantly
different (p = 0.674, F = 0.589, df = 4). B) After 120h, comparison of 0.5mg/ml hpIAP
(0.5_hpIAP, n=2*), 1.0mg/ml hpIAP (1.0_hpIAP, n=4), 5.0mg/ml hpIAP (5.0_hpIAP, n =
5) and the negative controls water (H2O, n=6) and 5.0mg/ml hpRS (5.0-_hpRS, n=6): iap
expression is not significantly different (p = 0.495, F = 0.834, df = 3). * With only two
biological repetitions, this treatment group was excluded from the statistical analysis but
plotted for visual observation.

4.3.6 Phloem home – translocated yeast solutions through the phloem (PHT)
The presence of hpRNA throughout the phloem was confirmed with ddPCR (see
Appendix, Table S5). After ingestion of hpRNA translocated through phloem, adult MPB
survival remained above 50% in all groups for the duration of the assay (Figure 4.11). The
survival of MPB in the 0.1mg/ml hpIAP (0.1_hpIAP) group remained the highest at 83%.
125

Beetles in the control groups showed similar survival to the other two treatment groups,
0.01mg/ml hpIAP (0.01_hpIAP), 0.05mg/ml hpIAP (0.05_hpIAP), with a range of 61-66%
survival.

Figure 4.11 Percent survival of adult MPB fed different amounts of hpIAP- expressing yeast
translocated through lodgepole pine (Pinus contorta) phloem (n=18): 0.01mg/ml hpIAP
(0.01_hpIAP), 0.05mg/ml hpIAP (0.05_hpIAP), and 0.1mg/ml hpIAP (0.1_hpIAP). The
survival of MPB in two negative controls: water (H2O) and 0.1mg/ml hpRS (0.1_hpRS;
does not match any transcript in the mountain pine beetle transcriptome) was included for
comparison.

Gene expression analysis did not show any relative iap gene expression differences
between the groups (Figure 4.12). The Kruskal-Wallis test determined that there was no
statistically significant difference in the mean log2 relative iap gene expression between any of
the treatment and control groups (p = 0.4437, χ2 = 3.731, df = 4).

126

Figure 4.12 Comparison of the mean (n=6) of the log2 transformed relative iap gene
expression between 0.01mg/ml hpIAP (0.01_hpIAP), 0.05mg/ml hpIAP (0.05_hpIAP),
0.1mg/ml hpIAP (0.1_hpIAP) and the control groups: water (H2O) and 0.1mg/ml hpRS
(0.1_hpRS, n = 5) 72h after initial exposure. Statistical analysis using the Kruskal-Wallis
test reported no significant difference between the mean log2 transformed relative iap gene
expression among groups (p = 0.4437, χ2 = 3.731, df = 4).

4.3.7 Phloem home – phloem soaked in yeast solutions (PHS)
Adult MPB survival in the treatment and control groups was more variable in this assay;
however, MPB survival was still 50% or higher for the duration of the assay (Figure 4.13).
Survival was lowest in the 0.05mg/ml hpIAP (0.05_hpIAP) treatment group at 50%, and was
highest in the 0.1mg/ml hpRS (0.1_hpRS) control group at 83%. Beetle survival in the water
group was 66%, similar to the 0.01mg/ml hpIAP (0.01_hpIAP) and 0.1mg/ml hpIAP (0.1_hpIAP)
groups (Figure 4.13).

127

Figure 4.13 Percent survival of adult MPB fed lodgepole pine (Pinus contorta) phloem
soaked in different amounts of hpIAP- expressing yeast (n=18): 0.01mg/ml hpIAP
(0.01_hpIAP), 0.05mg/ml hpIAP (0.05_hpIAP), and 0.1mg/ml hpIAP (0.1_hpIAP). The
survival of MPB in two negative controls: water (H2O) and 0.1mg/ml hpRS (0.1_hpRS;
does not match any transcript in the mountain pine beetle transcriptome) was included for
comparison.

Gene expression analysis reported no statistically significant difference in mean log2
relative iap gene expression among the treatment and control groups (Figure 4.14). The mean
log2 transformed relative iap gene expression is slightly higher in the 0.1mg/ml hpIAP
(0.1_hpIAP) than in the other groups (Figure 4.14). The Kruskal-Wallis test reported no
statistically significant difference in the mean log2 relative iap gene expression between any of
the treatment and control groups (p = 0.0822, χ2 = 8.269, df = 4).

128

Figure 4.14 Comparison of the mean (n=6) of the log2 transformed relative iap gene
expression between 0.01mg/ml hpIAP (0.01_hpIAP), 0.05mg/ml hpIAP (0.05_hpIAP, n =
5), 0.1mg/ml hpIAP (0.1_hpIAP) and the control groups: water (H2O, n = 4) and 0.1mg/ml
hpRS (0.1_hpRS) 72h after initial exposure. Statistical analysis using the Kruskal-Wallis
test reported no significant difference between the mean log2 transformed relative iap gene
expression among groups (p = 0.0822, χ2 = 8.269, df = 4).

129

4.4 Discussion
4.4.1. Phloem entices target liquid ingestion by MPB
Blue-dyed 1% sucrose solution uptake by adult MPB was higher when phloem was used
to entice ingestion. Blue dye was found in 90% of MPB, an increase of 30% compared to the
submergence method. The uptake success in the soaked phloem group shows promise for testing
dsRNA delivery effectiveness using phloem, which can also progress the applicability of RNAi
for MPB.
When soaked phloem was used to test the efficacy of dsIAP and dsHSP on adult MPB,
there was no observable RNAi initiation from the mortality observations (Figure 3.4). Based on
previous RNAi assays (see Chapter 3, section 3.4.2) in our study and from other studies,
mortality in the dsIAP and dsHSP groups should have started around day three (Kyre et al.
2020). In emerald ash borer larvae, hsp silencing was detected 7 days after a foliar spray of
dsHSP was applied to seedlings (Pampolini and Rieske 2023). Though it is likely that the
ingestion of dsRNA-soaked phloem delays the response time before mortality, similar mortality
in the negative controls did not provide evidence for RNAi initiation. Based on similar
observations in previous chapters, mortality of MPB was likely caused by decreased beetle
health (see Chapter 6, section 6.2.1).
4.4.2 Phloem homes show phloem ingestion and high survival
The number of phloem layers and presence of bark had no effect on MPB survival. With
62.5% survival after 13 days in both the two- and three-layered wells, the phloem home showed
higher survival than previously observed in phloem ingestion studies. More MPB were observed
burrowing through the phloem when it was attached to bark in the two-layered wells, an
adaptation of the three-layered set up (Keeling et al. 2013). The presence of burrows and frass

130

indicated ingestion, and due to no impact on MPB survival, the two-layer adaptation was used in
subsequent phloem home assays.
4.4.3 Successful dsRNA translocation through lodgepole pine
In all three segments (bottom, middle, and top) of the cut lodgepole pine rounds, hpRNAexpressing yeast was detected using ddPCR (see Appendix, Table S5). Translocation of dsRNA
has been successful when applied as a root soak to White oak (Quercus alba) and Loblolly pine
(Pinus taeda) seedlings (Bragg and Rieske 2022a, 2022b). Adapting the translocation through
the phloem of lodgepole pine rounds for MPB ingestion was an important proof-of-concept for
potential application of RNAi to manage MPB populations.
4.4.4 No RNAi in dsRNA-expressing yeast translocated or soaked phloem home
4.4.4.1 Unsuccessful RNAi initiation in the phloem home – translocated (PHT) assay
The MPB survival was high in all groups, indicating that the hpIAP-expressing yeast
translocated through the lodgepole pine phloem was not lethal. This was further supported by
higher MPB survival in two of the treatment groups, 0.05mg/ml hpIAP (0.05_hpIAP), and
0.1mg/ml hpIAP (0.1_hpIAP), than in the water (H2O) and 0.1mg/ml hpRS (0.1_hpRS) negative
control groups. Inconsistent chewing by individual adult MPB were observed between and
within treatment groups. This may have affected the amount of dsRNA ingested, impacting the
reliability of this method.
Gene expression analysis confirmed that RNAi was not initiated in adult MPB. There was
no significant difference in the mean relative log2 iap expression among any of the groups.
Visually, the mean relative log2 iap expression in the hpIAP-expressing yeast treatment groups
appears to be slightly lower than in the two control groups, but the already slight difference is
obscured by variation in the data.

131

4.4.4.2 No RNAi response in the Phloem home soaked (PHS) assay
Similar to the PHT assay, MPB survival was above 50% for the duration of the PHS
assay (Figure 4.13). More in line with expectations, MPB survival was highest in one of the
negative controls, 0.1mg/ml hpRS (0.1_hpRS). Different from the PHT assay, lowest MPB
survival was in the 0.05mg/ml hpIAP (0.05_hpIAP), and 0.1mg/ml hpIAP (0.1_hpIAP) groups
(Figure 4.13). However, the water (H2O) control survival was similar to the survival of the
hpIAP-expressing yeast treatment groups. Therefore, it is unlikely that RNAi initiation was
successful, and that the observed mortality was random or due to confounding factors like beetle
condition or age from delayed emergence (see Chapter 3, section 3.4.3 and Chapter 6, section
6.2.1) as this assay was performed later in the summer than the PHT and PHP assays.
Gene expression analysis provided further evidence that an RNAi response was not
achieved. The mean relative log2 iap expression was similar among all groups with no
statistically significant difference. Interestingly, iap expression in the 0.1mg/ml hpIAP
(0.1_hpIAP) group was higher than the others, which was the first time an increased iap
expression after treatment has been observed in our assays. While non-significant reduction of
iap gene expression has been reported in southern pine beetles (Dendroctonus frontalis), neither
a non-significant or significant increase has been reported in southern pine beetles or MPB (Kyre
et al. 2019, 2020; Kyre and Rieske 2022).
4.4.5 No RNAi initiation in dsRNA-expressing yeast solution painted on phloem home
(PHP) assay
With MPB survival above 75% in all groups, ingestion of hpIAP-expressing yeast
painted on phloem does not appear to be lethal to adult MPB. The high MPB survival in the
control groups suggests that this specific association method holds potential for future testing

132

due to the decrease in confounding factors impacting MPB mortality and more control over
delivered dosage to MPB than in PHT assays.
No statistically significant differences were reported in the mean relative log2 iap
expression between the groups, further supporting that RNAi initiation was not achieved. One
such explanation could be the inconsistent chewing progress of individual MPB adults within
each treatment (see section 4.4.4.1). This would impact the mortality and the gene expression
analysis results. Another possible explanation is that the actual dose of hpIAP ingested by the
adult MPB was unknown, due to individual differences in chewing and general ingestion
ambiguity (List et al. 2022).
4.4.5.1 Increased dsRNA-expressing yeast solution concentration and MPB pairing in
second phloem home painted (PHP24) assay indicates RNAi-initiation potential
The MPB mortality in all groups was higher than the previous phloem home assays.
Higher MPB mortality in treatment groups than in the control groups suggests that the hpIAPexpressing yeast was eliciting a lethal response in MPB. However, the effect of RNAi-mediated
mortality is likely confounded by fungus beyond day six. While the increased concentrations of
hpIAP-expressing yeast started to show a lethal response in adult female MPB, more yeast may
be contributing to the increased growth of fungus in the phloem homes, as previous assays were
not affected by fungus. This could be due to the increased amount of yeast providing more
nutrients for MPB-associated fungi to increase (Paine et al. 1997; Klepzigl et al. 2001;
Zimmermann 2007). For future studies, the confounding effect of fungal growth on mortality can
likely be prolonged with the addition of sorbic acid (Rangasamy and Siegfried 2012; Costa and
Reeve 2012; Vélez et al. 2016). The addition of sorbic acid has previously acted as a preservative
and increased the longevity of the diet in Thanasimus dubius, a predator of southern pine beetle

133

(Costa and Reeve 2012). Adding 0.12% sorbic acid into an artificial diet for adult western corn
rootworm (Diabrotica virgifera virgifera) minimizes fungal contamination (Vélez et al. 2016).
This preventative measure was not used in our studies due to the previously fungus-free phloem
home assays and the potential impact of the sorbic acid on beetle fitness. Adding a low
percentage of sorbic acid will not impact the already heat-inactivated yeast, and the hpRNA is
protected within the yeast cell walls (C. Snowdon, personal communication, February 7, 2025).
However, the effect of ingesting sorbic acid on adult MPB would need to be determined and the
sorbic acid dosage adjusted accordingly.
The higher concentrations of hpIAP-expressing yeast did not cause statistically
significant differences in mean relative log2 iap expression between any of the groups or within
groups over time. It is interesting to note that the median relative log2 iap expression in the
1.0mg/ml hpIAP (1.0_hpIAP) group is higher at 72h post-exposure compared to 120h postexposure. There are subtle shifts in the 0.5mg/ml hpIAP (0.5_hpIAP) and 1.0mg/ml hpIAP
(1.0_hpIAP) groups. However, the variation in the data is large, impacting the analysis and
preventing further interpretation of these small shifts in the data. Gene expression analysis at
120h accounted for the possibility of a delayed gene suppression response, and the iap
expression pattern does appear to mirror the mortality observations. Significant gene suppression
was detected in Colorado potato beetles after six days of feeding on dsRNA-expressing bacteria
(Zhu et al. 2011). In emerald ash borer larvae, gene suppression was detected seven days after
dsRNA exposure (Pampolini and Rieske 2023). In a study on Western corn rootworm larvae, no
sign of RNAi was initially present, but activity was detected after 12 days (Baum et al. 2007). In
our study, gene expression was not analyzed after 120h, but would likely have been affected by
the fungal presence.

134

The pairing of a male and female into the one well did appear to increase burrowing, and
therefore phloem ingestion in the females. Naturally, female MPB are the first to burrow into a
host tree, and after mating, continue burrowing to create oviposition galleries (Chiu and
Bohlmann 2022). Simulating the host attack and mating situations in the phloem home increased
ingestion of the phloem, and associated hpIAP-expressing yeast, by the target female adult MPB.
4.4.6. General absence of response in adult MPB to dsRNA-expressing, heat-inactivated
yeast
All three different applications of hpIAP-expressing, heat-inactivated yeast solutions to
lodgepole pine phloem did not lead to an RNAi response when ingested by adult MPB. In
submergence trials, hpRNA-expressing, heat-inactivated yeast solutions were also unsuccessful
at initiating an RNAi response in adult MPB (see Chapter 3, section 3.3.5/ 3.3.6). In the phloem
homes, some MPB ingested only small amounts of treated phloem, which may have skewed the
mortality and gene expression results. The yeast solutions were all gone from the tube in the
submergence assays, though the ingestion percentage in submergence was previously found to be
60%. However, when the yeast solution concentrations were increased, and ingestion enticed, in
the second phloem home painted (PHP24) assay there appeared to be a lethal effect. Thus, one
possible explanation for no RNAi response is the inefficient and inconsistent ingestion of the
dsRNA-expressing yeast in the assays.
Another possible factor impacting the RNAi response is the dose of hpRNA. In the initial
assays, concentrations were between 0.01mg/ml and 0.1mg/ml. This range is similar to in vitro
dsRNA dosages of 0.017μg/μL and 0.067μg/μL that initiated an RNAi response when
translocated through a green bean and ingested by brown marmorated stink bug nymphs (Ghosh
et al. 2018). This value increased when used for injections, sprays, or cuts in Citrus sinensis x

135

Poncirus trifoliata trees to target the Asian citrus psyllid. Concentrations ranged from 0.5mg/ml
for foliar spray, 0.2-1.0mg/ml for soil and root drenches, and 1.7mg/ml for injections (Ghosh et
al. 2018). In each of those methods, the volume used varied, impacting the total dose of dsRNA.
Concentrations of hpRNA-expressing yeast solutions were increased in the latter phloem home –
painted assay (PHP24) to: 0.5mg/ml, 1.0mg/ml, and 5.0mg/ml. With a potential lethal response
but no gene silencing response, this suggests that the dose of dsRNA is an important factor in the
lack of an RNAi response.
In previous chapters, significant gene suppression has been detected in previous assays
but with small foldchanges (See Chapter 3, section 3.3.4 and 3.3.7.1). Our RNA extraction
method uses the entire adult MPB to measure and compare target gene copies. This is the same
as previous studies in adult MPB and congeneric southern pine beetles (Keeling et al. 2013; Kyre
et al. 2019, 2020). However, this is the first study to investigate lethality caused by gene targets
that likely have a localized effect in the structure of MPB intestines, and using RNA from the
whole body may be diluting the RNAi effect in gene expression (C. Snowdon, personal
communication, 2023). In studies testing the efficacy of RNAi targeting ssk and mesh orthologs
in Western corn rootworm larvae, RNA was extracted from whole larvae (Hu et al. 2016, 2019).
While adults are likely larger than larvae, whole adults were also used for gene expression
analysis when reproductive genes were targeted in western corn rootworm (Niu et al. 2017).
Therefore, while extracting RNA from a whole adult MPB may dilute the response of a localized
gene, it is unlikely to be a large effect as adult MPB are small and many studies have used
whole-beetle RNA for localized gene expression quantification. In our study, the gene targets are
expressed in more than one tissue type and expression appears to be important in each of those
tissues, like tsp2a in the Malpighian tubules and midgut epithelia (Jonusaite et al. 2020).

136

Neither submergence nor phloem associations delivering hpRNA-expressing yeast to
MPB caused an RNAi response. The second phloem home painted (PHP24) assay showed that
hpIAP-expressing yeast is potentially lethal to adult female MPB, but a fungus outbreak
impacted the assay and obscured any further inferences. While it is a possibility that adult MPB
were not breaking down the heat inactivated yeast vectoring the hpRNA in the stomach, the
mortality trend in the PHP24 assay suggests this was unlikely. Additionally, the lack of a
response by MPB when submerged in hpRNA-expressing yeast coincided with a lack of
response when submerged in in vitro synthesized dsRNA, and as such the response is likely due
to beetle-related factors rather than dsRNA factors, like MPB emergence dates or beetle health
(see Chapter 3, section 3.3.5/3.3.6). Yeast has been successfully used to produce and deliver
dsRNA to D. suzukii larvae and initiate decreased fitness via RNAi (Murphy et al. 2016). Yeast
is a part of the natural diet of D. suzukii, and therefore can be ingested as expected. Fungal
associates, including yeasts, of MPB are a nutrient source for larvae and teneral adults (Paine et
al. 1997; Chiu and Bohlmann 2022). In MPB, yeast was added to the phloem homes when
rearing teneral adults into emerged adults, supporting that yeast is ingested by MPB (Keeling et
al. 2013). Therefore, MPB are expected to successfully ingest and breakdown the heatinactivated, hpRNA-expressing yeast, and the absence of responses are likely connected to
decreased beetle condition and low dosages.

137

4.5 Conclusion
This study was the first to investigate the effectiveness of hpRNA-expressing, heatinactivated yeast associated with lodgepole pine phloem at initiating an RNAi response when
ingested by adult MPB. The iap gene was targeted in all assays for a proof-of-concept gene due
to previous gene suppression success in adult MPB. Two of the three yeast-phloem association
methods, phloem soaked in hpRNA-expressing yeast solutions and hpRNA-expressing yeast
solutions translocated through phloem, did not elicit an RNAi response. The other association,
hpRNA-expressing yeast solutions painted on phloem, showed the beginnings of a lethal
response in adult female MPB with increased yeast concentrations and adapted methods. In all
assays, however, there was no significant differences in mean iap expression among groups.
Producing hpRNA in heat-inactivated yeast and delivering it via associations with phloem shows
promise for future RNAi assays with MPB, with increased concentrations and method
refinement, as survival was often high in the controls.

138

Chapter 5 Preliminary transcriptomic analysis comparing negative controls to one another
within each of the three dsRNA/hpRNA delivery methods to investigate the genomic
response of adult MPB.
5.1 Introduction
Applying RNA interference (RNAi) as a pest management tool for insects is gaining
momentum (Christiaens et al. 2020; Lü et al. 2022). Variation in the effectiveness of RNAi are
attributed to target insect species and life stage, gene targets, and the dsRNA delivery method
(Poreddy et al. 2017; Cooper et al. 2019; Leelesh and Rieske 2020). Robust RNAi initiation has
been reported in many Coleopteran insects, including Dendroctonus spp. (Cooper et al. 2019;
Christiaens et al. 2020). As an important pest in North American forests, the mountain pine
beetle (Dendroctonus ponderosae, MPB) has shown responsiveness to RNAi in laboratory-based
trials (Keeling et al. 2013; Kyre et al. 2020; Kyre and Rieske 2022). A congeneric species, the
southern pine beetle (Dendroctonus frontalis, SPB) has also exhibited RNAi-mediated gene
suppression and associated mortality (Kyre et al. 2019; Kyre and Rieske 2022). The SPB
response to gene targets varies among populations, providing another variable to consider for
RNAi application (Kyre et al. 2024). As RNAi advances toward bark beetle management,
attention to the genetic diversity among populations of the target insect is needed.
Transcriptome analyses have been performed on MPB for the identification of
overwintering genes and increased understanding of detoxification gene families (Robert et al.
2013, 2016). An investigation into overwintering larvae and a study comparing starved and fed
adult MPB used a type of transcriptome analysis called RNAseq (Robert et al. 2013, 2016). The
RNAseq method can identify differential gene expression using the full length of transcripts,
making it a useful tool for comparing transcript levels between different experimental or natural
139

conditions (Lohman et al. 2016). Using RNAseq, detected expression patterns of gene families
provided further understanding of their roles in host colonization by adult MPB (Robert et al.
2013). This method also allowed for identification of critical genes for overwintering MPB
larvae (Robert et al. 2016). While the general RNASeq methods are transferable to relative
differential gene expression analyses, a more focused method can also be used.
The RNAseq output is redundant and costly for relative gene expression, where
expression is normalized to a reference gene (Lohman et al. 2016). An alternative to the full
RNAseq analysis is TagSeq. TagSeq analysis uses the 3’ end of the RNA molecules to create a
single initial library molecule per transcript (DNA Technologies Core). TagSeq generates lowcost and low-noise data from fewer sequencing reads, making it ideal for gene expression
profiling when compared to RNAseq (Lohman et al. 2016).
Further analyses can be performed on TagSeq results to provide functional
interpretations. An analysis becoming more frequently used to represent gene functions is gene
ontology (Andersson et al. 2013; Wei et al. 2017). The gene ontology analysis was used to
identify genes with olfactory function in MPB and the European spruce bark beetle (Ips
typographus) (Andersson et al. 2013). These previous transcriptome analyses on MPB were used
to identify changes in transcript levels and identify protein functions.
Gene ontology (GO) analysis is commonly incorporated with differential gene expression
investigations. Using a protein identification and associated GO terms, the analysis results
provide the functional annotation (Wei et al. 2017; Tehrani et al. 2024). This analysis also sorts
the GO terms associated with a list of proteins or genes into one of three categories: cellular
component (CC), biological process (BP), and molecular function (MF) (Wei et al. 2017). One
regularly used analysis method is the gene ontology enrichment analysis (Xin et al. 2022). The

140

enrichment of a gene ontology term refers to the measured frequency of the gene ontology term
compared to the expected frequency relative to the genome (Wei et al. 2017). The functional
annotation, categorizations, and the enrichment measurement of the GO terms can assist with
inferences about what pathways are involved in experimental conditions or observed phenotypes.
Previous RNAi initiation success in adult MPB demonstrates the presence of RNAi
machinery in MPB (Keeling et al. 2013; Kyre et al. 2020; Kyre and Rieske 2022). This
assumption is supported by successful RNAi in assays within this study (see Chapter 3, section
3.3.4 and 3.3.7.1). An initial search of an MPB transcriptome from an overwintering population
(Thompson et al. 2020; B. Murray, unpublished results) confirmed the presence of some
transcripts known to be involved in the RNAi pathway: Argonaute-2, endoribonuclease dicerlike, and SID1 transmembrane family member 1-like (Yoon et al. 2016; Haller et al. 2019). The
identification of RNAi machinery transcripts has been provided alongside RNAi mediated gene
suppression in the six-spined ips (Ips calligraphus) (Wallace and Rieske 2023), but an associated
transcriptome analysis with RNAi initiation in MPB has not been reported.
Variable results from the assays conducted throughout our study remain unexplained
from the experimental results. In negative control groups the MPB mortality has often been
higher than expected, suggesting that the methods are inducing adult MPB mortality. The
ingestion of dsRNA can alter the physiology of insects, and could be causing unexpected, offtarget responses (Lü et al. 2022). Additionally, the variation in RNAi initiation success may be
linked to genetic differences in different MPB populations, as was observed in SPB (Kyre et al.
2024).
In this chapter, a bioinformatic study was performed to investigate the possible factors
impacting assay results. The first objective of the TagSeq analysis was to evaluate the genomic

141

response of adult MPB to the dsRNA and hpRNA delivery methods by comparing adult MPB
treated with negative controls to non-treated adult MPB. The second objective of the TagSeq
analysis was to confirm the presence of critical RNAi components in the MPB population used
for this study. Lastly, a positive control group of MPB with suppressed iap expression was
included to compare to MPB in the negative control group of the same delivery method for an
increased understanding of the genomic responses.

142

5.2 Methods
5.2.1 Sample Preparation
Total RNA samples from the negative controls in all three different delivery methods,
microinjection, submergence, and phloem homes, were quality checked to meet the requirements
for 3’Tag-Seq analysis (https://dnatech.genomecenter.ucdavis.edu/sample-requirements/). The
three samples, comprised of mixed sex or unsexed MPB, within each treatment with the best
quality were selected for submission. Most of the quality control was performed before gene
expression analysis using digital droplet PCR (ddPCR), as previously described (see Chapter 1,
section 1.2.8.1). Briefly, samples were quantified with the Qubit 4 Fluorometer Broad Range
RNA assay (Thermo Fisher Scientific Inc., 2015) and the sample integrity was determined using
the Agilent RNA 6000 Nano Kit on the Agilent Bioanalyzer 2100 (Agilent, Santa Clara, CA).
Though the RIN assigned to the samples is not reliable for insect RNA as there is an endogenous
break in the 28S rRNA, the RNA quality was visually assessed using the electropherogram for
each sample (Fabrick and Hull 2017). Lastly, the ND-1000 Nanodrop (v.3.8.1, NanoDrop
Technologies 2024) was used to measure the 260/280 and 260/230 ratios. Selected samples were
diluted to 60ng/μl at a volume of 25μl and submitted for analysis at the DNA Technologies and
Expression Analysis Cores at the UC Davis Genome Center.
5.2.2. 3’Tag-Seq Library Preparation and Sequencing
The library preparation and sequencing were carried out at the DNA Technologies and
Expression Analysis Cores at the UC Davis Genome Center, supported by NIH Shared
Instrumentation Grant 1S10OD010786-01. Barcoded 3'Tag-Seq libraries were prepared using the
QuantSeq FWD kit (Lexogen, Vienna, Austria) for multiplexed sequencing according to the
recommendations of the manufacturer. The fragment size distribution of the libraries was

143

verified via micro-capillary gel electrophoresis on a Bioanalyzer 2100 (Agilent, Santa Clara,
CA). The libraries were quantified by fluorometry on a Qubit instrument (LifeTechnologies,
Carlsbad, CA), and pooled in equimolar ratios. Twenty-four libraries were sequenced on one
lane of an AVITI sequencer (Element Biosciences, San Diego, CA) with single-end 100 bp
reads. The sequencing generated more than 4 million reads per library.
5.2.3 Differential Gene Expression (DGE) Analysis
The data analysis on 3’TagSeq sequencing was performed by the Bioinformatics Core at
UC Davis Genome Center. Single-end 151bp AVITI reads were subjected to quality control.
Adapter sequences and low-quality bases (q < 30) were removed using trim_galore/v0.6.7
(Krueger et al. 2021). Reads that were less than 30bp in length were discarded. Reads that passed
quality control were aligned to the mountain pine beetle genome (GCF_020466585.1) using
STAR/v2.7.11b (Dobin et al. 2013). Annotation of the MPB genome (GCF_020466585.1)
includes 12,777 protein-coding genes and 23,095 mRNAs, of which 22,374 are fully supported
(NCBI 2022). Raw counts generated from STAR aligner was normalized using TMM method in
edgeR (Robinson et al. 2010). Differential expression analysis was carried out using limma and
voom (Law et al. 2014; Ritchie et al. 2015), that adjusted for a hidden variable identified that
was most likely sex-linked based on the sex information available for a subset of samples. Genes
were filtered to require a two counts-per-million in at least two samples. The p-value was
adjusted using the Benjamini-Hochberg procedure to control the false discovery rate.
5.2.4 Annotation and Gene Ontology of DGE results
From the list of significantly up-regulated genes (adjusted p-value < 0.05) from each
comparison (Table 5.1), a 1.5 foldchange cut off was applied. For genes with a foldchange
greater than 1.5, a UniProt ID and respective gene ontology (GO) terms were obtained where

144

possible (UniProt 2024). This process was repeated with the down-regulated genes, though only
those with a foldchange below -1.5 were included. A two-fold up- or down-regulation is
commonly used as a cut off, but by using a cut off of 1.5, the annotated genes are likely to have
consequences in function of the beetles (Silva and Vogel 2016). The GO terms were uploaded
for GO Enrichment analysis to the NaviGO website (Wei et al. 2017;
https://kiharalab.org/navigo/views/goenrich.php), where the proteins and associated GO terms
are arranged by their calculated counts compared to the expected counts based on the genome.
Information on the biological processes, molecular function, and/or cellular function that the upor down-regulated genes were involved in will also be provided by NaviGO (Wei et al. 2017).
For GO terms with no domain assigned were searched using QuickGo (EMBL-EBI,
https://www.ebi.ac.uk/QuickGO/term). Visualization of the gene ontology results was performed
using “ggplot2” (Wickham 2016) in R Statistical Software (v4.3.1; R Core Team 2023).
Table 5.1 Treatment comparisons within each dsRNA/hpRNA delivery method used for differential gene
expression analysis to investigate the response to RNAi and the delivery methods in adult mountain pine
beetle (Dendroctonus ponderosae).

dsRNA/hpRNA delivery method
Microinjection

Submergence

Phloem-fed

Comparison
A16M_D vs.C22 (dsRS vs not-injected)
A16M_W vs.C22 (water vs not-injected)
A16M_D vs. A16M_W (dsRS vs water)
J22S_D vs.C22 (dsRS vs not-submerged)
J22S_I vs.C22 (dsIAP vs not-submerged)
J22S_D vs. J22S_I (dsRS vs dsIAP)
PHPF_D vs.C23 (hpRS vs not-fed)
PHPF_W vs.C23 (water vs not-fed)
PHPF_D vs. PHPF_W (hpRS vs water)

145

5.3 Results
5.3.1 Sample Selection
Quality check results of the three samples with the best quality measurements from each
negative control group, dsIAP treatment group, and no-treatment group from each year that met
requirements are listed (see Appendix, Table S7). Only one sample did not meet one of the
quality requirements due to a low 260/230 ratio, but with a good quality electropherogram from
the Agilent measurements, it was included in the analysis (see Appendix, Table S7, sample
A16M_D5). Quality of the samples upon receival by the DNA Technologies and Expression
Analysis Cores at the UC Davis Genome Center showed slightly decreased values but were still
of a satisfactory level for downstream analysis.
5.3.2 Differential Gene Expression analysis results
After quality control, reads from each sample were uniquely mapped with rates ranging
from 46-65% (see Appendix, Table S8). The other reads were either non-uniquely mapped
(multi-mapped/mapped to too many loci) or unmapped (too short/other). The first output from
the differential gene expression showed a large gap along the first dimension in a multidimensional scaling (MDS) plot (Figure 5.1A). After further investigation using the recorded sex
for some of the samples along with patterns from previous studies, it was determined that the
difference was likely a sex-linked effect. Once added to the formula as a fixed unknown variable,
the resulting MDS plot showed clusters more aligned to the treatments (Figure 5.1B).
Additionally, the number of genes that were significantly different in the comparisons decreased.

146

A)

B)

Figure 5.1 Multidimensional scaling (MDS) plots performed by the
Bioinformatics Core at UC Davis Genome Center. (A) The initial MDS plot
shows a large separation along the first dimension, which was determined
to be a sex effect. (B) This sex effect was added as an unknown variable to
the formula. Females are represented by circles and males represented by
triangles. Microinjection samples are represented by A16M prefix,
submergence samples by the J22S prefix, and phloem-fed samples by PHPF
prefix. Controls are listed with ‘C’ followed by the last two digits of
emergence year. Lastly, dsRS-treated samples are represented by the suffix
‘D’,water-treated samples by the suffix ‘W’, and dsIAP-treated samples
with the suffix ‘I’.

147

5.3.2.1 Expression of RNAi machinery did not differ significantly between comparisons
Significant differential gene expression results did not include any RNAi machinery.
Transcripts of the RNAi machinery, like protein argonaute-2, endoribonuclease dicer, and SID1
transmembrane family member were found in the unfiltered (did not meet the 1.5/-1.5foldchange
cutoff) data in each microinjection, submergence and phloem home comparison, showing small,
insignificant differences (Table 5.2). One protein-coding gene, SID-2, which has been identified
to be involved in dsRNA uptake for environmental RNAi was not found in these comparisons
because it was also not identified in the MPB genome (Keeling et al. 2021).
Table 5.2 Presence or absence of genes coding for RNAi machinery components in the differential gene
expression analysis comparing the negative controls in different delivery methods.

Gene
LOC109543529
LOC109533193
LOC109546978
LOC109540929
LOC109537029
LOC109533632
LOC109538703
LOC109537913

Annotation
protein argonaute - 2
protein argonaute - 2
endoribonuclease Dicer
endoribonuclease Dcr -1
SID1 transmembrane family
member
SID1 transmembrane family
member 1
SID-2 systemic RNA
interference defective protein
2
V-type proton ATPase 16
kDa proteolipid subunit c
double-stranded RNAbinding
protein Staufen homolog

Present or absent
present
present
present
present
present
present
absent
present
present

5.3.2.2 Microinjection comparisons
Comparisons of the transcripts in adult MPB microinjected with water (A16M_W) or
dsRS (A16M_D) to those not injected (C22) yielded no significant differences in gene
expression. Only one significant gene (padj < 0.05), venom allergen 5, was significantly down
regulated in MPB microinjected with dsRS compared to when microinjected with water.
148

5.3.2.3 Submergence comparisons
Differential gene expression analysis comparing adult MPB submerged in dsRS
(J22S_D) or submerged in dsIAP (J22S_I) to beetles not submerged at all (C22) yielded 305 and
265 genes, respectively, with significantly different expression (padj < 0.05). After applying a
log foldchange limit of >1.5 for upregulated and <-1.5 for downregulated genes, 182 and 117
genes were differentially expressed between J22S_D and J22S_I compared to C22, respectively.
In J22S_I compared to C22, stress response genes like heat shock proteins (hsp) were upregulated. Gene expression in J22S_I compared to J22S_D indicated no significantly
differentially expressed genes.
5.3.2.4 Phloem-fed comparisons
Differential gene expression analysis comparing MPB fed phloem with hpRS (PHPF_D)
or water (PHPF_W) painted on to phloem to MPB not fed anything (C23) resulted in 1003 and
567 significant genes (padj < 0.05), respectively. After the log foldchange cut offs, there were
344 and 231 significantly different genes for PHPF_D and PHPF_W, respectively. There were
249 genes significantly differentially expressed between PHPF_D and PHPF_W, and 82 after log
foldchange cut-offs.
5.3.3. Gene ontology
5.3.3.1 Microinjection control comparisons
No significant gene ontology enrichment terms were obtained for any of the following
microinjection control comparisons: injected with water (A16M_W) to no injection (C22),
injected with dsRS (A16M_D) to no injection (C22), and A16M_D to A16M_W.

149

5.3.3.2 Submergence comparisons
The gene ontology enrichment analysis for J22S_D compared to C22 yielded 98 GO
terms associated with the up-regulated genes and 68 GO terms associated with the downregulated genes. Within the list, 40 of the up-regulated and 23 of the down-regulated GO terms
were enriched (p < 0.05, see Appendix, Tables S11 and S12). The top 10 enriched (i.e. 10 GO
terms with the smallest p value) GO terms from each category were selected for visualization
(Figure 5.2).
Three GO term annotations in the cellular component domain from the up-regulated
genes were the mitochondrion, chitin-based extracellular matrix, and intraciliary transport
particle B. The top three GO term annotations from the biological process domain were:
isoprenoid biosynthetic process, tricarboxylic acid, and glyoxylate cycle. The top three GO term
annotations from the molecular function domain are: acyl-CoA dehydrogenase activity,
diphosphomevalonate decarboxylase activity, and structural constituent of chitin-based larval
cuticle.
The GO term annotation in the cellular component domain from the down-regulated
genes is the myosin II complex. The top four GO term annotations from the biological process
domain are: cell wall modification, pectin catabolic process, fatty acid elongation
(monounsaturated fatty acid), and fatty acid elongation (polyunsaturated fatty acid). The top four
GO term annotations from the molecular function domain are: chitin binding, odorant binding,
rhamnogalacturonan endolyase activity and L-galactose dehydrogenase activity.

150

Figure 5.2 Enriched (p < 0.05) GO terms from the comparison between adult MPB submerged in dsRS
and adult MPB not submerged in anything. Categories are: cellular component (CC), biological process
(BP), and molecular function (MF). Significance level is indicated by the horizontal red line, any bar
above the line indicates p < 0.05. A) Enriched GO terms associated with up-regulated genes. B)
Enriched GO terms associated with down-regulated genes.

151

The gene ontology enrichment analysis for J22S_I compared to C22 yielded 70 GO terms
associated with the down-regulated genes and 78 GO terms associated with the up-regulated
genes. Within the list, 24 of the up-regulated and 19 of the down-regulated GO terms were
enriched (p < 0.05, see Appendix, Tables S9 and S10). The top 10 enriched GO terms (i.e. the 10
GO terms with the smallest p value) from each category were selected for visualization (Figure
5.3).
Three GO term annotations in the cellular component domain from the up-regulated
genes were the chitin-based extracellular matrix, mitochondrion, and the A band. The top three
GO term annotations from the biological process domain were: L-alanine catabolic process,
macromolecule depalmitoylation, and nucleoside monophosphate phosphorylation. The top three
GO term annotations from the molecular function domain were: scavenger receptor activity,
ATP-dependent protein folding chaperone, and beta-fructofuranosidase activity.
The GO term annotation in the cellular component domain from the down-regulated
genes was the mediator complex. The top three GO term annotations from the biological process
domain were: phagosome-lysosome fusion, lipid catabolic process, and zinc II ion
transmembrane transport. The top eight GO term annotations were: MAP kinase serine/threonine
phosphatase activity, histone H2AXS140 phosphatase activity, five different RNA polymerase II
CTD heptapeptide phosphatase repeats, and L-galactose dehydrogenase activity.

152

Figure 5.3 Enriched (p < 0.05) GO terms from the comparison between adult MPB submerged
in dsIAP and adult MPB not submerged in anything. Categories are: cellular component (CC),
biological process (BP), and molecular function (MF). Significance level is indicated by the
horizontal red line, any bar above the line indicates p < 0.05. A) Enriched GO terms associated
with up-regulated genes. B) Enriched GO terms associated with down-regulated genes.

153

Among both comparisons, there were some GO terms that are up-regulated and downregulated regardless of what dsRNA (J22S_D or J22S_I) when compared to C22. Genes
associated with mitochondria and chitin-based extracellular matrix were upregulated in both
treatments. The L-alanine catabolic process, protein refolding, and tricarboxylic acid cycle were
enriched biological processes in both treatments. Genes involved in the acyl-CoA dehydrogenase
activity, aconitate hydrolase activity, scavenger receptor activity, structural constituent of chitinbased larval cuticle, structural constituent of cuticle, aconitate hydratase activity, carbonate
dehydratase activity, lyase activity, and glutathione transferase activity molecular functions were
also significantly enriched in both dsRNA conditions.
The GO terms associated with the down-regulated genes did not have any overlap
between J22S_D compared to C22 and J22S_I compared to C22 in the cellular component or
biological processes categories. The molecular functions of L-galactose dehydrogenase activity,
beta-glucosidase activity, and sugar transmembrane transporter activity were significantly
enriched in both dsRNA treatments.
In the comparison between J22S_D and C22, genes involved in oxygen binding and
transport as well as odorant binding and smell were down-regulated. These genes were not
significantly down-regulated in the dsIAP-submerged MPB when compared to MPB not
submerged.
5.3.3.3 Phloem-fed control comparisons
The gene ontology enrichment analysis for PHPF_D compared to C23 yielded 53 GO
terms associated with the down-regulated genes and 104 GO terms associated with the upregulated genes. Within the list, 41 of the up-regulated and 22 of the down-regulated GO terms
were enriched (p < 0.05, see Appendix, Tables S15 and S16). The top 10 enriched GO terms (i.e.

154

the 10 GO terms with the smallest p value) from each category were selected for visualization
(Figure 5.4).
The enriched GO term annotation in the cellular component domain from the upregulated genes was chitin-based extracellular matrix. The top three GO term annotations from
the biological process domain were: cellulose catabolic process, fatty acid biosynthetic process,
and unsaturated fatty acid biosynthetic process. The top three GO term annotations from the
molecular function domain were: cellulase activity, stearoyl-CoA 9-desaturase activity, and
transmembrane monodehydroascorbate reductase activity.
The three enriched GO term annotations in the cellular component domain from the
down-regulated genes were the chitin-based extracellular matrix, origin recognition complex,
and nuclear origin of replication recognition complex. The top three GO term annotations from
the biological process domain were: dUMP biosynthetic process, dUTP catabolic process, and
regulation of synaptic transmission (cholinergic). The top three GO term annotations from the
molecular function domain were: structural constituent of chitin-based larval cuticle, structural
constituent of cuticle, and dUTP diphosphatase activity.

155

Figure 5.4 Enriched (p < 0.05) GO terms from comparison between adult MPB fed dsRS-treated phloem
(PHPF_D) and adult MPB not fed (C23). Categories are: cellular component (CC), biological process
(BP), and molecular function (MF). Significance level is indicated by the horizontal red line, any bar
above the line indicates p < 0.05. A) Enriched GO terms associated with up-regulated genes. B)
Enriched GO terms associated with down-regulated genes.

The gene ontology enrichment analysis for PHPF_W compared to C23 yielded 83 GO
terms associated with the down-regulated genes and 92 GO terms associated with the up-

156

regulated genes. Within the list, 43 of the up-regulated and 32 of the down-regulated GO terms
were enriched (p < 0.05, see Appendix, Tables S13 and S14). The top 10 enriched GO terms (i.e.
the 10 GO terms with the smallest p value) from each category were selected for visualization
(Figure 5.5).
The enriched GO term annotation in the cellular component domain from the upregulated genes was the peroxisome. The top three GO term annotations from the biological
process domain were: cellulose catabolic process, pectin catabolic process, and carbohydrate
metabolic process. The top three GO term annotations from the molecular function domain were:
cellulase activity, hydrolase activity acting on glycosyl bonds, and hydrolase activity
hydrolyzing O-glycosyl compounds.
The enriched GO term annotation in the cellular component domain from the downregulated genes was the mitochondrion. The top three GO term annotations from the biological
process domain were: fatty acid beta-oxidation, sucrose biosynthetic process, and isopentenyl
diphosphate biosynthetic process (mevalonate pathway). The top three GO term annotations are:
citrate (Si)-synthase activity, diphosphomevalonate decarboxylase activity, and acetate CoAtransferase activity.

157

Figure 5.5 Enriched (p < 0.05) GO terms from comparison between adult MPB fed water-treated
phloem (PHPF_W) and adult MPB not fed (C23). Categories are: cellular component (CC), biological
process (BP), and molecular function (MF). Significance level is indicated by the horizontal red line,
any bar above the line indicates p < 0.05. A) Enriched GO terms associated with up-regulated genes. B)
Enriched GO terms associated with down-regulated genes.

The gene ontology enrichment analysis for PHPF_D compared to PHPF_W yielded 29
GO terms associated with the down-regulated genes and 21 GO terms associated with the up-

158

regulated genes. Within the list, seven of the up-regulated and 15 of the down-regulated GO
terms were enriched (p < 0.05, see Appendix, Tables S17 and S18). The top 10 enriched GO
terms (i.e. the 10 GO terms with the smallest p value) from each category were selected for
visualization (Figure 5.6).
The one enriched GO term annotation in the cellular component domain from the upregulated gene was the chitin-based extracellular matrix. The only enriched GO term annotation
from the biological process domain was tissue regeneration The top three GO term annotations
from the molecular function domain were: structural constituent of chitin-based larval cuticle,
structural constituent of cuticle, and glucuronosyltransferase activity.
There were no enriched GO term annotations in the cellular component domain from the
down-regulated genes. The top three GO term annotations from the biological process domain
were: cellulose catabolic process, dUMP biosynthetic process, and the dUTP catabolic process.
The top three GO term annotations were: cellulase activity, dUTP diphosphatase activity, and
phenylalanine 4-monooxygenase activity.

159

Figure 5.6 Enriched (p < 0.05) GO terms from comparison between adult MPB fed dsRS-treated
phloem (PHPF_D) and adult MPB fed water-treated phloem (PHPF_W). Categories are: cellular
component (CC), biological process (BP), and molecular function (MF). Significance level is indicated
by the horizontal red line, any bar above the line indicates p < 0.05. There are no enriched cellular
components associated with the up- or down-regulated genes. A) Enriched GO terms associated with
up-regulated genes. B) Enriched GO terms associated with down-regulated genes.

Among the three different phloem-fed comparisons, there were some GO terms that were
up-regulated and down-regulated when PHPF_D or PHPF_W were compared to C23. The GO
160

terms associated with the up-regulated genes in PHPF_D compared to C23 and PHPF_W
compared to C23 both included the chitin-based extracellular matrix in the cellular component
category. There were five enriched biological processes that were associated with the upregulated gene lists: cellulose catabolic process, fatty acid biosynthetic process, L-galactose
dehydrogenase activity, AMP catabolic process, very long-chain fatty acid biosynthetic process.
There were 10 enriched terms that overlapped in the two up-regulated lists for molecular
function (see Appendix, Tables S13 and S15).
Some molecular function terms overlap between the PHPF_D-versus-PHPF_W upregulated gene list, the PHPF_D-versus-C23, and PHPF_W-versus-C23 lists. The structural
constituent of chitin-based larval cuticle and structural constituent of cuticle are enriched in the
PHPF_D-versus-PHPF_W and PHPF_D-versus-C23 comparisons. One GO term, the
monooxygenase activity molecular function was enriched in all three comparison up-regulated
gene lists.
The GO terms associated with the down-regulated genes in the PHPF_D-versus-C23 list
and the PHPF_W-versus-C23 list did not have any overlap in the cellular component category.
The regulation of synaptic transmission (cholinergic), sleep, protein maturation by iron-sulfur
cluster transfer, iron-sulfur cluster assembly, fatty-acyl-CoA biosynthetic process, and positive
regulation of Rho protein signal transduction were enriched biological processes. Enriched
molecular functions included long-chain fatty acid-CoA ligase activity and 2 iron, 2 sulfur
cluster binding. The PHPF_D-versus-PHPF_W list of GO terms associated with the downregulated genes did not have any shared terms with the PHPF_W-versus-C23 comparison list.
There were shared GO terms between the PHPF_D-versus-PHPF_W list and the PHPF_Dversus-C23 list. Three biological processes were downregulated in both lists, the: dUTP

161

diphosphatase activity, dUMP biosynthetic process, and dUTP catabolic process. Two molecular
functions, 5'-flap endonuclease activity and four-way junction DNA binding were shared among
the two down-regulated lists.
Two molecular functions, the structural constituent of chitin-based larval cuticle and
structural constituent of cuticle were both up- and down-regulated in PHPF_D. Up-regulation of
these functions occurs when compared to PHPF_W and C23. These functions were
simultaneously down-regulated in the PHPF_D compared to C23. The chitin-based extracellular
matrix in the cellular component category is also up- and down-regulated in PHPF_D compared
to C23.

162

5.4 Discussion
5.4.1 Presence of genes coding for critical RNAi machinery was confirmed in all MPB
Genes that code for proteins involved in the RNAi machinery were previously identified
in Colorado potato beetles (Leptinotarsa decemlineata) and the six-spined ips (Ips calligraphus)
(Yoon et al. 2016; Wallace and Rieske 2023). These include argonaute – 1 and 2, aubergine, vATPase 16 kDa subunit (vha16), and dicer. An additional component, the SID1 transmembrane
protein, is known to be involved in dsRNA uptake and systemic spread (Haller et al. 2019). The
staufen gene is involved in siRNA formation from dsRNA and has only been identified in
Coleopteran insects (Yoon et al. 2018; Wallace and Rieske 2023). In nematodes, like
Caenorhabditis elegans, SID-2 is required for dsRNA uptake from the environment (Winston et
al. 2007; McEwan et al. 2012). Orthologs of this gene have been identified in birds and
mammals, listed as SID1 transmembrane family member 2, but not in Coleopteran insects
(NCBI, 2025). However, dsRNA uptake via the SID-1 transmembrane channel-mediated
pathway was supported in Colorado potato beetles, and along with successful environmental
RNAi in other studies, provides support for the presence of a SID-2 like protein (Zhu et al. 2011;
Cappelle et al. 2016; Rodrigues et al. 2021) Five of the eight genes were found in the mountain
pine beetle genome, with no results for the aubergine, argonaute-1, and SID-2 genes (Keeling et
al. 2021). Two loci were found for the protein argonaute-2, SID1 transmembrane family member
1, and dicer-coding genes (Table 5.2). All eight loci belonging to previously identified genes
were present, but not significantly up-regulated or down-regulated in this TagSeq study,
supporting the assumption that MPB contain the necessary components for an RNAi response
(Yoon et al. 2016; Wallace and Rieske 2023).

163

The absence of SID-2 might explain some of the variability in RNAi success within this
study. In SID-2 knockdown C. elegans, resistance to ingestion or absorption of dsRNA was
observed (McEwan et al. 2012). After injection, these knockdown worms were able to show a
systemic response due to SID-1 function. Therefore, dsRNA uptake from the lumen requires
SID-2 and SID-1 facilitates the dsRNA entry into cells (McEwan et al. 2012). In most insects,
SID-2 homologs are not present (Capelle et al. 2016; Cooper et al. 2019). Orthologs of SID-2
were present in mammals, like humans, and annotated as SID-1 transmembrane family member
2. A BLASTn search of the second SID1 transmembrane family member 1 sequence in MPB
(see section 5.3.2.1, Table 5.2, LOC109533632) was a 92% match to a SID1 transmembrane
family member 2- like gene in the Southeast Asian Ambrosia Beetle (Euwallacea similis)
(BLASTn, NCBI 2025). Due to SID-2 orthologs in mammals and birds annotated as SID1
transmembrane family member 2- like, this may indicate that the second SID1 transmembrane
family member 1 gene in MPB has a role similar to SID-2 for environmental uptake. In the
absence of SID-2, nanoparticles can increase dsRNA uptake, and have improved RNAi
efficiency in Anthonomus grandis (Christiaens et al. 2020). Further investigation is required to
determine whether a SID-1 gene functions like a SID-2 gene, or if an alternative dsRNA delivery
method using nanoparticles or paperclip RNA should be used.
5.4.2 No significant differential gene expression when adult MPB injected with compared to
no-injection controls
High mortality was observed in all injected adult MPB, even when injected with the
water and dsRS negative controls, compared to the low mortality in non-injected control group
(See Chapter 2, section 2.3.2-2.3.4). There were no significant differentially expressed genes
when the TagSeq analysis was used to compare transcript abundance in C22 compared to

164

A16M_W or A16M_D. These results are unexpected as mortality is typically associated with
gene expression changes (Leelesh and Rieske 2020; Kyre et al. 2020). One likely explanation is
that the beetles tested were alive, and therefore not lethally wounded from the injection
compared to the deceased beetles. One gene, venom allergen 5, was found to be significantly
down-regulated between A16M_D and A16M_W. Differential gene expression of a single gene
does not support the genomic response to microinjection that was predicted based on the MPB
mortality observations.
5.4.3 Differentially expressed genes in the comparisons show similar response to dsRS and
dsIAP.
Many genes were significantly up-regulated or down-regulated in J22S_I compared to
C22. The targeted gene, iap, was not among this list. A search into the non-significant results
showed a very small down-regulation of the iap gene. This was unexpected due to the ddPCR
quantifying a statistically significant decrease in iap expression in J22S_I. The absence of a
lethal response in the treated beetles might be explained by the small decrease in iap expression.
However, the up-regulation of stress response genes, like hsp, with similar roles to iap may
indicate that other genes were compensating for the down-regulation of iap. Additionally, the
J22S_I and C22 beetles emerged at different times, and though they were subject to the same
storage conditions, the emergence times may be reflective of physiological differences (see
Chapter 6, section 6.2.1). Therefore, it is possible that the iap expression comparison was not as
exact as comparing J22S_D to J22S_I. No significant differentially expressed genes were
identified between J22S_D to J22S_I, which were from the same bioassay. These results do not
support the ddPCR results and suggest the samples size for this TagSeq analysis was too small

165

and a larger sample size, as are typically used in this cost-effective analysis, is needed (Lohman
et al. 2016).
5.4.4 Differential gene expression indicates a genomic response in MPB when ingesting
phloem.
Adult MPB fed phloem associated with hpRS-expressing yeast (PHPF_D) or water
(PHPF_W) had the largest number of significant genes when compared to beetles that were not
fed or treated with any hpRNA (C23). This was expected due to the previously identified upregulation of metabolic genes, especially for carbohydrate metabolism (Robert et al. 2013;
Tittiger et al. 2005). These include cytochrome P450s, beta-glucosidase,
endopolygalacaturonase, and esterases, among others. Down-regulated genes are also mostly as
expected based on previous studies, like actin (Tittiger et al. 2005). Interestingly, peritrophin 1, a
gene previously down-regulated in feeding bark beetles was up-regulated in PHPF_D (Tittiger et
al. 2005). Peritrophins are the main constituent of the peritrophic membrane in insects (Dias et
al. 2019). The peritrophic membrane has an important role in digestion, which can explain the
up-regulation of this gene in MPB ingesting phloem.
Differential gene expression as a response to ingestion is further supported by the lower
number of significant genes that were up- or down-regulated when comparing PHPF_D and
PHPF_W. These results provide confirmation that the beetles were ingesting the phloem, and
presumably the target liquid as well. With the long list of up-regulated and down-regulated
genes, further annotation is needed to identify possible patterns or responses to this hpRNA
delivery method and ingestion of the negative control liquids.

166

5.4.5 Submergence comparison gene ontology reveals unexpected gene regulation
5.4.5.1 Functional annotation of up-regulated genes shows an increase in glycolysis
Many of the enriched GO terms for the up-regulated genes in J22S_D or J22S_I to C22
comparisons were associated with biological processes and molecular functions involved in
metabolism. The only cellular component that was enriched in both submergence treatments was
the mitochondrion, which was up-regulated in comparison to C22. Mitochondria have a role in
many important processes, including immune response, stress sensing, signaling, cell survival
and metabolism (Lubawy et al. 2022). In both J22S_I and J22S_D, the tricarboxylic acid (TCA)
cycle was an enriched biological process, along with L-alanine catabolic process. Components of
fatty acid metabolism were also up-regulated. Up-regulation of glycolysis was expected, due to
the starvation of the adult MPB before treatment. In an agricultural pest, Helicoverpa armigera,
similar up-regulation of glycolysis and fatty acid metabolism was reported after 48h of starvation
(Jiang et al. 2019b). These processes allow for conversion of stored energy into glucose for
insect energy requirements (Jiang et al. 2019b).
Functions related to the exoskeleton were up-regulated in beetles within both J22S_I and
J22S_D treatments relative to C22. While the exoskeleton undergoes alterations with insect
development, allowing for insect growth, emerged adults are not expected to be undergoing
molting (Huang et al. 2025). It is speculated that the specific up-regulation of larval cuticle and
cuticle structural constituents might be due to the recent emergence of the tested MPB. The soft
cuticle, like that found in developing insects, is also found in more flexible body parts, like
wings (Lodhi et al. 2024). The up-regulation of these functions may be preparation for the flight
period usually occurring right after emergence (Bleiker and Van Hezewijk 2016; Chiu and
Bohlmann 2022). This could also be linked to the peritrophic membrane, which is similar to the

167

cuticle, and it has been identified that chitin synthases are involved in peritrophic membrane
formation (Dias et al. 2019). This is likely connected to the up-regulation of the chitin-based
extracellular matrix. This is further supported by the up-regulation of peritrophin-1, a component
of the peritrophic membrane in phloem-fed beetles (see section 5.4.4).
Beetles in J22S_I showed up-regulation of processes and functions that were involved in
stress responses relative to C22. Biological processes of protein folding and refolding and the
ATP-dependent protein folding chaperone molecular function were enriched. Under stress
conditions, protein misfolding increases and can impact signalling pathways (Lanneau et al.
2008). Heat shock proteins have ATP-dependent chaperone capabilities and can assist in protein
refolding (Lanneau et al. 2008). This process would rely on ATP production from the
mitochondria (Lubawy et al. 2022). Additionally, scavenger receptor and glutathione transferase
activities have been previously identified as immune responses. Scavenger receptors are involved
in the endocytosis of apoptotic cells (Robert et al. 2013). Up-regulation of glutathione transferase
activity, which metabolizes toxins, in response to feeding has been reported in MPB (Robert et
al. 2013). It is likely that the glutathione transferase activity was responding to the presence of
terpenoids in the phloem (Chiu and Bohlmann 2022). Speculation that the stress may be in
response to dsIAP, as it is not in the J22S_D comparison, is negated by the absence of any
significant differentially expressed genes between J22S_I and J22S_D treatment groups.
Processes and functions involved in the mevalonate pathway, like isopentyl diphosphate
biosynthesis and delta-isomerase activity were up-regulated in J22S_D. The mevalonate pathway
produces frontalin, an anti-aggregation pheromone that was previously determined to be
produced upon feeding (Robert et al. 2013; Keeling et al. 2016; Sun et al. 2021). This is the
second response in submerged beetles to show similar responses as feeding MPB, as was

168

observed in the glutathione transferase activity (Robert et al. 2013; Keeling et al. 2016).
However, up-regulation of products in this pathway have been linked to the typical increase in
pheromone biosynthesis after adult emergence in other insects (González-Caballero et al. 2014).
5.4.5.2 Down-regulated gene functional annotation supports starved conditions in MPB
submergence
In both J22S_I and J22S_D treatments, synthesis of sugars and fatty acids were downregulated relative to the C22 group. Previous up-regulation of glycolysis, indicating the use of
energy stores, suggests that the decrease in synthesis was also linked to the starved condition of
the MPB (Jiang et al. 2019b). Expression of genes associated with the GO annotations relating to
sugar, protein, and nucleoside transport was also decreased. Specifically, in J22S_I, the zinc II
ion transport was down-regulated relative to no submergence. Transport of molecules, like
sugars, is often energy-dependent (Chaudhari et al. 2025). In a state of starvation where limited
energy stores are required for survival, molecule transport might be decreased to conserve
energy.
Eight different phosphatases related to gene transcription in J22S_I compared to C22
were significantly down-regulated. Five act on carboxyl-terminal domain (CTD) repeats in RNA
Polymerase II, and are involved in transcription regulation (Schüller 2013). Alternative
phosphorylation states are required for different transcription stages (Phatnani and Greenleaf
2006). It can be speculated that the down-regulation of transcription may be linked to dsIAP
uptake and RNAi initiation, as it is expected that iap transcription would decrease. Along with
increases in stress response in the J22S_I group, this adds to the speculation that some sort of
RNAi response occurred, especially when considering the digital droplet PCR (ddPCR) results
(see Chapter 3, section 3.3.4). However, with no significant difference between J22S_I and

169

J22S_D, this was not supported by this preliminary transcriptomic analysis. Rather, the downregulation may be due to ingestion of dsRNA liquid, as alternative food can cause transcription
changes (Huang et al. 2017). This was also observed in the PHPF_D compared to PHPF_W and
compared to C23 (see section 5.4.6.2).
In J22S_D, genes related to smell and oxygen were downregulated relative to C22. One
possible explanation is reduced respiration due to the starved condition of the MPB. In
Helicoverpa armigera, oxygen consumption was decreased in starved larvae compared to fed
larvae (Jiang et al. 2019b). However, it would be expected to appear down-regulated in both of
the submergence treatments, like the up-regulated processes involved in glycolysis. Another
possible explanation is the impact of submerging the adult MPB up to the posterior end of the
pronotum, and sealing the tube for 12h. Oxygen may have been too low, eliminating the need for
oxygen transport. Many insects, including Coleopteran beetles, are tolerant to hypoxic or anoxic
conditions for a determined period of time (Hoback and Stanley 2001). In Lepidopteran insects,
adults are among the most sensitive of the life stages to hypoxia conditions, perhaps accounting
for the gene regulation response (Hoback and Stanley 2001). Once again, since both groups of
dsRNA-treated beetles were subject to the same submergence method, it would have been
expected to be observed in both. These results showed the starved conditions for beetles in
J22S_D and J22S_I compared to in C22. With no significant differentially expressed genes in the
J22S_I compared to the J22S_D, no definitive conclusions can be drawn about the RNAi
response.

170

5.4.6 Phloem-fed gene ontology
5.4.6.1 Phloem-fed up-regulated gene functional annotation confirms the ingestion of
phloem.
Most of the up-regulated processes and functions in the fed adult MPB compared to the
MPB that were not fed were involved in metabolic processes, with lipid production and
regulation. In insects, energy obtained from diet is stored as triglycerides, and other lipids
(Chaudhari et al. 2025). Up-regulation of their synthesis suggests successful phloem ingestion by
adult MPB in the phloem home method. This was further supported by the up-regulation of
processes and functions related to the breakdown of pectin, a large component of plant cell walls,
and cellulose (Kirsch et al. 2016). The absence of stress response genes, and the up-regulation of
genes previously found to be associated with feeding, supports using the phloem home method
for hpRNA delivery to MPB in future RNAi testing.
Interestingly, one gene involved in the bioluminescence biological process was upregulated in PHPF_W. This has been reported before in feeding MPB, and was theorized to be
involved in detoxification and other physiological roles during host colonization (Robert et al.
2013). It was also proposed that this might indicate a form of low-light communication in MPB
(Robert et al. 2013).
Other studies have demonstrated that genes involved in the mevalonate pathway were upregulated upon feeding (Aw et al. 2010; Robert et al. 2013). This was expected due to
aggregation pheromones used to attract MPB for a mass attack on a new host, and later antiaggregation pheromones to prevent over-crowding in the host tree (Robert et al. 2013; Keeling et
al. 2016; Chiu and Bohlmann 2022). This was not observed in our study. This could be affected
by the longer starvation period in our study (typically up to seven days) than in the other studies

171

(24-48h) (Aw et al. 2010; Robert et al. 2013). In Lutzomyia longipalpis, genes involved in the
mevalonate pathway were up-regulated after adult emergence and not directly impacted by the
act of feeding (González-Caballero et al. 2014). This information can be used to speculate that a
prolonged starvation period may decrease the up-regulation of genes in the mevalonate pathway
in MPB upon feeding compared to non-fed MPB, but this is not a direct comparison.
When the MPB response in PHPF_D and PHPF_W were compared to each other, upregulated genes were involved in toxin tolerance and detoxification, wound healing and
exoskeleton components, and protein regulation. The toxin tolerance and detoxification,
specifically in the form of glucuronosyltransferase activity and monooxygenase activity, could
have been due to the terpenoids in the pine phloem, which are toxic to MPB (Chiu and
Bohlmann 2022). This was supported by the absence of other genes involved in stress response,
like hsp proteins. The absence of a large impact from hpRS delivery via phloem when compared
to water supports using hpRS as a negative control in future RNAi studies.
5.4.6.2 Phloem-fed down-regulated gene functional annotation supports metabolic response
to feeding.
Among the PHPF_D and PHPF_W beetles, most of the down-regulated genes were
involved in metabolic processes, like glycolysis. This was expected as MPB were no longer in a
starved state and did not need to use stored energy for maintenance (Jiang et al. 2019b). Rather,
the stores were being filled by ingestion of phloem. One other large group of down-regulated
genes were involved in DNA replication and metabolism, mostly in the PHPF_D beetles. Downregulation of DNA replication can indicate a less favourable diet, as was observed in Oedaleus
asiaticus fed one type of grass compared to other, optimal grasses (Huang et al. 2017). This

172

suggests that adult MPB were physiologically impacted by the ingestion of the hpRS along with
the phloem.
Genes involved in DNA replication and metabolism were also down-regulated in
PHPF_D compared to PHPF_W, providing further support that the hpRS, or presence of hpRNA,
is impacting MPB. Some metabolic processes, such as cellulase, hydrolase, and monooxygenase
activity, were represented by the down-regulated genes as well. This was unexpected, as these
are typically associated with ingestion of plant material. However, if the hpRS is having
physiological impacts on the MPB, the amount ingested was likely decreased (Huang et al.
2017). Despite down-regulation of genes associated with DNA replication indicating a negative
physiological response to the ingested hpRS-expressing yeast solutions, up-regulation of genes
involved in phloem breakdown and lipid storage indicates phloem ingestion and provides support
for using phloem-feeding to deliver hpRNA in future investigations.

173

5.5 Conclusion
The 3’TagSeq and subsequential differential gene analysis comparing the different
delivery methods provided insight to the MPB genomic response. Despite high mortality in all
injected beetles, there was no significant gene expression between injected and non-injected
beetles. The differential gene expression results showed that submerged MPB were in starved
conditions, breaking down energy stores for survival. There was no significant iap silencing,
contradicting the ddPCR results. Up-regulation of hsp genes was observed, showing the potential
for compensation of any iap loss of function. Ultimately, there was no evidence for an RNAi
machinery response due to no significant differences between J22S_I and J22S_D beetles. In the
phloem-fed MPB, less feeding occurred when yeast was present compared to water-associated
phloem, but ingestion of phloem was confirmed in both treatment groups. Out of the three
delivery methods, the differential gene expression shows less stress in MPB ingesting hpRNAassociated phloem, which is promising for future RNAi trials with MPB.

174

Chapter 6 – Discussion and Conclusion
This study has identified promising novel gene targets and laboratory-based dsRNA and
hpRNA delivery methods for RNAi initiation in emerged adult mountain pine beetles
(Dendroctonus ponderosae, MPB). This study has also provided new insights into previously
established dsRNA delivery methods. In our hands, microinjecting dsRNA into emerged adult
MPB was too invasive, despite being a successful delivery method in teneral adult MPB and
congeneric species. The maximum uptake success in the submergence method trials was 60%.
This provides some explanation for the variation observed, potentially obscuring any suppression
obtained when using this method. To advance the laboratory-based delivery method and provide
support for RNAi use in lethal trap trees, we introduce a phloem-based hpRNA delivery method,
adapted from Keeling et al. (2013) that led to successful ingestion, high MPB survival in
controls, and the beginnings of RNAi-induced mortality. Lastly, an investigative transcriptome
analysis provided more details in the MPB responses to the delivery methods and dsIAP
exposure. This thesis includes four data-comprising chapters, summarized below. Chapter
summaries are followed by important factors that were discovered during this thesis and
suggested future directions for RNAi in MPB.
6.1 General chapter conclusions
6.1.1 Chapter two summary: microinjection is too invasive for adult mountain pine beetles
In the second chapter, microinjection was used to test six gene targets for MPB mortality
using the RNAi pathway and to test the MPB-designed dsRNA on a congeneric species. Later,
microinjection delivered cascading dsRNA concentrations, creating a kill-curve, to determine the
optimal concentration for rapid MPB mortality. Microinjection has been used extensively in
Dendroctonus armandi adults, resulting in RNAi initiation and no physiological stress from the
175

injection method (Zhang et al. 2016; Sun et al. 2021; Liu et al. 2021, 2022; Liu and Chen 2022).
Microinjection for dsRNA delivery in MPB is not as common. One study reported successful
RNAi initiation after dsRNA injection into teneral adults, with a 56–83% survival of injected
beetles (Keeling et al. 2013). In our study, all injected MPB showed high mortality, likely due to
lethal injuries caused by using a larger needle than was used in D. armandi and teneral adult
MPB injections (Keeling et al. 2013; Sun et al. 2021; Liu et al. 2021, 2022; Liu and Chen 2022).
The congeneric species, the Douglas Fir beetle (Dendroctonus pseudotsugae, DFB), showed less
initial mortality in response to microinjection and no physiological response to the MPB-dsRNA.
Our results show that our microinjection delivery method, using needles that are approximately
twice as large as those in D. armandi and much larger than those used for teneral adult MPB, is
too invasive for emerged adult MPB and support other methods for dsRNA delivery to initiate
RNAi for emerged adult MPB.
6.1.2 Chapter three summary: submergence irregularly elicits an RNAi response in
mountain pine beetles
A method that involves dsRNA ingestion is more practical than microinjection for pest
management applications. Submerging MPB in a liquid solution of dsRNA has previously been
successful at initiating the RNAi pathway (Kyre et al. 2020). This method was used in the
exhaustive third chapter to test the six gene targets. Our study added another variable and tested
two different dsRNA sources: kit-synthesized dsRNA (over 200 nucleotides, see Chapter 2,
section 2.2.2) and hpRNA produced and expressed in a Saccharomyces cerevisiae strain.
Successful RNAi-mediated suppression was achieved in four of the six targets in an assay using
in vitro synthesized dsRNA. Decreased iap expression as a response to submergence in dsIAP
was initiated in two of four assays. This was less than expected as iap was a previously

176

successful target in MPB and Ips calligraphus (Kyre et al. 2020; Wallace and Rieske 2023). In
the same assay, mesh, ssk, and vha19 up-regulation was observed in response to in vitro
synthesized dsMESH, dsSSK, and dsVHA19, respectively. In a subsequent assay, submergence
in dsMESH and dsVHA19 caused gene suppression.
This study represents the first to test hpRNA-expressing yeast for RNAi initiation in
MPB. There was no successful RNAi initiation when both female and male MPB were
submerged in hpRNA-expressing yeast solutions. However, the results were likely impacted by
factors such as experimental pre-emergence cold storage and emergence timing, as there was no
response to the in vitro synthesized dsMESH, dsIAP, and dsVHA19 in these assays, either.
Colder temperatures during the development can impact beetle health upon emergence into
warmer temperatures (Huho et al. 2007; Sørensen et al. 2012).
Our study was also the first to incorporate consecutive time points, 24h, 48h, and 72h, for
MPB gene expression quantification after dsRNA exposure. The results show that target gene
expression does not change significantly over the three time points. However, the difference
between the relative gene expression in the treatment group compared to the relative gene
expression in the control groups does change over time. This shows the variability in the RNAi
results obtained in the submergence assays performed, which is likely explained by random
chance or the incomplete uptake success from this method (see Chapter 3, section 3.3.2). When
comparing the target gene expression in the treatment group to three negative controls, the gene
expression was only significantly decreased in the treatment group compared to one or two
control groups, never all three. Generally, target gene expression in the dsRS group, which
controls for the most experimental conditions out of the three controls, was not significantly
different from gene expression in the target dsRNA group.

177

6.1.3 Chapter four summary: ingestion of phloem associated with dsRNA-expressing yeast
solutions shows promise for further testing
A novel method for hpRNA delivery to MPB was tested in the fourth chapter. This
phloem-feeding method, adapted from Keeling et al. (2013), entices dsRNA ingestion by
associating it with phloem. Termed “phloem home” (C.I. Keeling and C.C. Chiu, personal
communication, 2022), MPB were placed one-per-well into a 24-well plate. Each well contained
two phloem layers, and each layer was treated with hpIAP-expressing yeast or the negative
control solutions of water and hpRS-expressing yeast. Initial trials testing three phloem and yeast
solution associations: yeast solutions painted on phloem (PHP), yeast solutions translocated
through the phloem (PHT), and phloem soaked in yeast solutions (PHS) yielded no MPB
response via mortality or gene expression. However, MPB survival in the negative controls was
high. Upon increasing the concentration of the hpIAP-expressing yeast solutions painted onto the
phloem, the start of a mortality response was observed but interrupted by the presence of fungus.
Our results show that this method has potential to be a lab-based method for hpRNA delivery to
MPB. On a larger scale, this method shows the potential for effective RNAi use in trap trees to
cause targeted MPB mortality.
6.1.4 Chapter five summary: identification of the metabolic processes involved in the
delivery methods provides support for future directions
In the fifth chapter, an investigative transcriptomic analysis was used to clarify the
variable results in the three previous chapters. Genes identified to be critical to the RNAi
pathway, argonaute -2, dicer, SID1 transmembrane family member, and double-stranded RNAbinding protein Staufen homolog (Yoon et al. 2016; Wallace and Rieske 2023) were found in the
adult MPB in all experimental conditions. In both dsRNA submerged treatments, differentially

178

expressed genes were mostly involved in metabolism. Genes involved in glycolysis were upregulated, indicating mobilization of energy stores due to the starved conditions (Jiang et al.
2019b). In the dsIAP-treated MPB, genes involved in stress response were up-regulated. The
stress response was not observed in the negative control dsRNA. In the dsRS treatment group,
genes involved in odorant reception and oxygen transport were down regulated. While it would
be expected to be down-regulated in both treatments, this could be an effect of hypoxia
conditions.
In MPB fed water-treated phloem (PHPF_W) and hpRS-expressing yeast associated
phloem (PHPF_D) relative to unfed controls (C23) (see Chapter 5, section 5.3.2.4), up-regulated
genes demonstrated successful phloem ingestion due to the genes being involved in lipid
synthesis, the main form of storage in MPB, and plant material breakdown (Chaudhari et al.
2025). The absence of up-regulated genes involved in the mevalonate pathway in our study was
unexpected, but could indicate that these genes were up-regulated upon emergence, like in
Dipteran insects (González-Caballero et al. 2014), rather than by feeding alone (Robert et al.
2013).
Down-regulated genes were involved in glycolysis, supporting the hypothesis that
feeding MPB were storing energy rather than mobilizing energy stores. In the PHPF_D
compared to PHPF_W and C23, genes involved in DNA replication and metabolism were downregulated. This has been connected to less favourable diet ingestion in grasshoppers (Oedaleus
asiaticus), and could point to a negative response to dsRNA. However, the up-regulation of
feeding-related genes does confirm that ingestion of the hpRS-treated phloem occurred.

179

6.2 Important factors to consider for MPB bioassays
6.2.1 Beetle emergence timing
Conducting bioassays using three delivery methods with beetles from 3 annual
emergence events, I have observed that when MPB emerged later in the season compared to the
initial emergences, the MPB exhibited poor health. Previous studies have mentioned a short
storage time of emerged adult MPB before use in RNAi bioassays (Kyre et al. 2020). Postemerged MPB have also been categorized in a previous study where after three days, MPB were
considered middle-aged until day nine when they were categorized as old (Evenden et al. 2014).
These categorizations are based on dispersal patterns in the wild and the maturation of MPB
(Evenden et al. 2014). In this study, I observed that the time of MPB emergence impacts their
health, potentially more than the post-emergence storage time. Examples of this are provided by
comparing submergence bioassays in this study. The terms early and late emergence are relative
to the season and based on when the first MPB emerges. In 2022 and 2024, emergence started in
early July, but in 2023 emergence started in early June. Emergence is considered early within a
two-week period of that initial emergence, and the middle ground is up to a month from first
emergence. Emergence is categorized as late a month or more after the initial emergence. Beetle
health becomes more crucial in submergence experiments, as it uses starvation conditions. Beetle
survival in the controls was higher in the assays performed with early-emerged MPB, like the
submergence assay in 2024 with more than 50% MPB survival on day seven (see Chapter 3,
section 3.3.7). The MPB survival in the negative controls for the male and female submergence
assays from 2023, using late-emerged MPB, was low and indistinguishable from the gene target
groups, with 50% or less MPB alive by day seven (see Chapter 3, sections 3.3.5 and 3.3.6). The
2022 submergence assay was in the middle ground regarding emergence time, and MPB survival

180

in the negative control was above 75% on day seven, but it rapidly decreased and was at 100%
mortality by day ten (see Chapter 3, section 3.3.3). This theory is also supported when
comparing the MPB survival of the non-injected MPB between the 2022 and 2023
microinjection assays (see Chapter 2, sections 2.3.2 and 2.3.3, respectively). The 2022
microinjection experiment was performed using late-emerged MPB and MPB survival in the
non-injected group was at 50% on day 14. In the 2023 microinjections, in which early emerged
MPB were used, MPB survival in the non-injected group was above 80% by day 14. The
decreased health of MPB that emerge later in the flight period may be due to the collection
method used in this study (see Chapter 2, section 2.2.1). The use of small bolts may cause the
phloem to lose moisture as time progresses. Therefore, MPB that emerge early are reared in
conditions similar to nature. Later emergence exposes MPB to drier phloem and increased
monoterpenes, as moisture was noted to decrease to 64% or lower after six months in jack pine
(Pinus banksiana) bolts (Guevara-Rozo et al. 2019). Reduced moisture was predicted to impact
larval development in MPB (Guevara-Rozo et al. 2019). The impact of emergence timing on
MPB health in this study is likely influenced by moisture levels and other differences in bolts
compared to living trees.
6.2.2 Beetle sex in assays
Another important factor in assays was the sex of MPB. This is important due to possible
differences in relative gene expression of the target gene between males and females before
dsRNA exposure as well as the potential different responses to RNAi between sexes. In a
population of MPB from Utah, USA, relative gene expression of hsp, iap, and shibire (shi) was
lower in males than females, but the only significant difference was in hsp (Kyre et al. 2020).
After dsRNA exposure, only female MPB showed significant hsp suppression (Kyre et al. 2020).

181

Investigations into iap expression show that this sex-linked gene is expressed less on the neo-Y
alleles, but this is compensated for by the neo-X allele, allowing similar iap expression between
males and females (Horianopoulos et al. 2018). Horianopoulos et al. (2018) also discovered
evidence that a northern neo-X allele showed iap up-regulation earlier in the fall, and the
presence or absence of this allele could impact iap expression in male MPB, an important factor
to consider in future dsIAP assays.
Our study was the first to test V-type proton ATPase subunit S1 (vha19), mesh protein
(mesh), snakeskin protein (ssk), and tetraspanin 2a (tsp2a) for targeted mortality in MPB.
Previous RNAi bioassays testing ssk, mesh, and v-Atpase A homologs in Diabrotica virgifera
virgifera larvae did not include sexing of the insects. Investigation of tsp2a as a knockdown
target in Drosophila melanogaster used only females, and reported mortality due to prevention
of fluid excretion (Beyenbach et al. 2020). Knockdown of mesh was also observed in only
female Drosophila, and only had a lethal impact in larvae, due to the importance of mesh in
Malpighian tubule (Jonusaite et al. 2020). Lastly, knockdown of vha19 in Haemonchus contortus
larvae did not include identification of the larvae sex, and caused changes in larvae development
and viability (Zawadzki et al. 2012).
Initial microinjection and submergence assays did not consider MPB sex (see Chapter 2,
section 2.3.2 and Chapter 3, section 3.3.3, respectively). Based on previous literature, this likely
impacted hsp silencing, but is not expected to have affected the other five gene targets (Kyre et
al. 2020). Subsequent bioassays in our study focused mostly on females, with a few males used
when needed for numbers. Submergence assays included only one sex, with partial knockdown
successful in females and eliminating concerns for sex-specific responses to the dsRNA (see
Chapter 3, section 3.3.6). In the microinjection assays that followed, MPB were sexed, and males

182

and females used were kept as even as possible. Most of the phloem homes were predominantly
female, but males were needed to increase the number of MPB (see Chapter 4, sections 4.2.6,
4.2.8, and 4.2.9). In the silencing groups, males and females were kept even, but noted. The only
gene target was iap, which was not found to have significant differences in gene expression
between male and female MPB (Horianopoulos et al. 2018; Kyre et al. 2020). Therefore, this is
not expected to impact results, and the final phloem home only tested females to remove this
potential variable (see Chapter 4, section 4.2.7).
Due to the identification of MPB sex used in the phloem home bioassays, the component
explaining the highest amount (17%) of the differential gene expression in the TagSeq analysis
was determined to be sex based. This variable was removed as it obscured other components that
were predicted to explain the impacts of the delivery methods or dsRNA exposure (see Chapter
5, section 5.3.2). Therefore, for RNAi bioassays with MPB, the sex of tested beetles should at
least be determined and recorded, though I recommend to use single-sex bioassays while in the
target identification stages.
6.2.3 Sample size
The variability in the gene expression analysis results may also indicate that there is not
enough statistical power. With higher power, the Type II error probability, in which the null
hypothesis is falsely accepted, is decreased (Gupta et al. 2016). For many studies, power within
the range of 80-90% is standard (Gupta et al. 2016). Here, I used a small set of bioassays for
statistical power and sample size calculations on the gene expression analyses to determine if
power could be contributing to the variable results. All tests were performed using the “pwrss”
package (Bulus 2022) in R Statistical Software (v4.3.1; R Core Team 2023).

183

The first analysis was performed on two genes with no significant gene expression
changes in the 2022 submergence assay (see Chapter 3, section 3.3.4.1, Figure 3.3 B&D).
Previous mortality was observed with approximately a 50% decrease in gene expression (Kyre et
al. 2020). This study would have 80% power to detect significance with a 50% decrease or
increase in hsp expression in the dsHSP group compared to dsRS. With a small increase
observed in the hsp expression in the dsHSP group, it is expected that this indicates no
significant difference. In order to observe a 50% decrease or increase in tsp2a expression in the
dsTSP2A group, a slightly larger sample size of n = 6 would give a power of 80%. However, as a
decrease in tsp2a is expected, a one-sided Student’s t-test would require the current sample size,
n=5, to have 80% power.
In order to have the statistical power to reduce Type II errors with small differences in
gene expression, a sample size of 15-30 beetles is required. While these sample sizes are
manageable, the purpose of the research should be considered. In our study, the goal is to
achieve a lethal response in MPB, which is not occurring with small decreases in mean gene
expression. Gene expression decreases of 50% or larger were statistically significant and
associated with emerald ash borer larvae, SPB adult, and MPB adult mortality (Kyre et al. 2019,
2020; Leelesh and Rieske 2020). Therefore, future studies should aim for a sample size
providing 80-90% power for a change in gene expression around 50%.
When more controls are included, and thus more statistical comparisons performed, a
larger sample size is required for statistical power. Sample size calculations from the 2024
female submergence assay gene expression analysis indicate a range of 10-40 beetles would be
the required sample size to have 80% power in the ANOVA with the current variances (see
Chapter 3, section 3.3.7.1). Two exceptions to the sample size range are the dsMESH groups at

184

24h and 48h, where a much larger and unobtainable required sample size was calculated (see
Chapter 3, section 3.3.7.1.3). A sample size range of 80-120 beetles would be needed for power
to reach 80% in the PHP24 gene expression analysis by ANOVA (see Chapter 4, section
4.3.5.2). The larger sample size required likely indicates one of two things. First, it may indicate
that there is no significant difference. This is likely the case in some comparisons, like the FSA
(see Chapter 3, Figure 3.5B) and MSA (see Chapter 3, Figure 3.7A) vha19 and iap gene
expression analyses, respectively (see Chapter 3, sections 3.3.5.1 and 3.3.6.1). Second, a large
required sample size could suggest that the variation in the data is too large, and impacted by
other factors, like beetle health. Variation in the data due to other factors is likely the case in the
dsMESH groups in the 2024 female submergence assay.
Ultimately, the sample sizes appear to be too small for some of the questions being asked
in our study. Our results have limited power in the more complex gene expression analyses, and
there could be significant gene expression changes that went undetected. Due to time and
resource constraints, increasing the sample sizes to the required numbers is not always feasible.
Additionally, the statistical power provided by our sample sizes was able to detect a 50% or
greater difference in gene expression, and smaller changes in gene expression were not
associated with MPB mortality. Other variables besides power and sample size were likely
impacting the gene expression analysis, like beetle health (see section 6.2.1). For future RNAi
investigations, it is recommended to increase sample sizes for gene expression analysis to within
the range of 10-20 beetles to decrease the impact of other variables on the gene expression
analysis.

185

6.3 Future Directions
The ambiguity of the results from this study leads to many new questions, which require
more experiments. While a comprehensive list of all recommended or potential future directions
for RNAi studies with MPB is not practical, a refined list is presented here.
6.3.1 Gene targets
A large variable in our study, along with many other RNAi studies, is the gene target
(Cooper et al. 2019). While we have shown promise for the targets tested in this study, further
investigations should be conducted using iap, mesh, vha19, and ssk. Additionally, testing
different dsRNA constructs within the target gene sequences used in this study should be tested
for improved effectiveness. With the results from the TagSeq analysis suggesting gene
compensation when iap suppression was observed, combining similar gene targets, like iap and
hsp, may reduce compensation and increase the efficiency of RNAi in MPB.
Another possible explanation for the absence of a mortality response in MPB after
exposure to dsIAP is gene paralogs. Paralogs are duplications of a gene, some of which are
functional (Deem and Brisson 2024). These paralogous genes contribute to evolution and have
roles in the genetic pathways in an organism, though identification of these genes can be difficult
(Dunivant et al. 2024). Therefore, it is likely that the presence of paralogous genes in an
organism can impact the RNAi response, and therefore efficiency. Paralogs can be different
enough to avoid RNAi-mediated suppression and may compensate for the suppression of the
original gene. For example, individual targeting of paralogs was achieved in Mimulus lewisii
(Phrymaceae) flowers (Dunivant et al. 2024). With 5.6% of the genome identified as duplicated,
or paralogous, genes (NCBI 2022), investigating the specific MPB gene paralogs in future
studies may provide insights to better gene targets.

186

Responses to the same target can be influenced by geographical factors as well. Genetic
differences exist between MPB populations, especially the northern and southern populations in
western Canada. Large genetic differences also exist between MPB populations around the Great
Basin Desert in the United States of America (Bracewell et al. 2011, 2013; Janes et al. 2014).
Different responses to the same dsRNA target were reported among different southern pine
beetle (Dendroctonus frontalis, SPB) populations (Kyre et al. 2024). Future studies should
investigate the variation in the target genes and the response in MPB from different populations
in Canada and the United States of America, as the results will be crucial for the application of
this method as a MPB management tool.
6.3.2 Delivery method
Our results support the effectiveness of submerging MPB in dsRNA to elicit an RNAi
response, as was originally shown by Kyre et al. (2020). Our study aimed to advance the labbased delivery to a method comparable to proposed in situ uses. A novel delivery method using
phloem and hpRNA-expressing heat-inactivated yeast associations was tried. Upon increasing
the hpIAP-expressing yeast solutions, this method showed promise for RNAi-mediated
mortality, with high MPB survival in the negative controls. High MPB survival suggests that this
method might also boost MPB vitality, allowing MPB that emerged later in the season to be
tested and increasing productivity during the flight season. It is my recommendation to include
this method in future MPB RNAi investigations, but to incorporate an anti-fungal agent, like
sorbic acid (Rangasamy and Siegfried 2012; Costa and Reeve 2012; Vélez et al. 2016), to
prevent fungal infections.
With the assumed absence of SID-2 in MPB, dsRNA uptake from ingestion-based
delivery methods is likely limited. However, one of the SID-1 transporters could function

187

similarly to SID-2, allowing for environmental RNAi (see Chapter 5, section 5.4.1). Increasing
the dsRNA delivered could increase the dsRNA successfully delivered to cells. Alternatively,
delivering the dsRNA via nanoparticles shows promise for increasing dsRNA uptake in insects
(Christiaens et al. 2020). Using a “paperclip” dsRNA structure, where both ends are closed, has
increased dsRNA uptake via the clathrin-mediated pathway in Aedes aegypt (Abbasi et al. 2020).
It is possible that using this dsRNA structure could improve RNAi sensitivity in MPB, and
should be investigated in future studies.
6.4 Final remarks
It is my hope that the chapters in this thesis provide details that assist future MPB
bioassays. At the beginning of this project, I was advised that bioassay planning was crucial, and
I reiterate that advice here. While planning, I recommend prioritizing the more promising, and
any non-feeding, bioassays for the first wave of MPB. Using early emerged MPB, as they appear
to be the healthiest and will hopefully have high survival in the controls, enables any mortality
response from target dsRNA delivery to be observed (see section 6.2.1).

188

Literature Cited
Abbasi, R., Heschuk, D., Kim, B., Whyard, S. 2020. A novel paperclip double-stranded RNA
structure demonstrates clathrin-independent uptake in the mosquito Aedes aegypti. Insect
Biochem. Mol. Biol. 127:103492. doi: 10.1016/j.ibmb.2020.103492.
Ainslie, B., and Jackson, P.L. 2011. Investigation into mountain pine beetle above-canopy
dispersion using weather radar and an atmospheric dispersion model. Aerobiologia 27(1):
51–65. doi:10.1007/s10453-010-9176-9.
Andersson, M.N., Grosse-Wilde, E., Keeling, C.I., Bengtsson, J.M., Yuen, M.M., Li, M., Hillbur,
Y., Bohlmann, J., Hansson, B.S., and Schlyter, F. 2013. Antennal transcriptome analysis
of the chemosensory gene families in the tree killing bark beetles, Ips typographus and
Dendroctonus ponderosae (Coleoptera: Curculionidae: Scolytinae). BMC Genomics
14(1): 198. doi:10.1186/1471-2164-14-198.
Andrus, R.A., Hart, S.J., and Veblen, T.T. 2020. Forest recovery following synchronous
outbreaks of spruce and western balsam bark beetle is slowed by ungulate browsing.
Ecology 101(5): e02998. doi:10.1002/ecy.2998.
Anjum, A., Jaggi, S., Varghese, E., Lall, S., Bhowmik, A., and Rai, A. 2016. Identification of
Differentially Expressed Genes in RNA-seq Data of Arabidopsis thaliana: A Compound
Distribution Approach. J. Comput. Biol. 23(4): 239–247. doi:10.1089/cmb.2015.0205.
Audley, J.P., Fettig, C.J., Steven Munson, A., Runyon, J.B., Mortenson, L.A., Steed, B.E.,
Gibson, K.E., Jørgensen, C.L., McKelvey, S.R., McMillin, J.D., and Negrón, J.F. 2020.
Impacts of mountain pine beetle outbreaks on lodgepole pine forests in the Intermountain
West, U.S., 2004–2019. For. Ecol. Manag. 475: 118403.
doi:10.1016/j.foreco.2020.118403.
Aw, T., Schlauch, K., Keeling, C.I., Young, S., Bearfield, J.C., Blomquist, G.J., Tittiger, C.
2010. Functional genomics of mountain pine beetle (Dendroctonus ponderosae) midguts
and fat bodies. Genomics 11:215. https://doi.org/10.1186/1471-2164-11-215
Baum, J.A., Bogaert, T., Clinton, W., Heck, G.R., Feldmann, P., Ilagan, O., Johnson, S.,
Plaetinck, G., Munyikwa, T., Pleau, M., Vaughn, T., and Roberts, J. 2007. Control of
coleopteran insect pests through RNA interference. Nat. Biotechnol. 25(11): 1322–1326.
Nature Publishing Group. doi:10.1038/nbt1359.
Bentz, B.J., and Hansen, E.M. 2018. Evidence for a Prepupal Diapause in the Mountain Pine
Beetle (Dendroctonus ponderosae). Environ. Entomol. 47(1): 175–183.
doi:10.1093/ee/nvx192.
Bentz, B.J., and Powell, J.A. 2014. Mountain Pine Beetle Seasonal Timing and Constraints to
Bivoltinism: (A Comment on Mitton and Ferrenberg, “Mountain Pine Beetle Develops an
Unprecedented Summer Generation in Response to Climate Warming”). Am. Nat. 184(6):
787–796. doi:10.1086/678405.
189

Beyenbach, K.W., Schöne, F., Breitsprecher, L.F., Tiburcy, F., Furuse, M., Izumi, Y., Meyer, H.,
Jonusaite, S., Rodan, A.R., and Paululat, A. 2020. The septate junction protein
Tetraspanin 2A is critical to the structure and function of Malpighian tubules in
Drosophila melanogaster. Am. J. Physiol.-Cell Physiol. 318(6): C1107–C1122.
doi:10.1152/ajpcell.00061.2020.
Bingsohn, L., Knorr, E., Billion, A., Narva, K.E., and Vilcinskas, A. 2017. Knockdown of genes
in the Toll pathway reveals new lethal RNA interference targets for insect pest control.
Insect Mol. Biol. 26(1): 92–102. doi:10.1111/imb.12273.
Bleiker, K. P. (Ed.). (2019). Risk assessment of the threat of mountain pine beetle to Canada’s
Boreal and Eastern pine forests. Canadian Council of Forest Ministers, Forest Pest
Working Group
Bleiker, K.P., and Van Hezewijk, B.H. 2016. Flight Period of Mountain Pine Beetle (Coleoptera:
Curculionidae) in its Recently Expanded Range. Environ. Entomol. 45(6): 1561–1567.
doi:10.1093/ee/nvw121.
Bracewell, R.R., Pfrender, M.E., Mock, K.E., and Bentz, B.J. 2011. Cryptic postzygotic isolation
in an eruptive species of bark beetle (Dendroctonus ponderosae). Evolution 65(4): 961–
975. doi:10.1111/j.1558-5646.2010.01201.x.
Bracewell, R.R., Pfrender, M.E., Mock, K.E., and Bentz, B.J. 2013. Contrasting Geographic
Patterns of Genetic Differentiation in Body Size and Development Time with
Reproductive Isolation in Dendroctonus ponderosae (Coleoptera: Curculionidae,
Scolytinae). Ann. Entomol. Soc. Am. 106(3): 385–391. doi:10.1603/AN12133.
Bragg, Z., and Rieske, L.K. 2022a. Feasibility of Systemically Applied dsRNAs for Pest-Specific
RNAi-Induced Gene Silencing in White Oak. Front. Plant Sci. 13: 830226.
doi:10.3389/fpls.2022.830226.
Bragg, Z., and Rieske, L.K. 2022b. Spatial Distribution and Retention in Loblolly Pine Seedlings
of Exogenous dsRNAs Applied through Roots. Int. J. Mol. Sci. 23(16): 9167-N.PAG.
MDPI. doi:10.3390/ijms23169167.
British Columbia. (n.d.). B.C.'s Bark Beetles: What does the science say? Available from
https://www2.gov.bc.ca/gov/content/industry/forestry/managing-our-forestresources/forest-health/forest-pests/bark-beetles [accessed 30 August 2024].
Bulus, M. 2022. pwrss: Statistical Power and Sample Size Calculation Tools.
doi:10.32614/CRAN.package.pwrss.
Burton, P.J. 2006. Restoration of forests attacked by mountain pine beetle: Misnomer,
misdirected, or must-do? J. Ecosyst. Manag. 7(2). doi:10.22230/jem.2006v7n2a537.

190

CABI Digital Library. 2020. Dendroctonus ponderosae (black hills beetle),
https://www.cabidigitallibrary.org/doi/10.1079/cabicompendium.18354 [accessed March
2023].
Cappelle K, de Oliveira CF, Van Eynde B, Christiaens O, Smagghe G. 2016. The involvement of
clathrin-mediated endocytosis and two Sid-1-like transmembrane proteins in doublestranded RNA uptake in the Colorado potato beetle midgut. Insect Mol Biol. 25(3):31523. doi:10.1111/imb.12222.
Chaudhari, B.Y., Pradhan, A.G., and Joshi, R.S. 2025. Metabolic gatekeepers: Dynamic roles of
sugar transporters in insect metabolism and physiology. Insect Mol. Biol. 34(1): 1–18.
doi:10.1111/imb.12963.
Chiu, C.C., and Bohlmann, J. 2022. Mountain Pine Beetle Epidemic: An Interplay of Terpenoids
in Host Defense and Insect Pheromones. Annu. Rev. Plant Biol. 73(1): 475–494.
doi:10.1146/annurev-arplant-070921-103617.
Christiaens, O., Whyard, S., Vélez, A.M., and Smagghe, G. 2020. Double-Stranded RNA
Technology to Control Insect Pests: Current Status and Challenges. Front. Plant Sci. 11:
1-10. doi: 10.3389/fpls.2020.00451.
Coggins, S.B., Coops, N.C., Wulder, M.A., Bater, C.W., and Ortlepp, S.M. 2011. Comparing the
impacts of mitigation and non-mitigation on mountain pine beetle populations. J.
Environ. Manage. 92(1): 112–120. doi:10.1016/j.jenvman.2010.08.016.
Cooper, A.M., Silver, K., Zhang, J., Park, Y., and Zhu, K.Y. 2019. Molecular mechanisms
influencing efficiency of RNA interference in insects. Pest Manag. Sci. 75(1): 18–28.
doi:10.1002/ps.5126.
Corbett, L.J., Withey, P., Lantz, V.A., and Ochuodho, T.O. 2016. The economic impact of the
mountain pine beetle infestation in British Columbia: provincial estimates from a CGE
analysis. For. Int. J. For. Res. 89(1): 100–105. doi:10.1093/forestry/cpv042.
Costa, A., and Reeve, J.D. 2012. The effect of larval predators Thanasimus dubius (Coleoptera:
Cleridae), produced by an improved system of rearing, against the southern pine beetle
Dendroctonus frontalis (Coleoptera: Curculionidae). Biol. Control 60(1): 1–6.
doi:10.1016/j.biocontrol.2011.08.006.
Coulter, S.J. 2018. Mitigation of the effect of variability in digital PCR assays through use of
duplexed reference assays for normalization. BioTechniques 65(2): 86–91.
doi:10.2144/btn-2018-0058.
Cullingham, C.I., Cooke, J.E.K., Dang, S., Davis, C.S., Cooke, B.J., Coltman, D.W. 2011.
Mountain pine beetle host-range expansion threatens the boreal forest. Mol. Ecol. 20:
2157-2171. doi: 10.1111/j.1365-294X.2011.05086.x

191

Cullingham, C.I., Janes, J.K., Hamelin, R.C., James, P.M.A., Murray, B.W., and Sperling, F.A.H.
2019. The contribution of genetics and genomics to understanding the ecology of the
mountain pine beetle system. Can. J. For. Res. 49(7): 721–730. doi:10.1139/cjfr-20180303.
Cullingham, C.I., Roe, A.D., Sperling, F.A.H., and Coltman, D.W. 2012. Phylogeographic
insights into an irruptive pest outbreak. Ecol. Evol. 2(5): 908–919. doi:10.1002/ece3.102.
Deem, K.D., and Brisson, J.A. 2024. Problems with Paralogs: The Promise and Challenges of
Gene Duplicates in Evo-Devo Research. Integr. Comp. Biol. 64(2): 556–564.
doi:10.1093/icb/icae009.
Dhar, A., Parrott, L., and Hawkins, C. 2016a. Aftermath of Mountain Pine Beetle Outbreak in
British Columbia: Stand Dynamics, Management Response and Ecosystem Resilience.
Forests 7(8): 171. doi:10.3390/f7080171.
Dhar, A., Parrott, L., and Heckbert, S. 2016b. Consequences of mountain pine beetle outbreak on
forest ecosystem services in western Canada. Can. J. For. Res. 46(8): 987–999. NRC
Research Press. doi:10.1139/cjfr-2016-0137.
Dias, R.O., Cardoso, C., Leal, C.S., Ribeiro, A.F., Ferreira, C., and Terra, W.R. 2019. Domain
structure and expression along the midgut and carcass of peritrophins and cuticle proteins
analogous to peritrophins in insects with and without peritrophic membrane. J. Insect
Physiol. 114: 1–9. doi:10.1016/j.jinsphys.2019.02.002.
Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M.,
and Gingeras, T.R. 2013. STAR: ultrafast universal RNA-seq aligner. Bioinformatics
29(1): 15–21. doi:10.1093/bioinformatics/bts635.
Dowling, D., Pauli, T., Donath, A., Meusemann, K., Podsiadlowski, L., Petersen, M., Peters,
R.S., Mayer, C., Liu, S., Zhou, X., Misof, B., and Niehuis, O. 2016. Phylogenetic Origin
and Diversification of RNAi Pathway Genes in Insects. Genome Biol. Evol. 8(12): 3784–
3793. doi:10.1093/gbe/evw281.
Duman-Scheel, M. 2019. Saccharomyces cerevisiae (Baker’s Yeast) as an Interfering RNA
Expression and Delivery System. Curr. Drug Targets 20(9): 942–952.
doi:10.2174/1389450120666181126123538.
Dunivant, T.S., Singh, V., Livingston, K.E., Ross, J.D., and Hileman, L.C. 2024. CYCLOIDEA
paralogs function partially redundantly to specify dorsal flower development in Mimulus
lewisii. Am. J. Bot. 111(2): e16271. doi:10.1002/ajb2.16271.
Evenden, M.L., Whitehouse, C.M., and Sykes, J. 2014. Factors Influencing Flight Capacity of
the Mountain Pine Beetle (Coleoptera: Curculionidae: Scolytinae). Environ. Entomol.
43(1): 187–196. doi:10.1603/EN13244.
Fabrick, J.A., and Hull, J.J. 2017. Assessing Integrity of Insect RNA. USDA-ARS Research
Notes. 5991-7903EN: 1-12. Available from
192

https://www.ars.usda.gov/ARSUserFiles/20200500/Pubs%202018/FabrickHull%20Agile
ntNot4es2017.pdf [Accessed May 24, 2023].
Fettig, C.J., Gibson, K.E., Munson, A.S., and Negrón, J.F. 2014. Cultural Practices for
Prevention and Mitigation of Mountain Pine Beetle Infestations. For. Sci. 60(3): 450–
463. doi:10.5849/forsci.13-032.
Finetti, L., Benetti, L., Leyria, J., Civolani, S., and Bernacchia, G. 2023. Topical delivery of
dsRNA in two hemipteran species: Evaluation of RNAi specificity and non-target effects.
Pestic. Biochem. Physiol. 189: 105295. doi:10.1016/j.pestbp.2022.105295.
Fraser, J.D., Bonnett, T.R., Keeling, C.I., and Huber, D.P.W. 2017. Seasonal shifts in
accumulation of glycerol biosynthetic gene transcripts in mountain pine beetle,
Dendroctonus ponderosae Hopkins (Coleoptera: Curculionidae), larvae. PeerJ 5: e3284.
doi:10.7717/peerj.3284.
Ghosh, S.K.B., Hunter, W.B., Park, A.L., and Gundersen-Rindal, D.E. 2018. Double-stranded
RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sapfeeding Hemipteran Insects. J. Vis. Exp. JoVE (135): 57390. doi:10.3791/57390.
Gilbert, S.F. 2000. Differential Gene Expression. In Developmental Biology. 6th edition. Sinauer
Associates. Available from https://www.ncbi.nlm.nih.gov/books/NBK10061/ [accessed
10 September 2024].
Girard, M., Berthaud, V., Martin, E., Vallon, L., Rebollo, R., Vallier, A., Vigneron, A., Hay, A.-E.,
Valiente Moro, C., and Minard, G. 2025. Evaluation of non-invasive dsRNA delivery
methods for the development of RNA interference in the Asian tiger mosquito Aedes
albopictus. J. Pest Sci. 98(1): 581–596. doi:10.1007/s10340-024-01779-w.
González-Caballero, N., Rodríguez-Vega, A., Dias-Lopes, G., Valenzuela, J.G., Ribeiro, J.M.C.,
Carvalho, P.C., Valente, R.H., Brazil, R.P., and Cuervo, P. 2014. Expression of the
mevalonate pathway enzymes in the Lutzomyia longipalpis (Diptera: Psychodidae) sex
pheromone gland demonstrated by an integrated proteomic approach. J. Proteomics 96:
117–132. doi:10.1016/j.jprot.2013.10.028.
Griffin, J., and Turner, M. 2012. Changes to the N cycle following bark beetle outbreaks in two
contrasting conifer forest types. Oecologia 170(2): 551–565. doi:10.1007/s00442-0122323-y.
Gupta, K., Attri, J., Singh, A., Kaur, H., and Kaur, G. 2016. Basic concepts for sample size
calculation: Critical step for any clinical trials! Saudi J. Anaesth. 10(3): 328.
doi:10.4103/1658-354X.174918.
Haller, S., Widmer, F., Siegfried, B.D., Zhuo, X., and Romeis, J. 2019. Responses of two
ladybird beetle species (Coleoptera: Coccinellidae) to dietary RNAi. Pest Manag. Sci.
75(10): 2652–2662. doi:10.1002/ps.5370.

193

Hashiro, S., and Yasueda, H. 2022. RNA Interference-Based Pesticides and Antiviral Agents:
Microbial Overproduction Systems for Double-Stranded RNA for Applications in
Agriculture and Aquaculture. Appl. Sci. 12(6): 2954. Multidisciplinary Digital Publishing
Institute. doi:10.3390/app12062954.
Hicke, J.A., Meddens, A.J.H., Allen, C.D., and Kolden, C.A. 2013. Carbon stocks of trees killed
by bark beetles and wildfire in the western United States. Environ. Res. Lett. 8(3):
035032. IOP Publishing. doi:10.1088/1748-9326/8/3/035032.
Hoback, W.W., and Stanley, D.W. 2001. Insects in hypoxia. J. Insect Physiol. 47(6): 533–542.
doi:10.1016/S0022-1910(00)00153-0.
Hollowell, H., Wallace, M., and Rieske, L.K. 2022. The trigger for RNA interference to silence
essential genes in southern pine beetle, Dendroctonus frontalis, demonstrates no lethal
effects on pine‐associated nontarget insects. Agric. For. Entomol. doi:10.1111/afe.12550.
Horianopoulos, L.C., Boone, C.K., Samarasekera, G.D.N.G., Kandola, G.K., and Murray, B.W.
2018. Selection of the sex‐linked inhibitor of apoptosis in mountain pine beetle
(Dendroctonus ponderosae) driven by enhanced expression during early overwintering.
Ecol. Evol. 8(12): 6253–6264. doi:10.1002/ece3.4164.
Howe, M., Carroll, A., Gratton, C., and Raffa, K.F. 2021. Climate-induced outbreaks in highelevation pines are driven primarily by immigration of bark beetles from historical hosts.
Glob. Change Biol. 27(22): 5786–5805. doi:10.1111/gcb.15861.
Hu, X., Richtman, N.M., Zhao, J.-Z., Duncan, K.E., Niu, X., Procyk, L.A., Oneal, M.A.,
Kernodle, B.M., Steimel, J.P., Crane, V.C., Sandahl, G., Ritland, J.L., Howard, R.J.,
Presnail, J.K., Lu, A.L., and Wu, G. 2016. Discovery of midgut genes for the RNA
interference control of corn rootworm. Sci. Rep. 6(1): 30542. doi:10.1038/srep30542.
Hu, X., Steimel, J.P., Kapka-Kitzman, D.M., Davis-Vogel, C., Richtman, N.M., Mathis, J.P.,
Nelson, M.E., Lu, A.L., and Wu, G. 2019. Molecular characterization of the insecticidal
activity of double-stranded RNA targeting the smooth septate junction of western corn
rootworm (Diabrotica virgifera virgifera). PLoS ONE 14(01): 1–18. Public Library of
Science. doi:10.1371/journal.pone.0210491.
Huang, C., Lü, J., Bai, C., Guo, Y., Guo, C., Song, J., and Xi, J. 2025. Transcriptome reveals
patterns of response by Lasioderma serricorne (Coleoptera: Ptinidae) larvae to smethoprene exposure. J. Stored Prod. Res. 111: 102521. doi:10.1016/j.jspr.2024.102521.
Huang, X., Whitman, D.W., Ma, J., McNeill, M.R., and Zhang, Z. 2017. Diet alters performance
and transcription patterns in Oedaleus asiaticus (Orthoptera: Acrididae) grasshoppers.
PLOS ONE 12(10): e0186397. doi:10.1371/journal.pone.0186397.
Huho, B.J., Ng’habi, K.R., Killeen, G.F., Nkwengulila, G., Knols, B.G.J., and Ferguson, H.M.
2007. Nature beats nurture: a case study of the physiological fitness of free-living and
laboratory-reared male Anopheles gambiae s.l. J. Exp. Biol. 210(16): 2939–2947.
doi:10.1242/jeb.005033.
194

Izumi, Y., Motoishi, M., Furuse, K., and Furuse, M. 2016. A tetraspanin regulates septate
junction formation in Drosophila midgut. J. Cell Sci.: jcs.180448.
doi:10.1242/jcs.180448.
Izumi, Y., Yanagihashi, Y., and Furuse, M. 2012. A novel protein complex, mesh-ssk, is required
for septate junction formation in Drosophila midgut. J. Cell Sci.: jcs.112243.
doi:10.1242/jcs.112243.
Janes, J.K., Li, Y., Keeling, C.I., Yuen, M.M.S., Boone, C.K., Cooke, J.E.K., Bohlmann, J.,
Huber, D.P.W., Murray, B.W., Coltman, D.W., and Sperling, F.A.H. 2014. How the
Mountain Pine Beetle (Dendroctonus ponderosae) Breached the Canadian Rocky
Mountains. Mol. Biol. Evol. 31(7): 1803–1815. doi:10.1093/molbev/msu135.
Jantz, O.K., and Johnsey, R.L. 1964. Determination of Sex of the Douglas-fir Beetle
Dendroctonus pseudotsugae Hopkins (Coleoptera: Scolytidae). Can. Entomol. 96(10):
1327–1329. doi:10.4039/Ent961327-10.
Jenkins, M.J., Hebertson, E., Page, W., and Jorgensen, C.A. 2008. Bark beetles, fuels, fires and
implications for forest management in the Intermountain West. For. Ecol. Manag. 254(1):
16–34. doi:10.1016/j.foreco.2007.09.045.
Jiang, H., Zhang, N., Chen, M., Meng, X., Ji, C., Ge, H., Dong, F., Miao, L., Yang, X., Xu, X.,
Qian, K., and Wang, J. 2019a. Transcriptional and post-translational activation of
AMPKα by oxidative, heat, and cold stresses in the red flour beetle, Tribolium
castaneum. Cell Stress Chaperones 24(6): 1079–1089. doi:10.1007/s12192-019-01030-x.
Jiang, T., Ma, L., Liu, X.-Y., Xiao, H.-J., and Zhang, W.-N. 2019b. Effects of starvation on
respiratory metabolism and energy metabolism in the cotton bollworm Helicoverpa
armigera (Hübner) (Lepidoptera: Noctuidae). J. Insect Physiol. 119: 103951.
doi:10.1016/j.jinsphys.2019.103951.
Joga, M.R., Zotti, M.J., Smagghe, G., and Christiaens, O. 2016. RNAi Efficiency, Systemic
Properties, and Novel Delivery Methods for Pest Insect Control: What We Know So Far.
Front. Physiol. 7. Available from
https://www.frontiersin.org/articles/10.3389/fphys.2016.00553 [accessed 21 November
2022].
Johnson, E.C. 2024. An assessment of Alberta’s strategy for controlling mountain pine beetle
outbreaks. arXiv. doi:10.48550/arXiv.2412.08786.
Jonusaite, S., Beyenbach, K.W., Meyer, H., Paululat, A., Izumi, Y., Furuse, M., and Rodan, A.R.
2020. The septate junction protein Mesh is required for epithelial morphogenesis, ion
transport, and paracellular permeability in the Drosophila Malpighian tubule. Am. J.
Physiol.-Cell Physiol. 318(3): C675–C694. American Physiological Society.
doi:10.1152/ajpcell.00492.2019.

195

Jurado, A.R., Tan, D., Jiao, X., Kiledjian, M., and Tong, L. 2014. Structure and Function of PremRNA 5′-End Capping Quality Control and 3′-End Processing. Biochemistry 53(12):
1882. American Chemical Society. doi:10.1021/bi401715v.
Keeling, CI., Campbell, E.O., Batista, P.D., Shegelski, V.A., Trevoy, S.A.L., Huber, D.P.W.,
Janes, J.K., Sperling, F.A.H. 2021. Chromosome-level genome assembly reveals genomic
architecture of northern range expansion in the mountain pine beetle, Dendroctonus
ponderosae Hopkins (Coleoptera: Curculionidae). Mol Ecol Resour. 22:1149–1167.
doi:10.1111/1755-0998.13528.
Keeling, C.I., Chiu, C.C., Aw, T., Li, M., Henderson, H., Tittiger, C., Weng, H.-B., Blomquist,
G.J., and Bohlmann, J. 2013a. Frontalin pheromone biosynthesis in the mountain pine
beetle, Dendroctonus ponderosae , and the role of isoprenyl diphosphate synthases. Proc.
Natl. Acad. Sci. 110(47): 18838–18843. doi:10.1073/pnas.1316498110.
Keeling, C.I., Li, M., Sandhu, H.K., Henderson, H., Yuen, M.M.S., and Bohlmann, J. 2016.
Quantitative metabolome, proteome and transcriptome analysis of midgut and fat body
tissues in the mountain pine beetle, Dendroctonus ponderosae Hopkins, and insights into
pheromone biosynthesis. Insect Biochem. Mol. Biol. 70: 170–183.
doi:10.1016/j.ibmb.2016.01.002.
Kirsch, R., Heckel, D.G., and Pauchet, Y. 2016. How the rice weevil breaks down the pectin
network: Enzymatic synergism and sub-functionalization. Insect Biochem. Mol. Biol. 71:
72–82. doi:10.1016/j.ibmb.2016.02.007.
Klepzigl, K.D., Moser, J.C., Lombardero, F.J., Hofstetter, R.W., and Ayres, M.P. 2001. Symbiosis
and Competition: Complex Interactions Among Beetles, Fungi and Mites. Symbiosis. 30:
83-96.
Klutsch, J.G., Cale, J.A., Whitehouse, C., Kanekar, S.S., and Erbilgin, N. 2017. Trap trees: an
effective method for monitoring mountain pine beetle activities in novel habitats. Can. J.
For. Res. 47(10): 1432–1437. doi:10.1139/cjfr-2017-0189.
Koch, D., Lewis, M.A., and Lele, S. 2021. The Signature of Endemic Populations in the Spread
of Mountain Pine Beetle Outbreaks. Bull. Math. Biol. 83(6): 65. doi:10.1007/s11538021-00899-z.
Krueger, F., James, F., Ewels, P., Afyounian, E. & Schuster-Boeckler, B. 2021.
FelixKrueger/TrimGalore: v0.6.7 - doi via Zenodo. doi:10.5281/zenodo.5127899.
Kyre, B.R., Bentz, B.J., and Rieske, L.K. 2020. Susceptibility of mountain pine beetle
(Dendroctonus ponderosae Hopkins) to gene silencing through RNAi provides potential
as a novel management tool. For. Ecol. Manag. 473: 118322.
doi:10.1016/j.foreco.2020.118322.

196

Kyre, B.R., Dupuis, J.R., Zúñiga, G., and Rieske, L.K. 2024. Variation in RNA interference
sensitivity in the southern pine beetle, Dendroctonus frontalis (Coleoptera:
Curculionidae). Biol. J. Linn. Soc. 142(2): 147–154. doi:10.1093/biolinnean/blad126.
Kyre, B.R., and Rieske, L.K. 2022. Using RNAi to silence heat shock protein has congeneric
effects in North America’s Dendroctonus bark beetles. For. Ecol. Manag. 520: 120367.
doi:10.1016/j.foreco.2022.120367.
Kyre, B.R., Rodrigues, T.B., and Rieske, L.K. 2019. RNA interference and validation of
reference genes for gene expression analyses using qPCR in southern pine beetle,
Dendroctonus frontalis. Sci. Rep. 9: 5640. doi:10.1038/s41598-019-42072-6.
Lanneau, D., Brunet, M., Frisan, E., Solary, E., Fontenay, M., and Garrido, C. 2008. Heat shock
proteins: essential proteins for apoptosis regulation. J. Cell. Mol. Med. 12(3): 743–761.
doi:10.1111/j.1582-4934.2008.00273.x.
Law, C.W., Chen, Y., Shi, W., and Smyth, G.K. 2014. voom: precision weights unlock linear
model analysis tools for RNA-seq read counts. Genome Biol. 15(2): R29.
doi:10.1186/gb-2014-15-2-r29.
Leelesh, R.S., and Rieske, L.K. 2020. Oral Ingestion of Bacterially Expressed dsRNA Can
Silence Genes and Cause Mortality in a Highly Invasive, Tree-Killing Pest, the Emerald
Ash Borer. Insects 11(7): 440. Multidisciplinary Digital Publishing Institute.
doi:10.3390/insects11070440.
Li, K., Chen, T., Li, Y., Sun, K., Pang, K., Yu, X., and Hao, P. 2025. Risk Assessment of RNAiBased Potential Pesticide dsNlAtg3 and Its Homologues for Nilaparvata lugens and NonTarget Organisms. Insects 16(2): 225. doi:10.3390/insects16020225.
Linz, D.M., Clark-Hachtel, C.M., Borràs-Castells, F., and Tomoyasu, Y. 2014. Larval RNA
Interference in the Red Flour Beetle, Tribolium castaneum. J. Vis. Exp. (92): 52059.
doi:10.3791/52059.
List, F., Tarone, A.M., Zhu‐Salzman, K., and Vargo, E.L. 2022. RNA meets toxicology: efficacy
indicators from the experimental design of RNAI studies for insect pest management.
Pest Manag. Sci. 78(8): 3215–3225. doi:10.1002/ps.6884.
Liu, B., and Chen, H. 2022. Disruption of CYP6DF1 and CYP6DJ2 increases the susceptibility
of Dendroctonus armandi to (+)-α-pinene. Pestic. Biochem. Physiol. 188: 105270.
doi:10.1016/j.pestbp.2022.105270.
Liu, B., Fu, D., Gao, H., Ning, H., Sun, Y., Chen, H., and Tang, M. 2021. Cloning and
Expression of the Neuropeptide F and Neuropeptide F Receptor Genes and Their
Regulation of Food Intake in the Chinese White Pine Beetle Dendroctonus armandi.
Front. Physiol. 12: 662651. doi:10.3389/fphys.2021.662651.
Liu, B., Fu, D., Ning, H., Tang, M., and Chen, H. 2022. Knockdown of CYP6CR2 and
CYP6DE5 reduces tolerance to host plant allelochemicals in the Chinese white pine
197

beetle Dendroctonus armandi. Pestic. Biochem. Physiol. 187: 105180.
doi:10.1016/j.pestbp.2022.105180.
Livak, K.J., and Schmittgen, T.D. 2001. Analysis of Relative Gene Expression Data Using RealTime Quantitative PCR and the 2−ΔΔCT Method. Methods 25(4): 402–408.
doi:10.1006/meth.2001.1262.
Lodhi, L., Ahi, J.D., Gupta, N., Pradhan, B.L., Sen, P., Ghosh, M., and Dey, K.K. 2024.
Exploring the structure and dynamics of soft and hard cuticle of Bombyx mori using
solid-state NMR techniques. Sci. Rep. 14(1): 22378. doi:10.1038/s41598-024-69984-2.
Lohman, B.K., Weber, J.N., and Bolnick, D.I. 2016. Evaluation of TagSeq, a reliable low-cost
alternative for RNAseq. Mol. Ecol. Resour. 16(6): 1315–1321. doi:10.1111/17550998.12529.
Lü, J., Nanda, S., Chen, S., Mei, Y., He, K., Qiu, B., Zhang, Y., Li, F., and Pan, H. 2022. A survey
on the off-target effects of insecticidal double-stranded RNA targeting the Hvβ´COPI
gene in the crop pest Henosepilachna vigintioctopunctata through RNA-seq. J. Integr.
Agric. 21(9): 2665–2674. doi:10.1016/j.jia.2022.07.015.
Lubawy, J., Chowański, S., Adamski, Z., and Słocińska, M. 2022. Mitochondria as a target and
central hub of energy division during cold stress in insects. Front. Zool. 19(1): 1.
doi:10.1186/s12983-021-00448-3.
McCambridge, W.F., Morris, M.J., and Edminster, C.B. 1982. Herbage Production Under
Ponderosa Pine Killed by the Mountain Pine Beetle in Colorado. USDA Forest Service,
Rocky Mountain Forest and Range Experiment Station.
McEwan, D.L., Weisman, A.S., and Hunter, C.P. 2012. Uptake of Extracellular Double-Stranded
RNA by SID-2. Mol. Cell 47(5): 746–754. doi:10.1016/j.molcel.2012.07.014.
Mock, K.E., Bentz, B.J., O’neill, E.M., Chong, J.P., Orwin, J., and Pfrender, M.E. 2007.
Landscape-scale genetic variation in a forest outbreak species, the mountain pine beetle
(Dendroctonus ponderosae). Mol. Ecol. 16(3): 553–568. doi:10.1111/j.1365294X.2006.03158.x.
Morris, J.L., Cottrell, S., Fettig, C.J., Hansen, W.D., Sherriff, R.L., Carter, V.A., Clear, J.L.,
Clement, J., DeRose, R.J., Hicke, J.A., Higuera, P.E., Mattor, K.M., Seddon, A.W.R.,
Seppä, H.T., Stednick, J.D., and Seybold, S.J. 2017. Managing bark beetle impacts on
ecosystems and society: priority questions to motivate future research. J. Appl. Ecol.
54(3): 750–760. doi:10.1111/1365-2664.12782.
Morris, J.L., Courtney Mustaphi, C.J., Carter, V.A., Watt, J., Derr, K., Pisaric, M.F.J., Anderson,
R.S., and Brunelle, A.R. 2015. Do bark beetle remains in lake sediments correspond to
severe outbreaks? A review of published and ongoing research. Quat. Int. 387: 72–86.
doi:10.1016/j.quaint.2014.03.022.

198

Murphy, K.A., Tabuloc, C.A., Cervantes, K.R., and Chiu, J.C. 2016. Ingestion of genetically
modified yeast symbiont reduces fitness of an insect pest via RNA interference. Sci. Rep.
6(1): 22587. doi:10.1038/srep22587.
Niu, X., Kassa, A., Hu, X., Robeson, J., McMahon, M., Richtman, N.M., Steimel, J.P., Kernodle,
B.M., Crane, V.C., Sandahl, G., Ritland, J.L., Presnail, J.K., Lu, A.L., and Wu, G. 2017.
Control of Western Corn Rootworm (Diabrotica virgifera virgifera) Reproduction
through Plant-Mediated RNA Interference. Sci. Rep. 7: 12591. doi:10.1038/s41598-01712638-3.
Paine, T.D., Raffa, K.F., and Harrington, T.C. 1997. Interactions among Scolytid bark beetles,
their associated fungi, and live host conifers. Annu. Rev. Entomol. 42(1): 179–206.
doi:10.1146/annurev.ento.42.1.179.
Pampolini, F., and Rieske, L.K. 2023. Foliar Application of dsRNA to Induce Gene Silencing in
Emerald Ash Borer: Systemic Distribution, Persistence, and Bioactivity. Forests 14(9):
1853. Multidisciplinary Digital Publishing Institute. doi:10.3390/f14091853.
Petek, M., Coll, A., Ferenc, R., Razinger, J., and Gruden, K. 2020. Validating the Potential of
Double-Stranded RNA Targeting Colorado Potato Beetle Mesh Gene in Laboratory and
Field Trials. Front. Plant Sci. 11: 1250. doi:10.3389/fpls.2020.01250.
Pettit, J.M., Voelker, S.L., DeRose, R.J., and Burton, J.I. 2020. Spruce beetle outbreak was not
driven by drought stress: Evidence from a tree-ring iso-demographic approach indicates
temperatures were more important. Glob. Change Biol. 26(10): 5829–5843.
doi:10.1111/gcb.15274.
Phatnani, H.P., and Greenleaf, A.L. 2006. Phosphorylation and functions of the RNA polymerase
II CTD. Genes Dev. 20: 2922-2936. doi:10.1101/gad.1477006.
Poreddy, S., Li, J., and Baldwin, I.T. 2017. Plant-mediated RNAi silences midgut-expressed
genes in congeneric Lepidopteran insects in nature. BMC Plant Biol. 17(1): 199.
doi:10.1186/s12870-017-1149-5.
Raffa, K.F., Aukema, B.H., Bentz, B.J., Carroll, A.L., Hicke, J.A., Turner, M.G., and Romme,
W.H. 2008. Cross-scale Drivers of Natural Disturbances Prone to Anthropogenic
Amplification: The Dynamics of Bark Beetle Eruptions. BioScience 58(6): 501–517.
doi:10.1641/B580607.
Rangasamy, M., and Siegfried, B.D. 2012. Validation of RNA interference in western corn
rootworm Diabrotica virgifera virgifera LeConte (Coleoptera: Chrysomelidae) adults.
Pest Manag. Sci. 68(4): 587–591. doi:10.1002/ps.2301.
Reaume, C.J., and Sokolowski, M.B. 2011. Conservation of gene function in behaviour. Philos.
Trans. R. Soc. B Biol. Sci. 366(1574): 2100–2110. doi:10.1098/rstb.2011.0028.

199

Reed, D.E., Ewers, B.E., Pendall, E., Frank, J., and Kelly, R. 2018. Bark beetle-induced tree
mortality alters stand energy budgets due to water budget changes. Theor. Appl. Climatol.
131(1–2): 153–165. Springer Nature. doi:10.1007/s00704-016-1965-9.
Reinders, J.D., Moar, W.J., Head, G.P., Hassan, S., and Meinke, L.J. 2023. Effects of
SmartStax® and SmartStax® PRO maize on western corn rootworm (Diabrotica
virgifera virgifera LeConte) larval feeding injury and adult life history parameters. PLOS
ONE 18(7): e0288372. doi:10.1371/journal.pone.0288372.
Rieu, I., and Powers, S.J. 2009. Real-Time Quantitative RT-PCR: Design, Calculations, and
Statistics. Plant Cell 21(4): 1031–1033. doi:10.1105/tpc.109.066001.
Ritchie, M.E., Phipson, B., Wu, D., Hu, Y., Law, C.W., Shi, W., and Smyth, G.K. 2015. limma
powers differential expression analyses for RNA-sequencing and microarray studies.
Nucleic Acids Res. 43(7): e47. doi:10.1093/nar/gkv007.
Robert, J.A., Bonnett, T., Pitt, C., Spooner, L.J., Fraser, J., Yuen, M.M.S., Keeling, C.I.,
Bohlmann, J., and Huber, D.P.W. 2016. Gene expression analysis of overwintering
mountain pine beetle larvae suggests multiple systems involved in overwintering stress,
cold hardiness, and preparation for spring development. PeerJ 4: e2109.
doi:10.7717/peerj.2109.
Robert, J.A., Pitt, C., Bonnett, T.R., Yuen, M.M.S., Keeling, C.I., Bohlmann, J., and Huber,
D.P.W. 2013. Disentangling Detoxification: Gene Expression Analysis of Feeding
Mountain Pine Beetle Illuminates Molecular-Level Host Chemical Defense
Detoxification Mechanisms. PLOS ONE 8(11): e77777. Public Library of Science.
doi:10.1371/journal.pone.0077777.
Robinson, M.D., McCarthy, D.J., and Smyth, G.K. 2010. edgeR : a Bioconductor package for
differential expression analysis of digital gene expression data. Bioinformatics 26(1):
139–140. doi:10.1093/bioinformatics/btp616.
Rodrigues, T.B., Duan, J.J., Palli, S.R., and Rieske, L.K. 2018. Identification of highly effective
target genes for RNAi-mediated control of emerald ash borer, Agrilus planipennis. Sci.
Rep. 8(1): 5020. doi:10.1038/s41598-018-23216-6.
Rodrigues, T.B., Mishra, S.K., Sridharan, K., Barnes, E.R., Alyokhin, A., Tuttle, R.,
Kokulapalan, W., Garby, D., Skizim, N.J., Tang, Y., Manley, B., Aulisa, L., Flannagan,
R.D., Cobb, C., and Narva, K.E. 2021. First Sprayable Double-Stranded RNA-Based
Biopesticide Product Targets Proteasome Subunit Beta Type-5 in Colorado Potato Beetle
(Leptinotarsa decemlineata). Front. Plant Sci. 12: 728652. doi:10.3389/fpls.2021.728652.
Rosenberger, D.W., Venette, R.C., and Aukema, B.H. 2016. Sexing live mountain pine beetles
Dendroctonus ponderosae: refinement of a behavioral method for Dendroctonus spp.
Entomol. Exp. Appl. 160(2): 195–199. doi:10.1111/eea.12463.

200

Safranyik, L. 1998. Mortality of mountain pine beetle larvae, Dendroctonus ponderosae
(Coleoptera: Scolytidae) in logs of lodgepole pine (Pinus contorta var. latifolia) at
constant low temperatures. J. Entomol. Soc. Br. Columbia 95: 81–88.
Saleh, M.-C., Van Rij, R.P., Hekele, A., Gillis, A., Foley, E., O’Farrell, P.H., and Andino, R.
2006. The endocytic pathway mediates cell entry of dsRNA to induce RNAi silencing.
Nat. Cell Biol. 8(8): 793–802. doi:10.1038/ncb1439.
Samarasekera, G.D.N., Bartell, N.V., Lindgren, B.S., Cooke, J.E.K., Davis, C.S., James, P.M.A.,
Coltman, D.W., Mock, K.E., and Murray, B.W. 2012. Spatial genetic structure of the
mountain pine beetle ( Dendroctonus ponderosae ) outbreak in western Canada: historical
patterns and contemporary dispersal. Mol. Ecol. 21(12): 2931–2948. doi:10.1111/j.1365294X.2012.05587.x.
Schüller, R. 2013. Insights into the RNA Polymerase II CTD code. Helmholtz Center Munich
German Research Center for Environment and Health (GmbH) Institute for Clinical
Molecular Biology and Tumor Genetics Department of Molecular Epigenetics. 135.
Available from https://edoc.ub.uni-muenchen.de/16565/1/Schueller_Roland.pdf
[accessed February 27 2025].
Shegelski, V.A., Campbell, E.O., Thompson, K.M., Whitehouse, C.M., and Sperling, F.A.H.
2021. Source and spread dynamics of mountain pine beetle in central Alberta, Canada.
Can. Entomol. 153(3): 314–326. doi:10.4039/tce.2020.83.
Silva, G.M., and Vogel, C. 2016. Quantifying gene expression: the importance of being subtle.
Mol. Syst. Biol. 12(10): 885. doi:10.15252/msb.20167325.
Simard, M., Romme, W.H., Griffin, J.M., and Turner, M.G. 2011. Do mountain pine beetle
outbreaks change the probability of active crown fire in lodgepole pine forests? Ecol.
Monogr. 81(1): 3–24. doi:10.1890/10-1176.1.
Singh, I.K., Singh, S., Mogilicherla, K., Shukla, J.N., and Palli, S.R. 2017. Comparative analysis
of double-stranded RNA degradation and processing in insects. Sci. Rep. 7(1): 17059.
Nature Publishing Group. doi:10.1038/s41598-017-17134-2.
Sørensen, J.G., Addison, M.F., and Terblanche, J.S. 2012. Mass-rearing of insects for pest
management: Challenges, synergies and advances from evolutionary physiology. Crop
Prot. 38: 87–94. doi:10.1016/j.cropro.2012.03.023.
Stewart, A.T.M., Mysore, K., Njoroge, T.M., Winter, N., Feng, R.S., Singh, S., James, L.D.,
Singkhaimuk, P., Sun, L., Mohammed, A., Oxley, J.D., Duckham, C., Ponlawat, A.,
Severson, D.W., and Duman-Scheel, M. 2023. Demonstration of RNAi Yeast Insecticide
Activity in Semi-Field Larvicide and Attractive Targeted Sugar Bait Trials Conducted on
Aedes and Culex Mosquitoes. Insects 14(12): 950. doi:10.3390/insects14120950.
Sun, Y., Fu, D., Kang, X., Liu, B., Ning, H., and Chen, H. 2021. Function of mevalonate pathway
genes in the synthesis of frontalin in Chinese white pine beetle, Dendroctonus armandi
201

(curculionidae: Scolytinae). Arch. Insect Biochem. Physiol. 107(4): e21828.
doi:10.1002/arch.21828.
Tamaki, S., Takemoto, S., Uryu, O., Kamae, Y., and Tomioka, K. 2013. Opsins are involved in
nymphal photoperiodic responses in the cricket Modicogryllus siamensis. Physiol.
Entomol. 38(2): 163–172. doi:10.1111/phen.12015.
Taylor, S.C., Laperriere, G., and Germain, H. 2017. Droplet Digital PCR versus qPCR for gene
expression analysis with low abundant targets: from variable nonsense to publication
quality data. Sci. Rep. 7(1): 2409. Nature Publishing Group. doi:10.1038/s41598-01702217-x.
Taylor, S.P., Wilson, I.M., and White, K.J. 1997. Topical application of carbon dioxide and liquid
nitrogen against the mountain pine beetle, Dendroctonus ponderosae (Coleoptera:
Scolytidae).
Tehrani, S.D., Shojaei, S.R., Hosseini, S.R., and Shayan, P. 2024. Investigating Differential
Expression Genes Profile in Hct-8 Cell Line Infected with Cryptosporidium Parvum in
Host-Parasite Interactions. Bulg. J. Vet. Med. 27(3): 475–488. Trakia University.
doi:10.15547/bjvm.2022-0089.
Terenius, O., Papanicolaou, A., Garbutt, J.S., Eleftherianos, I., Huvenne, H., Kanginakudru, S.,
Albrechtsen, M., An, C., Aymeric, J.-L., Barthel, A., Bebas, P., Bitra, K., Bravo, A.,
Chevalier, F., Collinge, D.P., Crava, C.M., De Maagd, R.A., Duvic, B., Erlandson, M.,
Faye, I., Felföldi, G., Fujiwara, H., Futahashi, R., Gandhe, A.S., Gatehouse, H.S.,
Gatehouse, L.N., Giebultowicz, J.M., Gómez, I., Grimmelikhuijzen, C.J.P., Groot, A.T.,
Hauser, F., Heckel, D.G., Hegedus, D.D., Hrycaj, S., Huang, L., Hull, J.J., Iatrou, K., Iga,
M., Kanost, M.R., Kotwica, J., Li, C., Li, J., Liu, J., Lundmark, M., Matsumoto, S.,
Meyering-Vos, M., Millichap, P.J., Monteiro, A., Mrinal, N., Niimi, T., Nowara, D.,
Ohnishi, A., Oostra, V., Ozaki, K., Papakonstantinou, M., Popadic, A., Rajam, M.V.,
Saenko, S., Simpson, R.M., Soberón, M., Strand, M.R., Tomita, S., Toprak, U., Wang, P.,
Wee, C.W., Whyard, S., Zhang, W., Nagaraju, J., ffrench-Constant, R.H., Herrero, S.,
Gordon, K., Swevers, L., and Smagghe, G. 2011. RNA interference in Lepidoptera: An
overview of successful and unsuccessful studies and implications for experimental
design. J. Insect Physiol. 57(2): 231–245. doi:10.1016/j.jinsphys.2010.11.006.
Thompson, K.M., Huber, D.P.W., and Murray, B.W. 2020. Autumn shifts in cold tolerance
metabolites in overwintering adult mountain pine beetles. PLOS ONE 15(1): e0227203.
doi:10.1371/journal.pone.0227203.
Tittiger, C., Keeling, C.I., Blomquist, G.J. 2005. Some insights into the remarkable metabolism
of the bark beetle midgut. In Chemical Ecology and Phytochemistry of Forest
Ecosystems. Romeo, J.T., editor c2005, 38. Oxford, UK: Elsevier. p. 57-78.
Trevoy, S.A.L., Janes, J.K., Muirhead, K., and Sperling, F.A.H. 2019. Repurposing population
genetics data to discern genomic architecture: A case study of linkage cohort detection in

202

mountain pine beetle (Dendroctonus ponderosae). Ecol. Evol. 9(3): 1147–1159.
doi:10.1002/ece3.4803.
Turner, C.T., Davy, M.W., MacDiarmid, R.M., Plummer, K.M., Birch, N.P., and Newcomb, R.D.
2006. RNA interference in the light brown apple moth, Epiphyas postvittana (Walker)
induced by double-stranded RNA feeding. Insect Mol. Biol. 15(3): 383–391.
doi:10.1111/j.1365-2583.2006.00656.x.
Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., and Speleman,
F. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric
averaging of multiple internal control genes. Genome Biol. 3(7): research0034.1research0034.11.
Vélez, A.M., Khajuria, C., Wang, H., Narva, K.E., and Siegfried, B.D. 2016. Knockdown of
RNA Interference Pathway Genes in Western Corn Rootworms (Diabrotica virgifera
virgifera Le Conte) Demonstrates a Possible Mechanism of Resistance to Lethal dsRNA.
PLOS ONE 11(6): e0157520. doi:10.1371/journal.pone.0157520.
Verhagen, A.M., Coulson, E.J., and Vaux, D.L. (2001). Inhibitor of apoptosis proteins and their
relatives: IAPs and other BIRPs. Genome Biology 2(7): 1-10. doi:10.1186/gb-2001-2-7reviews3009.
Wallace, M., and Rieske, L.K. 2023. Ingestion of Species-Specific dsRNA Alters Gene
Expression and Can Cause Mortality in the Forest Pest, Ips calligraphus. Forests 14(2):
422. doi:10.3390/f14020422.
Wang, J., Zhang, R.-R., Gao, G.-Q., Ma, M.-Y., and Chen, H. 2016. Cold tolerance and silencing
of three cold-tolerance genes of overwintering Chinese white pine larvae. Sci. Rep. 6(1):
34698. doi:10.1038/srep34698.
Wangen, C.E., Powell, J.A., and Bentz, B.J. 2024. A mountain pine beetle (Coleoptera:
Curculionidae) adult development rate model confirms evolved geographic differences. J.
Insect Sci. 24(4): 16. doi:10.1093/jisesa/ieae074.
Wei, Q., Khan, I.K., Ding, Z., Yerneni, S., and Kihara, D. 2017. NaviGO: interactive tool for
visualization and functional similarity and coherence analysis with gene ontology. BMC
Bioinformatics 18(1): 177. doi:10.1186/s12859-017-1600-5.
Whitney, H.S., and Spanier, O.J. 1982. An improved method for rearing axenic mountain pine
beetles, Dendroctonus ponderosae (Coleoptera: Scolytidae). Can. Entomol. 114(11):
1095–1100. doi:10.4039/Ent1141095-11.
Whyard, S., Singh, A.D., and Wong, S. 2009. Ingested double-stranded RNAs can act as speciesspecific insecticides. Insect Biochem. Mol. Biol. 39(11): 824–832.
doi:10.1016/j.ibmb.2009.09.007.
Wickham, H. 2016. ggplot2: Elegant Graphics for Data Analysis. Springer-Verlag New York.
203

Winston, W.M., Sutherlin, M., Wright, A.J., Feinberg, E.H., and Hunter, C.P. 2007.
Caenorhabditis elegans SID-2 is required for environmental RNA interference. Proc.
Natl. Acad. Sci. 104(25): 10565–10570. doi:10.1073/pnas.0611282104.
Wittische, J., Janes, J.K., and James, P.M.A. 2019. Modelling landscape genetic connectivity of
the mountain pine beetle in western Canada. Can. J. For. Res. 49(11): 1339–1348.
doi:10.1139/cjfr-2018-0417.
Wood, S.L. 1963. A Revision of the Bark Beetle Genus Dendroctonus Erichson (Coleoptera:
Scolytidae). Gt. Basin Nat. 23(1/2): 1–117. Monte L. Bean Life Science Museum,
Brigham Young University.
Xin, Z., Cai, Y., Dang, L.T., Burke, H.M.S., Revote, J., Charitakis, N., Bienroth, D., Nim, H.T.,
Li, Y.-F., and Ramialison, M. 2022. MonaGO: a novel gene ontology enrichment analysis
visualisation system. BMC Bioinformatics 23(1): 1–16. BioMed Central.
doi:10.1186/s12859-022-04594-1.
Xu, C., Tang, H.-W., Hung, R.-J., Hu, Y., Ni, X., Housden, B.E., and Perrimon, N. 2019. The
Septate Junction Protein Tsp2A Restricts Intestinal Stem Cell Activity via Endocytic
Regulation of aPKC and Hippo Signaling. Cell Rep. 26(3): 670-688.e6.
doi:10.1016/j.celrep.2018.12.079.
Yoon, J.-S., Mogilicherla, K., Gurusamy, D., Chen, X., Chereddy, S.C.R.R., and Palli, S.R. 2018.
Double-stranded RNA binding protein, Staufen, is required for the initiation of RNAi in
Coleopteran insects. Proc. Natl. Acad. Sci. 115(33): 8334–8339.
doi:10.1073/pnas.1809381115.
Yoon, J.-S., Shukla, J.N., Gong, Z.J., Mogilicherla, K., and Palli, S.R. 2016. RNA interference in
the Colorado potato beetle, Leptinotarsa decemlineata: Identification of key contributors.
Insect Biochem. Mol. Biol. 78: 78–88. doi:10.1016/j.ibmb.2016.09.002.
Zawadzki, J.L., Kotze, A.C., Fritz, J.-A., Johnson, N.M., Hemsworth, J.E., Hines, B.M., and
Behm, C.A. 2012. Silencing of essential genes by RNA interference in Haemonchus
contortus. Parasitology 139(5): 613–629. doi:10.1017/S0031182012000121.
Zhang, R., Gao, G., and Chen, H. 2016. Silencing of the olfactory co-receptor gene in
Dendroctonus armandi leads to EAG response declining to major host volatiles. Sci. Rep.
6(1): 23136. doi:10.1038/srep23136.
Zhao, C., Alvarez Gonzales, M.A., Poland, T.M., and Mittapalli, O. 2015. Core RNAi machinery
and gene knockdown in the emerald ash borer (Agrilus planipennis). J. Insect Physiol. 72:
70–78. doi:10.1016/j.jinsphys.2014.12.002.
Zhao, S., Liu, H., Wu, Y., Wu, P., Fu, J., Yang, H., James, A.A., Chen, X. 2024. The odorantbinding protein genes obp67 and obp56d-like encode products that guide oviposition site
selection in the Asian tiger mosquito, Aedes albopictus. Insect Sci. 0: 1-13.
doi:10.1111/1744-7917.13430.
204

Zhu, F., Xu, J., Palli, R., Ferguson, J., and Palli, S.R. 2011. Ingested RNA interference for
managing the populations of the Colorado potato beetle, Leptinotarsa decemlineata. Pest
Manag. Sci. 67(2): 175–182. doi:10.1002/ps.2048.
Zhu, K.Y., and Palli, S.R. 2020. Mechanisms, Applications, and Challenges of Insect RNA
Interference. Annu. Rev. Entomol. 65(1): 293–311. doi:10.1146/annurev-ento-011019025224.
Zimmermann, G. 2007. Review on safety of the entomopathogenic fungi Beauveria bassiana
and Beauveria brongniartii. Biocontrol Sci. Technol. 17(6): 553–596.
doi:10.1080/09583150701309006.
Zmienko, A., Samelak-Czajka, A., Goralski, M., Sobieszczuk-Nowicka, E., Kozlowski, P., and
Figlerowicz, M. 2015. Selection of Reference Genes for qPCR- and ddPCR-Based
Analyses of Gene Expression in Senescing Barley Leaves. PLOS ONE 10(2): e0118226.
doi:10.1371/journal.pone.0118226.

205

Appendix
Chapter 2
Table S1 Protein-coding sequences and accession numbers of gene targets in mountain pine beetle
(Dendroctonus ponderosae). Long dsRNA sequence is highlighted in yellow. Digital droplet PCR
(ddPCR) primers (highlighted in green) were designed outside of the dsRNA region to avoid inclusion of
the dsRNA in the gene quantification.
iap - XM_019910372.1
ATGAGTAGTACAGTTGTAAAACAAGTAATTTTGGCAAAGAGCAAAAACTTTCCCAAAAGAAACCTG
TTAACAGCCAATGGGCTGGAGTACCTAAGCGAGACAGACAACAGCAATAAAGCTCCATTGGCCTTA
TTGGAGGCATCTTCCTCACAGCCCGACTACAAGTCCTATCCGGGTAGATTGCGGACATTCGCAAATT
GGCCAAACCGAGAGATCGCCAAGGAGGTGCTGGCAAAGGCTGGATTCTATTACAAAAATGAAAGT
GATATTGTCCAGTGTGCGTACTGCTATATAGAGGGGTACCATTGGGTGGCAGGAGACGATCCTCTG
AAAGATCATCGGACTTGGAGCCCAGCTTGTCCCTTTGTAATGAATTCGGTTGAGCCCAGTTCGAGTA
GTAGTAGTAGTAGTAGTAGTAGTAGTACTACTAATAGTCGTTCGCGTGCTGCTGACACCTGTGGCTT
GTACGGGGTAGAAATCCTGCCAAATTCAGTGCCCGAAGACGAAATCCATTTAGAAAGATTAGGCAT
TCACAAAAACAAAGGTCCCGCTCATCCAGATAAATTTTCATTTGAAGCCCGACGGGCTACATTTGGC
ACATGGCCAAAGAGCATGAAACAGACCCCCCAAGAGTTGGCCGACGCTGGATTTTACTATCTCGGC
ACTGGGGATCAAACGATTTGCTTTCACTGTGGTGGCGGCTTGAAAGACTGGGAACAGAACGACAGC
CCTTGGGAGCAGCACGCCCTTTGGTTCCCCAAGTGTTCCTACGTGTATCTGATGAAAGGGCCCGAAT
ACATTCAGGAAGTTAAGGATAAGCGAAACCCACGACCTTCGGCCAGTTCTTCGGAGTCCGAAACCA
AAGAAAGTGCGAAAGAGGCAAAAGCCGAAGAAGCTGTTGCTGCTTCTAGTGCCGATGAAGAGAAA
GACAAAACAGGCGAAGAGAAGACCCTTTGTAAAATCTGTTACAAGAACGAAGTGGGTGTAGTTTTT
TTGCCTTGTGGACACGTTGTTGCCTGTGTAGAGTGTTCTTCCACTCTAAAAAATTGCGCAATTTGTCG
GAAACCCTTAGAAGCCACGGTCCGAGCGTTCCTATCATAG

hsp - XM_019906797.2
ATGAAATTACATCTTGCTTTGGGGGCGTTGTGCCTCATTGCCAGCGTCCTGGCGAAAGAGGACAAA
AAGGATGGAAAGGACGAGGTTGGCACTGTAATTGGCATCGATTTGGGAACCACGTACTCCTGCGTG
GGCGTGTACAAGAACGGCAGAGTGGAGATAATCGCCAACGACCAGGGTAACCGTATCACCCCTTCA
TATGTGGCCTTCACAGCTGATGGTGAGCGTCTGATTGGAGACGCTGCCAAGAATCAACTTACCACCA
ATCCAGAGAACACCGTCTTCGACGCTAAGCGTCTGATCGGGCGCGACTGGAGCGATGCCACTGTTC
AACACGATGTGAAATTCTTCCCATTCAAGGTGATTGAGAAGAGCAGCAAGCCCCACATCAAGGTAG
ACACCAGCCAGGGTGAGAAGGTTTTCGCTCCTGAGGAGATTTCCGCGATGGTTTTGACCAAAATGA
AGGAAACTGCCGAGGCTTACTTGGGCAAAAAGGTCACACATGCTGTTGTAACAGTGCCTGCTTATTT
CAACGACGCTCAGCGTCAGGCTACTAAAGACGCCGGTATCATTGCTGGTATGACCGTAATGAGAAT
CATCAACGAGCCCACCGCTGCCGCAATTGCCTACGGCCTGGACAAGAAAGAAGGCGAAAAGAACG
TATTGGTCTTCGATTTGGGCGGTGGTACCTTCGATGTGTCTCTTCTTACCATCGACAACGGGGTGTTC
GAAGTGGTGGCAACTAACGGAGACACGCACTTGGGAGGTGAAGATTTCGATCAGCGAGTGATGGA
CCACTTCATCAAGCTCTACAAGAAGAAGAAGGGCAAGGACATCAGAAAAGACAACAGAGCCGTAC
AGAAGTTGAGACGCGAAGTTGAGAAGGCCAAGAGAGCGCTATCGGCCAGCCATCAAGTCAGGATT
GAAATTGAAAGCTTCTTCGAGGGCGAGGACTTCTCGGAAACGTTAACGCGGGCGAAATTTGAGGAA
TTGAACATGGACTTGTTCAGGTCCACCTTGAAGCCAGTCCAGAAGGTATTGGAAGACGCCGACATG
AACAAAAAGAGTGTGGACGAAATCGTGCTGGTGGGCGGCTCAACCCGTATCCCCAAAGTGCAGCAA
CTGGTCAAAGAATTCTTCGGTGGCAAAGAACCGTCCAGAGGCATCAACCCCGATGAGGCAGTGGCG
TACGGGGCTGCCGTGCAAGCTGGAGTTCTCAGTGGCGAACAGGACACTGATGCCATCGTTTTGTTGG
ACGTCAATCCTCTAACTATGGGCATTGAGACTGTTGGAGGCGTCATGACCAAGCTTATCCCGAGAA
ACACCGTCATCCCGACCAAGAAATCTCAGATATTCAGTACTGCCTCTGACAATCAGCACACTGTTAC
CATTCAGGTATACGAGGGTGAACGTCCCATGACCAAAGACAACCATCTCCTGGGCAAGTTTGACCT
CACCGGAATCCCACCAGCACCCAGAGGAGTTCCTCAAATTGAAGTCACTTTCGAAATCGATGCCAA
CGGCATTCTTCAAGTATCGGCCGAAGACAAGGGAACCGGAAACCGAGAGAAAATCGTCATCACCA
ACGACCAAAACAGGCTCACACCCGATGACATCGACAGGATGATTCACGATGCTGAAAAATTCGCCG
ACGAAGACAAAAAGCTCAAAGAGAGAGTCGAGGCAAGGAACGAACTAGAAAGTTACGCGTATTCG

206

CTGAAGAACCAATTGGCCGACAAGGACAAACTAGGCGCCAAGTTGAGCGATGACGAGAAGACCAA
GATGGAAGAAGCCATCGATGAGAAGATCAAGTGGCTGGAAGAGAATCAAGACACCGATGCTGAAG
ACTACAAGAAACAGAAGAAGGAGCTCGAAGACGTCGTCCAGCCCATCATCGCTAAGCTCTATCAGT
CCTCAGGCGGTGCACCGCCTGCGACGTCGGGTGAAGACGACGACGACCTCAAGGATGAACTTTAA

vha19 - XM_019903780.2
ATGTGTTTATCTTACTGCAGAACTACATCGATTCCTGTAACATATTCAGTCTCTAACCAGAGTGATGT
TATCACTCTAACTGGAGTTAATGGCACTACATTCCAGGTCATTTTTCAATTTACCAAATCCGGCAAC
TCTTATTGGTATCTACAGGATATACATTTGACGGTAAATAATACCTCATTCAATCAAACAACCAACG
GAACTATTTATGCCCCATTGGGATTCTCTTACGCGTGTGGCAATCAAGTTTTCAAATCTACAAATCT
AGCTGTTACATTCCCACAATTCCAAGTTCAACCAACGTCCTACAGATCGACTCCCAGGACCAGGTCA
TCTAAATTTGATGATCCTTATAATTGTGTTGGTTTTACCACTATTCCAATTTGGTCTGGGCTTTTCGTA
ACCTTTATTTTGTTACTGATTATGACCTTTGGAATAACAATGATGATGGATATCAAAACCATGGACA
GATTTGATGATGCCAAAGGCAAAACAATTACTATTAACACTTCCGAATAA

tsp2a - XM_048663791.1
ATGGCCGGCAAAGGGGATGGAGAAGGCGAAGGAAGTATTCTAAAGCTAGAGAACCAGATTGCGGT
CTTGAAATATGTGCTACTGTTTACCAATGTGTTGGAATGGATTATTGGAGCAGCCATTTTCGCTCTGT
GTTTATGGCTGAGGTTCGAGCCAGGAATCAATGAATGGCTAACTATTCTCAATGCTAGCAACTTCTA
CATTGGGATCTACATTTTAGTTATTGTGGCCGCTATTATTATGGTGGTTTCCTTTTTGGGCTGCTTGA
GCTCGCTGCAGGAAAACGCGACGATTATTCTCGGGTACATTGGATCTCAAGTTCTGGCGTTCATTAT
CCTGCTGGCTGGATCAGCAGTGCTTTTGGATAACAGCGCAAGAGATTCCAGCTTCCAACCCCGAGTA
CGTGAAAGTATGCGGATACTGATTATGAATTCACAGTACGACGATGCCCGAAACACTCTTGCCATG
ATCCAGGAAGGTATTGCTTGCTGCGGAGCCGATGGTCCAGGCGACTACTTAACTTTGCAACAGCCA
ATTCCCACGGAATGTCGAGACACTGTTACCGGAAATCCATTTTTCCATGGATGCGTGGATGAATTAA
CCTGGTTCTTTGAAGCCAAATGCGCCTGGATTGCCGCCTTGGCCATGCTCGTCGCCTTTATTACGGTT
ATGAATGTGGTCGTTTCTATTGTCCTCATCCAAGCACTGAGGAAAGAAGAAGAACAAGCTGACACC
TACCGGAAGTAG

mesh - XM_048661387.1
ATGGAACTCAGATTTTTGTTAGGGGTAGTTCTTTTAGTGTTGTGCGCTAGTACATTGGGACAAGAAG
ATAATGCAGAAAACACAAATTCGGACAGTGATGTAGAAGCGGTGCCTGGTGTGCTTGCAGACGCAG
GTGATTCTGATGGTCAGCCTGTACCTGCGGAAGGTGATCCTGGAACTGGAGGTGACCAAGGAACAG
ATACAAATGTCGATCCCAACTATGATGAATCTGTAGATCCTCCCGTTCCTATTCCTGAAAATAGCGA
GTCTAACGATTCAGAGAATGCGGCAGAAGTAGGCGAAGGCGAGGCCGCTCCTGTAGACGACTCTTC
ATTACACACGGGGCAAAAAGTTCTTCGTATGGGCCAATATGTCATTTATTATGACGCTGATTACGAT
CCAATGACCTCACATGTTGCCCCACAAGATACTGACCAAAGAGGAGGATCCGGTACTCCATACACC
CTAACGGAAAGTCGTTTGGCTACCATCAGAAACCTCTTTATGTATCCTTTCTACAACCAAGGGGGAA
ACGTTGATAATGAGGGAGATTACCAAAAGGAGATTCAAGTCTCTTCACCTCAGGTACACAAGAATT
TGAACTTCCAACTGCCATTCTTCGGCTTCAGATTCAACTACACCAGAGTATCGCTAAATGGTTATTT
GGAGTTCAGCGATCCGCCACCAAACTACGAATATCCTTTGGTATTTCCCGTCAGGGATTGGCCGAAG
AGAAACGATCCGTCTTTCATTGGAATCTTCTTCAGCAAATGCAGGATCGGAAACCTTAGGGACGAC
GATCAAGATCAACGCAACCCAGGAGTGTATTTCCGCATGGAAAGGGACTTGCTGACCAGAACTGAC
CAGATGGGAGTCGAAATACGCGAGAGACTCAAGTGGGATATTCGCGAAGGAGTAATTGGTGCTGA
GGCGTTTGAACCCAAACATGCCATTATTGTGACCTGGAAGAACATTTCGTTCAATGGCGGCTTTGCC
AATGCATTGTTCCAGACCAACACATTCCAAATGGTTCTGGCCACTGATGAAGTTTACACCTATGCAA
TGTTCAACTATCTGGATATTTCCTGGACGAGTCACACTGAAGCTGGAGGAGACACGCGAAAAGGAG
AAGGAGGAGTTCCAGCTTATGTGGGATTCAATGCCGGTAACGGCACAAGAAGTTGGGAGTACAGCC
CATACAGTCAGGCCTCTGTAATTCGGGATTTATCTGGACGAGGTTACGCGAACGGGTTCCCTGGAAG
GCATTTGTTCAGGATCGATGAAAATATTCTAGTAGGAACATGCAATAAAGACATAGATGGTGCAAA
TTTGCCGCTAATGTTCGCTCCTGAATCGGGCAACATGTTGGGAGGTACAGTGGTGAACATTACTGGG
CCATGTTTCAACCCTACCGATCAGGTGATTTGCAAATTCGATGTAGCTGACGTGGTTTATGGTACTG
TGGTGAGCAGGAACAGGGCCATTTGCATCCAGCCTCCTCTTATGGTCGAGGGTTATGTGAGGTTTGA
AATTGCAATTGGACCAGGAGTTTACAAGTGGAAAGGCCAGTACTATGTGGAAACACCAGCTAGTGC
TGCACAGAAAATCTACTTCAAAGACATGAAAGTGCACGATAAAGCTCCTAGTGAGATCAAGATTAC
CTGGGAGAAGTACAATTTGACTGCAAATGATGCCGCCAACATCAGGATTTCTTTATGGGGTTATCGG
GAGACCACAATACGTCCAACTCTTCTGTATATCACAGATATCGCAGAAAACGTGCAGAATACTGGA
GAGTACACCATCACACCTTCGCAATATAGGAACAGAGAAAACACCTTTTTAACCGATTTACAGTTTG

207

GCTTCCTCCAAATCAATCTAACTGAATCGATTCCTGTTCAACCTGATTACAGTGGCACTGGTTCTTCT
TCTACCACCACTAATACAGCGGTTACCATCACTCCGGTAGTCTGGAGCAGACCAATTCCTCTTGGAT
GGTATTTCAACTGGCAGTGGGAGCGAATGTACGGGACAAACTGGCCTCGAATTCTGTGTGATGATT
GGCTGAGAACCGACAGATATCTGAAGAATTTCGCTCACGAACTACCTCAATGTCCGTGCACTTTAGA
ACAGGCCTTGATTGATAAAGGGAAATATATGCCCGATTTCGATTGCGATAAGGATTCCAATCCGACT
TGCTACTACAACAATCAGGCCGTTCATTGTGTAAGAACCGGATCACCCACACTGGAAGGATCAGAG
CAACAATGCTGCTACGACAAAAACCACTACCTGATGTTGTCCTACGATCAGCAATGGGGTTCCAGC
CCCAAACGATGCCACAATCTCGGCCTGATGCCCTACCAGGAAGCCACCAAAGTGCCCACCTTATCC
CAATGGTTCAACGATATGGTACCCAAATATTTGTGCTGTTTATGGCAAGAAGAGCAAGCGGTTGGG
TGCGAAACGGTTCGATTCGAGCGAAGACCCAGCCAGGATTGTGTGGCCTACCAAGCTCCAGGTATT
GCTGGAATTTACGGCGATCCTCACATTGTCACCTTCGACGATCTGGATTATACGTTCAATGGAAAAG
GGGAGTTCGTACTGGTCAAATCCAAAACGAAATTGAACAACATTGAGGTGCAAGGGCGCTTTGAGC
AAATGGATCCCAATCTCTACGGAGAGGTGCGGGCGACTCAACTGACATCGGTGGTTGCAAGGGGTA
ATACTTCCACAGTGGTGGAGGTGAGAAGAAGACCGGAATATGCCAGATGGAGATATAGACTGGAC
GTGATTGCAGACGGCAAAAGAGTATATTTCGATAGACCTTCTTTGAAGTTCCAACATTTCCCAGGCG
TTACTGTTTACACTCCTACATATATTTTGAACCAATCTGAAGTTATCATGATGTTCGACAATGGTGTC
GGTGTGGAGGTACTTGACAATAATGGTTACATGACAGCCAGAGTATTTCTACCATGGTCCTTCATCA
ACAAGACGGCCGGATTGTTGGGCAATTGGAGTTTCAACAAGGAGGACGACTTTACTCTCCCCGATG
GACAAAGAGTCAGTGTTGTTACCAATGTAAATGGCATGGAACGAGTTTACACTCAATTCGGATTGCT
ATGGATGGTGAATGATGTCCTGGACGCTGATAGAGGTAGATCACTGTTCCTGCGAGAAAACGGCCA
GACTTCCTCCAACTATAATAACCGCTCTTTCGTGCCAATATTCCCGATGACTCCGGAAGAAATCATT
CCGGCAAACCGGTCCAATTTGATCCAAAGAACTCACGAAATCTGCAGTACCCAGATGTACGAGTGC
TACTACGATTATGCGATGACTTTGAACAGAGACTTGGCTCATTACACGCAAAACTACAAAACCACG
ATATATAAATACAAGGGAATTTCTCGAACAAAGGTCGTTTCTTGTGGTATTATGCCAACGCCCCGAT
TTGGCCGAAAAAGTACATTTTTGTTCATACCCGGTACCAGAGTAACATTTGAATGCGAGCAGAACTT
TGTGCTGATTGGAGACAATCGAAGAACTTGCGGAAGTGATGGACAGTGGGACATTCCCGAATATGG
CTACACCCACTGCTTGCGACAACAGGAATATTCACAAAGGCAGCTCGCAGTTGCTTCCGGAATCATT
TTCGTGGTCATGATTCCATTGATCCTGCTATTCCTTTACCTGGCTTACATGATGCTTAAGAAGAGACA
AAAAGAGCAAGAAGAGGAGCAAATGCTTAACAGCAGTTACGAAGAACAGAAAAGGAAAGCTCAA
GAGGCTGCAGCTAAAAAGCTAACAGAATCTAATGACTACGATGATGAAGATGAAGTGACTAGCAA
CGTGACGAGTACTGCGTCTCCTTCCTCTCCAGTTCCCCAAATACAAAATAATAACACCACAGCTCCT
TCGTCACCATCAAAGAAAGAATCGGATATATTTTAA

ssk - XM_048663913.1
ATGGCCTTAGAGACGATAGCCTCCATTATAGTTAAACTAGTGAAGCTGGTATTGAACTTTATCATCC
TGGTTCTCTATCGCGTGGGCTTCGCTGGCGACTTCTTGGGAGTCGGAGGAACATGGAACTTGTTCGA
GGAGAAGAGCTCAGACGTGGAAATTATCGCCTCAGGAGTCTTTGTGGGGTATTTCGTCTACACCGC
AGTGTCCCTGATCAGTCTCTGCCTTGCCAGCAGCGAAAATAAAAACACTTTCACGGATATTTTGATG
AACATTGTCGGAGTATTTCTTTGGATCGCTGTGGGAGCCACAGCTTTGCACTACTGGCATGGTTATC
TTAGTGAGCACAAGTACACTTATGTGAACTCAGAAAGACAGGTTGGTCTCGCTTTGGGGTCCTTAAG
TGTGCTCAATGGTGCAGTTTACCTCGTTGATAGCGTCATATCAGTAATATTCTTAATAAAAGCCAAG
TTGCAGTAG

dsRS
AATTAACGAGTGTGTACTCGTTTTATCATCTGGCAGTTAAAGTCGGGAGAATAGGAGCCGCAACAC
ACAGTTTACCGCATTCAGACCTAACTGAGATACTGCCATAGACGACTAGCCATCCCTCTGGCTCTTA
GATAGCCGGATACAGTGATTTTGAAAGGTTTGTGGGGTACAGCTATGACTTGCTTAGCTGCGTGTGA

208

Figure S1 Mortality of adult mountain pine beetle (Dendroctonus ponderosae, MPB) in the
microinjection trial. Survival of the beetles injected with angled (inj_AN) and side-delivery
(inj_SN) needles (Hamilton, Canada) were compared to the survival of non-injected (control)
beetles. The initial survival pattern along with the injection process with each needle, were
considered in the selection of t he selection of the best needle.

209

Chapter 3

Figure S2 Adult MPB percent survival in three different sucrose feeding treatment groups: no
treatment (group_1), submerged in a 1% sucrose solution (group_2), and force fed a vertically
suspended droplet (group_3). Mortality was recorded for 15 days.

Table S2 A tally of the presence or absence of blue dye in MPB adult guts after exposure to a blue-dyed
1% sucrose solution.

Vertical Droplet Suspension
Beetle Submergence

Blue Dye Present
0
2

Blue Dye Absent
10
8

Table S3 Observation of the presence or absence of blue dye in MPB adult guts after exposure to bluedyed 1% sucrose as proof of ingestion.

Vertical Droplet Suspension
Beetle Submergence

Blue Dye Present
0
4

Blue Dye Absent
10
6

210

Table S4 Presence or absence of blue dye in the guts of adult MPB after being submerged in blue-dyed
1% sucrose for 12h.

Blue Dye Present
6

Blue Dye Absent
4

Table S5 Final tally of surviving “starved” and “fed” adult MPB 16 days post-submergence in the three
treatment groups: water, 0.05mg/ml and 0.1mg/ml hpRS-expressing yeast solutions.

Water
2 of 3
3 of 3

Starved
Fed

0.05mg/ml hpRS
2 of 3
2 of 3

0.1mg/ml hpRS
3 of 3
2 of 3

Chapter 4
Table S6 Quantification of hpRS translocated in phloem at the top (phT#), middle (phM#), and bottom
(phB#) of pine rounds placed in yeast solutions (see section 4.2.3.4.2). Included are no-reverse
transcriptase controls (-RTC_#), a no-template control (NTC), and a positive control (E gBlock). For
further definitions of controls, refer to Chapter 2, section 2.2.8.1 and 2.2.8.4.

Well
A10
A11
B10
B11
C10
C11
D10
D11
E10
E11
F10
F11
G10
G11
H10
H11
A12
B12
C12
D12
E12
F12
G12
H12

Sample
Top1
phT1
phT2
phT2
phT3
phT3
phM1
phM1
phM2
phM2
phM3i
phM3i
phB1
phB1
phB2
phB2
phB3
phB3
-RTCM1
-RTCM1
-RTCT2
-RTCB1
E gBlock
NTC

Copies/μl
18.2
19.7
4.96
6.35
5.71
6.26
6.48
4.21
2.51
3.62
9.24
8.43
2.4
1.9
4.31
3.49
2.07
2.22
0.298
0.513
0.116
0.243
26.3
0

Copies
364
394
99.2
127
114.2
125.2
129.6
84.2
50.2
72.4
184.8
168.6
48
38
86.2
69.8
41.4
44.4
5.96
10.26
2.32
4.86
526
0

211

Chapter 5
Table S7 Quality check results for total RNA eluted from adult MPB in previous RNAi assays meeting
requirements for 3’TagSeq library prep and sequencing. Concentration measured with the Qubit 4
Fluorometer Broad Range RNA assay (Thermo Fisher Scientific Inc., 2015) and the sample integrity
(RIN) was determined using the Agilent RNA 6000 Nano Kit on the Agilent Bioanalyzer 2100 (Agilent,
Santa Clara, CA). The ND-1000 Nanodrop (v.3.8.1, NanoDrop Technologies 2024) was used to measure
the 260/280 and 260/230 ratios. The 3’Tag-Seq analysis requirements are provided in red. * Though the
RIN assigned to the samples is not reliable for insect RNA as there is an endogenous break in the 28S
rRNA, the RNA quality was visually assessed using the electropherogram for each sample, showing little
to no degredation and the two peaks close together (Fabrick and Hull 2017).

Sample

Biological Delivery Method
Rep

Amount
sent (ng)

C22_1
C22_3
C22_4
C23_1
C23_4
C23_5
J22S_D3
J22S_D4
J22S_D5
J22S_I1
J22S_I4
J22S_I5
A16M_W1
A16M_W3
A16M_W5
A16M_D2
A16M_D3
A16M_D5
PHPF_W1
PHPF_W4
PHPF_W5
PHPF_D2
PHPF_D3
PHPF_D5

A
B
C
A
B
C
A
B
C
A
B
C
A
B
C
A
B
C
A
B
C
A
B
C

1500
1500
1500
1500
1500
1500
1500
1500
1500
1500
1500
1500
1500
1500
1500
1500
1500
1500
1500
1500
1500
1500
1500
1500

No treatment 2022
No treatment 2022
No treatment 2022
No treatment 2023
No treatment 2023
No treatment 2023
Submergence
Submergence
Submergence
Submergence
Submergence
Submergence
Microinjection
Microinjection
Microinjection
Microinjection
Microinjection
Microinjection
Phloem-fed
Phloem-fed
Phloem-fed
Phloem-fed
Phloem-fed
Phloem-fed

RIN
score
(>6)*
N/A
6.4
6.8
6.2
7.1
6.9
5.6
5.6
N/A
6.8
7.1
6.9
5.9
6.8
6.3
6.3
6.3
6.7
6.5
6.6
7.0
6.1
7.6
6.6

260/280
ratio (1.82.1)
2.1
2.1
2.1
2.1
2.1
2.1
2.1
2.1
2.1
2.1
2.1
2.1
2.1
2.1
2.1
2.1
2.1
2.1
2.1
2.1
2.1
2.1
2
2.1

260/230
ratio
(>1.5)
1.8
1.5
1.5
1.7
2
2.1
1.6
1.9
1.6
2.1
1.7
2
2
1.5
1.5
1.9
1.8
1.2
2
2
2
1.5
1.5
1.6

212

Table S8 Read count after quality control (QC) and mapping rate summary for each total MPB RNA
sample in the differential gene expression analysis.
Sample

Reads after QC

Reads uniquely mapped

A16M_D2
A16M_D3
A16M_D5
A16M_W1
A16M_W3
A16M_W5
C22_1
C22_3
C22_4
C23_1
C23_4
C23_5
J22S_D3
J22S_D4
J22S_D5
J22S_I1
J22S_I4
J22S_I5
PHPF_D2
PHPF_D3
PHPF_D5
PHPF_W1
PHPF_W4
PHPF_W5

6014032
6089371
6547129
6841191
6259254
6613472
7243905
6917986
7691051
7570401
7067160
7043497
7628782
6732600
6459394
7299763
6902227
7465229
6728546
6777632
6137461
7163238
6702677
6575207

3522181
3964016
4187597
3968350
3526978
3880999
3872899
4085141
4093132
3874023
3593754
3299466
3778522
3466626
3571064
3628493
3787147
4417637
4047544
4264421
3317399
4279602
3949065
3915640

Uniquely mapped rates
(%)
58.57
65.10
63.96
58.01
56.35
58.68
53.46
59.05
53.22
51.17
50.85
46.84
49.53
51.49
55.28
49.71
54.87
59.18
60.15
62.92
54.05
59.74
58.92
59.55

Table S9 List of annotated GO terms associated with up-regulated genes in adult MPB submerged in
dsIAP (J22S_I) compared to adult MPB not submerged at all (C22) obtained from NaviGO. Categories of
GO terms include: cellular component (CC), biological processes (BP), and molecular function (MF).
Enrichment is provided with calculated p-value, significance level is p<0.05.
GO term
GO:0005044
GO:0140662
GO:0004564
GO:0008010

P-value
0.000597
0.001312
0.001345
0.001347

Count
2
2
1
1

Category
MF
MF
MF
MF

GO:0042302
GO:0062129
GO:0003998
GO:0003994
GO:0042853
GO:0004017
GO:0035312

0.001347
0.001347
0.002685
0.004025
0.005363
0.010699
0.012028

1
1
1
1
1
1
1

MF
CC
MF
MF
BP
MF
MF

Annotation
scavenger receptor activity
ATP-dependent protein folding chaperone
beta-fructofuranosidase activity
structural constituent of chitin-based larval
cuticle
structural constituent of cuticle
chitin-based extracellular matrix
acylphosphatase activity
aconitate hydratase activity
L-alanine catabolic process
adenylate kinase activity
5'-3' exodeoxyribonuclease activity

213

GO:0003995
GO:0098599
GO:0098734
GO:0004089
GO:0046940
GO:0016829
GO:0005739
GO:0042026
GO:0008483
GO:0004364
GO:0006457
GO:0006099
GO:0031672

0.016007
0.01865
0.01865
0.01997
0.026541
0.029891
0.030417
0.033069
0.033069
0.035669
0.036711
0.044715
0.049847

1
1
1
1
1
2
6
1
1
1
2
1
1

MF
MF
BP
MF
BP
MF
CC
BP
MF
MF
BP
BP
CC

acyl-CoA dehydrogenase activity
palmitoyl hydrolase activity
macromolecule depalmitoylation
carbonate dehydratase activity
nucleoside monophosphate phosphorylation
lyase activity
mitochondrion
protein refolding
transaminase activity
glutathione transferase activity
protein folding
tricarboxylic acid cycle
A band

Table S10 List of annotated GO terms associated with down-regulated genes in adult MPB submerged in
dsIAP (J22S_I) compared to adult MPB not submerged at all (C22) obtained from NaviGO. Categories of
GO terms include: cellular component (CC), biological processes (BP), and molecular function (MF).
Enrichment is provided with calculated p-value, significance level is p<0.05.
GO term
GO:1990439

P-value
0.000724

Count
1

Category
MF

GO:0140791
GO:0180004

0.000724
0.000724

1
1

MF
MF

GO:0180005

0.000724

1

MF

GO:0180006

0.000724

1

MF

GO:0180007

0.000724

1

MF

GO:0180008

0.000724

1

NA

GO:0010349
GO:0033192
GO:0008422
GO:0090385
GO:0005385
GO:0016042
GO:0051119
GO:0071577
GO:0006829
GO:0016592
GO:0034219
GO:0008643

0.000724
0.003612
0.004333
0.010083
0.017939
0.019635
0.020072
0.020781
0.0222
0.026443
0.043247
0.046021

1
1
1
1
1
2
1
1
1
1
1
1

MF
MF
MF
BP
MF
BP
MF
BP
BP
CC
BP
BP

Annotation
MAP kinase serine/threonine phosphatase
activity
histone H2AXS140 phosphatase activity
RNA polymerase II CTD heptapeptide repeat Y1
phosphatase activity
RNA polymerase II CTD heptapeptide repeat T4
phosphatase activity
RNA polymerase II CTD heptapeptide repeat S2
phosphatase activity
RNA polymerase II CTD heptapeptide repeat S5
phosphatase activity
RNA polymerase II CTD heptapeptide repeat S7
phosphatase activity
L-galactose dehydrogenase activity
calmodulin-dependent protein phosphatase activity
beta-glucosidase activity
phagosome-lysosome fusion
zinc ion transmembrane transporter activity
lipid catabolic process
sugar transmembrane transporter activity
zinc II ion transmembrane transport
zinc II ion transport
mediator complex
carbohydrate transmembrane transport
carbohydrate transport

214

Table S11 List of annotated GO terms associated with up-regulated genes in adult MPB submerged in
dsRS (J22S_D) compared to adult MPB not submerged at all (C22) obtained from NaviGO. Categories of
GO terms include: cellular component (CC), biological processes (BP), and molecular function (MF).
Enrichment is provided with calculated p-value, significance level is p<0.05.

GO term
GO:0005739
GO:0003995
GO:0008299
GO:0006099
GO:0004163
GO:0008010

P-value
3.49E-05
0.000196
0.001023
0.001622
0.00176
0.001763

Count
12
2
2
2
1
1

GO:0042302
GO:0062129
GO:0006097
GO:0050992

0.001763
0.001763
0.00351
0.00351

1
1
1
1

GO:0004450
GO:0004452

0.00351
0.00351

1
1

GO:0019287

0.005261

1

GO:0034462
GO:0003994
GO:0017099

0.005261
0.005261
0.005261

1
1
1

GO:0046592
GO:0140300
GO:0016829
GO:0042853
GO:0004035
GO:0016491
GO:0000472

0.005261
0.005261
0.005283
0.007009
0.007009
0.007721
0.008754

1
1
3
1
1
5
1

GO:0009240
GO:0120170
GO:0050660
GO:0006102
GO:0003985
GO:0000480

0.008754
0.008754
0.010207
0.010496
0.010496
0.012234

1
1
2
1
1
1

GO:0000447

0.015703

1

Category
Annotation
CC
mitochondrion
MF
acyl-CoA dehydrogenase activity
BP
isoprenoid biosynthetic process
BP
tricarboxylic acid cycle
MF
diphosphomevalonate decarboxylase activity
MF
structural constituent of chitin-based larval
cuticle
MF
structural constituent of cuticle
CC
chitin-based extracellular matrix
BP
glyoxylate cycle
BP
dimethylallyl diphosphate biosynthetic
process
MF
isocitrate dehydrogenase (NADP+) activity
MF
isopentenyl-diphosphate delta-isomerase
activity
BP
isopentenyl diphosphate biosynthetic process,
mevalonate pathway
BP
small-subunit processome assembly
MF
aconitate hydratase activity
MF
very-long-chain-acyl-CoA dehydrogenase
activity
MF
polyamine oxidase activity
BP
serine import into mitochondrion
MF
lyase activity
BP
L-alanine catabolic process
MF
alkaline phosphatase activity
MF
oxidoreductase activity
BP
endonucleolytic cleavage generating mature
5'-end of SSU-rRNA
BP
isopentenyl diphosphate biosynthetic process
MF
intraciliary transport particle B binding
MF
flavin adenine dinucleotide binding
BP
isocitrate metabolic process
MF
acetyl-CoA C-acetyltransferase activity
BP
endonucleolytic cleavage in 5'-ETS of
tricistronic rRNA transcript (SSU-rRNA,
5.8S rRNA, LSU-rRNA)
BP
endonucleolytic cleavage in ITS1 to separate
SSU-rRNA from 5.8S rRNA and LSU-rRNA
215

GO:0033539

0.01916

1

BP

GO:0004089
GO:0000062
GO:0030992
GO:0042026
GO:0008483
GO:0005044
GO:0004364

0.026039
0.027751
0.029461
0.043031
0.043031
0.046395
0.046395

1
1
1
1
1
1
1

MF
MF
CC
BP
MF
MF
MF

from tricistronic rRNA transcript (SSUrRNA, 5.8S rRNA, LSU-rRNA)
fatty acid beta-oxidation using acyl-CoA
dehydrogenase
carbonate dehydratase activity
fatty-acyl-CoA binding
intraciliary transport particle B
protein refolding
transaminase activity
scavenger receptor activity
glutathione transferase activity

Table S12 List of annotated GO terms associated with down-regulated genes in adult MPB submerged in
dsRS (J22S_D) compared to adult MPB not submerged at all (C22) obtained from NaviGO. Categories of
GO terms include: cellular component (CC), biological processes (BP), and molecular function (MF).
Enrichment is provided with calculated p-value, significance level is p<0.05.

GO term
GO:0008061
GO:0005549
GO:0102210
GO:0010349
GO:0030599
GO:0042545
GO:0045490
GO:0005415
GO:0008422
GO:0009922
GO:0034625

P-value
4.11E-05
0.000449
0.001243
0.001243
0.001243
0.001243
0.001243
0.004951
0.007418
0.008649
0.008649

Count Category
2 MF
3 MF
1 MF
1 MF
1 MF
1 BP
1 BP
1 MF
1 MF
1 MF
1 BP

GO:0034626 0.008649

1 BP

GO:0019367 0.009879
GO:0005337 0.012334

1 BP
1 MF

GO:1901642
GO:0020037
GO:0005344
GO:0042761

0.012334
0.013273
0.016006
0.016006

1
2
1
1

BP
MF
MF
BP

GO:0015671 0.017227
GO:0007608 0.018424
GO:0016460 0.030563
GO:0051119 0.03417

1
3
1
1

BP
BP
CC
MF

Annotation
chitin binding
odorant binding
rhamnogalacturonan endolyase activity
L-galactose dehydrogenase activity
pectinesterase activity
cell wall modification
pectin catabolic process
nucleoside:sodium symporter activity
beta-glucosidase activity
fatty acid elongase activity
fatty acid elongation, monounsaturated fatty
acid
fatty acid elongation, polyunsaturated fatty
acid
fatty acid elongation, saturated fatty acid
nucleoside transmembrane transporter
activity
nucleoside transmembrane transport
heme binding
oxygen transporter activity
very long-chain fatty acid biosynthetic
process
oxygen transport
sensory perception of smell
myosin II complex
sugar transmembrane transporter activity
216

GO:0019825 0.037764

1 MF

oxygen binding

Table S13 List of annotated GO terms associated with up-regulated genes in adult MPB fed waterassociated with phloem (PHPF_W) compared to adult MPB not fed at all (C23) obtained from NaviGO.
Categories of GO terms include: cellular component (CC), biological processes (BP), and molecular
function (MF). Enrichment is provided with calculated p-value, significance level is p<0.05.

GO term
GO:0008810
GO:0030245
GO:0016798

P-value
2.24E-14
2.24E-14
2.91E-12

Count
5
5
9

Category
MF
BP
MF

GO:0045490
GO:0004553

3.77E-06
0.000753

2 BP
3 MF

GO:0004497
GO:0005975
GO:0000246
GO:0050614
GO:0030599
GO:0042545
GO:0008218
GO:0010349
GO:0004650
GO:0071555
GO:0005777
GO:0005506
GO:0080019

0.001204
0.001671
0.001967
0.001967
0.001971
0.001971
0.001971
0.001971
0.001971
0.001971
0.002812
0.003276
0.003923

3
5
1
1
1
1
1
1
1
1
3
3
1

GO:0102965

0.003923

1 MF

GO:0004768
GO:0004505
GO:0006571
GO:0019293

0.005879
0.005879
0.005879
0.005879

1
1
1
1

MF
MF
BP
BP

GO:0052689
GO:0006196
GO:0008422
GO:0009922
GO:0034625

0.006649
0.00978
0.011724
0.013665
0.013665

3
1
1
1
1

MF
BP
MF
MF
BP

GO:0034626

0.013665

1 BP

GO:0008061

0.015603

1 MF

MF
BP
MF
MF
MF
BP
BP
MF
MF
BP
CC
MF
MF

Annotation
cellulase activity
cellulose catabolic process
hydrolase activity, acting on glycosyl
bonds
pectin catabolic process
hydrolase activity, hydrolyzing O-glycosyl
compounds
monooxygenase activity
carbohydrate metabolic process
delta24(24-1) sterol reductase activity
delta24-sterol reductase activity
pectinesterase activity
cell wall modification
bioluminescence
L-galactose dehydrogenase activity
polygalacturonase activity
cell wall organization
peroxisome
iron ion binding
fatty-acyl-CoA reductase (alcoholforming) activity
alcohol-forming long-chain fatty acyl-CoA
reductase activity
stearoyl-CoA 9-desaturase activity
phenylalanine 4-monooxygenase activity
tyrosine biosynthetic process
tyrosine biosynthetic process, by oxidation
of phenylalanine
carboxylic ester hydrolase activity
AMP catabolic process
beta-glucosidase activity
fatty acid elongase activity
fatty acid elongation, monounsaturated
fatty acid
fatty acid elongation, polyunsaturated fatty
acid
chitin binding
217

GO:0019367
GO:0006559
GO:0016791
GO:0015187
GO:0016717

0.015603
0.015603
0.016119
0.019466
0.021392

1
1
3
1
1

BP
BP
MF
MF
MF

GO:0006633
GO:0005549
GO:0008253
GO:0015816
GO:0042761

0.022107
0.023898
0.025234
0.025234
0.025234

2
2
1
1
1

BP
MF
MF
BP
BP

GO:0008252
GO:0005283
GO:0035336

0.02906
0.044221
0.047975

1 MF
1 MF
1 BP

fatty acid elongation, saturated fatty acid
L-phenylalanine catabolic process
phosphatase activity
glycine transmembrane transporter activity
oxidoreductase activity, acting on paired
donors, with oxidation of a pair of donors
resulting in the reduction of molecular
oxygen to two molecules of water
fatty acid biosynthetic process
odorant binding
5'-nucleotidase activity
glycine transport
very long-chain fatty acid biosynthetic
process
nucleotidase activity
sodium:amino acid symporter activity
long-chain fatty-acyl-CoA metabolic
process

Table S14 List of annotated GO terms associated with down-regulated genes in adult MPB fed waterassociated with phloem (PHPF_W) compared to adult MPB not fed at all (C23) obtained from NaviGO.
Categories of GO terms include: cellular component (CC), biological processes (BP), and molecular
function (MF). Enrichment is provided with calculated p-value, significance level is p<0.05.

GO term
GO:0006635
GO:0004108
GO:0004163

P-value
4.56E-05
0.00119
0.00119

Count
3
1
1

Category
BP
MF
MF

GO:0008775
GO:0042132

0.00119
0.002375

1 MF
1 MF

GO:0005986
GO:0019287

0.002375
0.003561

1 BP
1 BP

GO:0006083
GO:0140300
GO:0005739
GO:0003986
GO:0006101
GO:0003985

0.003561
0.003561
0.004052
0.004745
0.005928
0.00711

1
1
7
1
1
1

GO:0003857

0.00711

1 MF

BP
BP
CC
MF
BP
MF

Annotation
fatty acid beta-oxidation
citrate (Si)-synthase activity
diphosphomevalonate decarboxylase
activity
acetate CoA-transferase activity
fructose 1,6-bisphosphate 1phosphatase activity
sucrose biosynthetic process
isopentenyl diphosphate biosynthetic
process, mevalonate pathway
acetate metabolic process
serine import into mitochondrion
mitochondrion
acetyl-CoA hydrolase activity
citrate metabolic process
acetyl-CoA C-acetyltransferase
activity
3-hydroxyacyl-CoA dehydrogenase
activity

218

GO:0030388

0.009469

1 BP

GO:0032222

0.009469

1 BP

GO:0030431
GO:0003995
GO:0006002

0.010647
0.014172
0.015344

1 BP
1 MF
1 BP

GO:0006000
GO:0004467

0.016515
0.017685

1 BP
1 MF

GO:0097428

0.018853

1 BP

GO:0070403
GO:0016747

0.02002
0.025524

1 MF
2 MF

GO:0042026
GO:0008299
GO:0051537
GO:0046949
GO:0016226
GO:0006099
GO:0006695
GO:0035025

0.029308
0.031616
0.031616
0.032769
0.032769
0.039656
0.043082
0.045359

1
1
1
1
1
1
1
1

BP
BP
MF
BP
BP
BP
BP
BP

fructose 1,6-bisphosphate metabolic
process
regulation of synaptic transmission,
cholinergic
sleep
acyl-CoA dehydrogenase activity
fructose 6-phosphate metabolic
process
fructose metabolic process
long-chain fatty acid-CoA ligase
activity
protein maturation by iron-sulfur
cluster transfer
NAD+ binding
transferase activity, transferring acyl
groups other than amino-acyl groups
protein refolding
isoprenoid biosynthetic process
2 iron, 2 sulfur cluster binding
fatty-acyl-CoA biosynthetic process
iron-sulfur cluster assembly
tricarboxylic acid cycle
cholesterol biosynthetic process
positive regulation of Rho protein
signal transduction

Table S15 List of annotated GO terms associated with up-regulated genes in adult MPB fed hpRSassociated with phloem (PHPF_D) compared to adult MPB not fed at all (C23) obtained from NaviGO.
Categories of GO terms include: cellular component (CC), biological processes (BP), and molecular
function (MF). Enrichment is provided with calculated p-value, significance level is p<0.05.

GO term
GO:0008810
GO:0030245
GO:0004768
GO:0140575

P-value
4.63E-06
4.63E-06
1.38E-05
2.75E-05

Count
2
2
2
2

Category
MF
BP
MF
MF

GO:0008061
GO:0016717
GO:0005506
GO:0006633
GO:0033961
GO:0010349
GO:0008010

0.000128
0.00025
0.000325
0.002082
0.002175
0.002179
0.002179

2
2
4
3
1
1
1

MF
MF
MF
BP
MF
MF
MF

Annotation
cellulase activity
cellulose catabolic process
stearoyl-CoA 9-desaturase activity
transmembrane monodehydroascorbate
reductase activity
chitin binding
oxidoreductase activity
iron ion binding
fatty acid biosynthetic process
cis-stilbene-oxide hydrolase activity
L-galactose dehydrogenase activity
structural constituent of chitin-based larval
cuticle
219

GO:0042302
GO:0062129
GO:0016798

0.002179
0.002179
0.002808

1
1
3

MF
CC
MF

GO:0006636
GO:0016491
GO:0080019

0.003238
0.004172
0.004336

2
6
1

BP
MF
MF

GO:0102965

0.004336

1

MF

GO:0008107

0.004336

1

MF

GO:0004180
GO:0004477

0.004672
0.006496

2
1

MF
MF

GO:0004487

0.006496

1

MF

GO:0102158

0.008653

1

MF

GO:0004488

0.008653

1

MF

GO:0006196
GO:0004185
GO:0097176
GO:0008422
GO:0004301
GO:0018812
GO:0035999
GO:0016803
GO:0004497
GO:0008253
GO:0042761

0.010805
0.010805
0.010805
0.012952
0.017233
0.017233
0.019366
0.021495
0.022581
0.027855
0.027855

1
1
1
1
1
1
1
1
2
1
1

BP
MF
BP
MF
MF
MF
BP
MF
MF
MF
BP

GO:0030497
GO:0016298
GO:0008252
GO:0004089
GO:0036065
GO:0020037

0.029966
0.031907
0.032073
0.032073
0.036273
0.038015

1
2
1
1
1
2

BP
MF
MF
MF
BP
MF

structural constituent of cuticle
chitin-based extracellular matrix
hydrolase activity, acting on glycosyl
bonds
unsaturated fatty acid biosynthetic process
oxidoreductase activity
fatty-acyl-CoA reductase (alcoholforming) activity
alcohol-forming long-chain fatty acylCoA reductase activity
galactoside 2-alpha-L-fucosyltransferase
activity
carboxypeptidase activity
methenyltetrahydrofolate cyclohydrolase
activity
methylenetetrahydrofolate dehydrogenase
(NAD+) activity
very-long-chain (3R)-3-hydroxyacylCoA dehydratase activity
methylenetetrahydrofolate dehydrogenase
(NADP+) activity
AMP catabolic process
serine-type carboxypeptidase activity
epoxide metabolic process
beta-glucosidase activity
epoxide hydrolase activity
3-hydroxyacyl-CoA dehydratase activity
tetrahydrofolate interconversion
ether hydrolase activity
monooxygenase activity
5'-nucleotidase activity
very long-chain fatty acid biosynthetic
process
fatty acid elongation
lipase activity
nucleotidase activity
carbonate dehydratase activity
fucosylation
heme binding

220

Table S16 List of annotated GO terms associated with down-regulated genes in adult MPB fed hpRSassociated with phloem compared (PHPF_D) to adult MPB not fed at all (C23) obtained from NaviGO.
Categories of GO terms include: cellular component (CC), biological processes (BP), and molecular
function (MF). Enrichment is provided with calculated p-value, significance level is p<0.05.

GO term
GO:0008010

P-value
0.001139

GO:0042302
GO:0062129
GO:0004170
GO:0006226
GO:0046081
GO:0017108
GO:0000808
GO:0005664

0.001139
0.001139
0.002272
0.002272
0.002272
0.006802
0.009059
0.009059

GO:0032222

0.009059

GO:0030431
GO:0000400
GO:0003688
GO:0004467
GO:0097428

0.010186
0.012436
0.015802
0.016922
0.01804

GO:0000900

0.019157

GO:0045947
GO:0051537
GO:0016226
GO:0046949
GO:0030371
GO:0035025

0.026943
0.030262
0.031366
0.031366
0.037964
0.043429

Count Category
Annotation
1 MF
structural constituent of chitin-based larval
cuticle
1 MF
structural constituent of cuticle
1 CC
chitin-based extracellular matrix
1 MF
dUTP diphosphatase activity
1 BP
dUMP biosynthetic process
1 BP
dUTP catabolic process
1 MF
5'-flap endonuclease activity
1 CC
origin recognition complex
1 CC
nuclear origin of replication recognition
complex
1 BP
regulation of synaptic transmission,
cholinergic
1 BP
sleep
1 MF
four-way junction DNA binding
1 MF
DNA replication origin binding
1 MF
long-chain fatty acid-CoA ligase activity
1 BP
protein maturation by iron-sulfur cluster
transfer
1 MF
translation repressor activity, nucleic acid
binding
1 BP
negative regulation of translational initiation
1 MF
2 iron, 2 sulfur cluster binding
1 BP
iron-sulfur cluster assembly
1 BP
fatty-acyl-CoA biosynthetic process
1 MF
translation repressor activity
1 BP
positive regulation of Rho protein signal
transduction

Table S17 List of annotated GO terms associated with up-regulated genes in adult MPB fed hpRSassociated with phloem (PHPF_D) compared to adult MPB fed water-associated with phloem (PHPF_W)
obtained from NaviGO. Categories of GO terms include: cellular component (CC), biological processes
(BP), and molecular function (MF). Enrichment is provided with calculated p-value, significance level is
p<0.05.

GO term
GO:0008010

P-value
1.50E-07

GO:0042302
GO:0062129

1.50E-07
1.50E-07

Count

Category
2 MF
2 MF
2 CC

Annotation
structural constituent of chitin-based
larval cuticle
structural constituent of cuticle
chitin-based extracellular matrix
221

GO:0015020
GO:0008080
GO:0042246
GO:0004497

0.01397
0.022919
0.028576
0.04339

1
1
1
1

MF
MF
BP
MF

glucuronosyltransferase activity
N-acetyltransferase activity
tissue regeneration
monooxygenase activity

Table S18 List of annotated GO terms associated with down-regulated genes in adult MPB fed hpRSassociated with phloem compared to adult MPB fed water-associated with phloem obtained from
NaviGO. Categories of GO terms include: cellular component (CC), biological processes (BP), and
molecular function (MF). Enrichment is provided with calculated p-value, significance level is p<0.05.

GO term
GO:0008810
GO:0030245
GO:0004170
GO:0006226
GO:0046081
GO:0004505
GO:0006571
GO:0019293

P-value
0.000362
0.000362
0.000723
0.000723
0.000723
0.001085
0.001085
0.001085

Count
1
1
1
1
1
1
1
1

Category
MF
BP
MF
BP
BP
MF
BP
BP

GO:0017108
GO:0006559
GO:0000400
GO:0007094
GO:0004867

0.002168
0.00289
0.003972
0.010802
0.036669

1
1
1
1
1

GO:0004497
GO:0016798

0.03807
0.046089

1 MF
1 MF

MF
BP
MF
BP
MF

Annotation
cellulase activity
cellulose catabolic process
dUTP diphosphatase activity
dUMP biosynthetic process
dUTP catabolic process
phenylalanine 4-monooxygenase activity
tyrosine biosynthetic process
tyrosine biosynthetic process, by
oxidation of phenylalanine
5'-flap endonuclease activity
L-phenylalanine catabolic process
four-way junction DNA binding
mitotic spindle assembly checkpoint
serine-type endopeptidase inhibitor
activity
monooxygenase activity
hydrolase activity, acting on glycosyl
bonds

222