CHARACTERIZATION OF PPAR-ALPHA OVEREXPRESSION IN BETACELL LIPOTOXICITY AND ITS EFFECTS ON OBESITY-INDUCED TYPE 2
DIABETES

by

K-Lynn N. Hogh
BSc., University of Northern British Columbia, 2008

THESIS SUBMITTED IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE
IN
INTERDISCIPLINARY STUDIES

THE UNIVERSITY OF NORTHERN BRITISH COLUMBIA
March 2012
© K-Lynn N. Hogh, 2012

1+1

Library and Archives
Canada

Bibliotheque et
Archives Canada

Published Heritage
Branch

Direction du
Patrimoine de I'edition

395 Wellington Street
Ottawa ON K1A0N4
Canada

395, rue Wellington
Ottawa ON K1A 0N4
Canada
Your file Votre reference
ISBN: 978-0-494-87528-5
Our file Notre reference
ISBN: 978-0-494-87528-5

NOTICE:

AVIS:

The author has granted a non­
exclusive license allowing Library and
Archives Canada to reproduce,
publish, archive, preserve, conserve,
communicate to the public by
telecommunication or on the Internet,
loan, distrbute and sell theses
worldwide, for commercial or non­
commercial purposes, in microform,
paper, electronic and/or any other
formats.

L'auteur a accorde une licence non exclusive
permettant a la Bibliotheque et Archives
Canada de reproduire, publier, archiver,
sauvegarder, conserver, transmettre au public
par telecommunication ou par I'lnternet, preter,
distribuer et vendre des theses partout dans le
monde, a des fins commerciales ou autres, sur
support microforme, papier, electronique et/ou
autres formats.

The author retains copyright
ownership and moral rights in this
thesis. Neither the thesis nor
substantial extracts from it may be
printed or otherwise reproduced
without the author's permission.

L'auteur conserve la propriete du droit d'auteur
et des droits moraux qui protege cette these. Ni
la these ni des extraits substantiels de celle-ci
ne doivent etre imprimes ou autrement
reproduits sans son autorisation.

In compliance with the Canadian
Privacy Act some supporting forms
may have been removed from this
thesis.

Conformement a la loi canadienne sur la
protection de la vie privee, quelques
formulaires secondaires ont ete enleves de
cette these.

While these forms may be included
in the document page count, their
removal does not represent any loss
of content from the thesis.

Bien que ces formulaires aient inclus dans
la pagination, il n'y aura aucun contenu
manquant.

Canada

Abstract
Lipotoxicity is implicated as a mechanism for pancreatic P-cell dysfunction in
obesity-induced type 2 diabetes (T2D). In vitro, peroxisome proliferator-activated
receptor alpha (PPARa) protects against lipotoxic (3-cell dysfunction preserving insulin
secretion. Utilizing an adeno-associated virus (dsAAV8), we induced overexpression of
PPARa specifically in pancreatic p-cells of adult, C57B16 mice that were fed a high-fat
diet for 20 weeks to induce obesity. We show that overexpression of PPARa in
pancreatic P-cells, in vivo, protects P-cell function in obesity, improving glucose
tolerance by preserving insulin secretion compared to obese controls. No change in islet
morphology or P-cell mass was observed. Despite metabolic improvements observed in
diet-induced obese mice, overexpression of PPARa in pancreatic P-cells of a genetic
model of severe obesity (db/db) did not improve carbohydrate metabolism. We have
developed the first in vivo model of p-cell specific PPARa overexpression to elucidate
the mechanisms involved in P-cell lipotoxicity in obesity-induced T2D.

ii

TABLE OF CONTENTS
Abstract

ii

Table of Contents

iii

List of Tables

v

List of Figures

vi

Dedication

xi

Acknowledgements

xiii

Chapter One: A lipotoxic approach to understanding the link between obesity and
type 2 diabetes
1
1.1 General introduction to obesity
2
1.2 General introduction to lipotoxicity
6
1.3 Changes in adipokine profiles: role in P-cell dysfunction and insulin resistance 8
1.4 The pancreas: insulin secretion and action
10
1.5 Pancreatic p-cell dysfunction: the lipotoxic hypothesis
15
1.6 Study objectives
20
1.7 References
22
Chapter Two: Utilizing dsAAV8 as a tool to overexpress proteins specifically in the
pancreatic p-cell in vivo
30
2.1 Introduction
31
2.2 Methods
37
2.3 Results
43
2.4 Discussion
56
2.5 References
61
Chapter Three: Overexpression of PPARa in the pancreatic p-cells improves
function in obesity
64
3.1 Introduction
65
3.2 Methods
71
3.3 Results
84
3.4 Discussion
98
3.5 References
105
Appendix
110
Chapter Four: Overexpression of PPARa in pancreatic p-cells does not improve
glucose tolerance in a severely obese genetic model (db/db mouse).
113
4.1 Introduction
114

iii

4.2 Methods
4.3 Results
4.4 Discussion
4.5 References

120
123
131
134

Chapter Five: Developing a model of PPARa overexpression in the pancreatic pcells in vivo: concluding remarks, future directions and significance.
138
5.1 Concluding remarks
139
5.2 Future directions
141
5.3 Significance
145
5.4 References
148

iv

LIST OF TABLES
Table 3.1 Taqman primer and probe sequences used to assess mRNA expression levels of
PPARa and PPARa target genes using quantitative PCR.

v

LIST OF FIGURES
Figure 1.1 The adaptability of adipose tissue and its role as a endocrine organ - modified
from (Gray and Vidal-Puig 2007; Shoelson et al. 2007). Healthy adipose tissue is
involved in metabolic homeostasis through the production and secretion of adipokines
(TNF-a, IL-6, MCP-1, PAI-1, leptin, adiponectin and resistin), as well as the safe storage
of TGs. When the storage capacity of the adipocytes is overloaded, the lipids spill-over
and accumulate in the surrounding non-adipose tissues. This increase in adiposity also
alters the adipokine profile. Abbreviations: j, - decreased levels; t - increased levels;
TNF-a - Tumor Necrosis Factor alpha; IL-6 — Interleukin 6; PAI-1 - Plasminogen
Activator Inhibitor-1; MCP-1 - Monocyte Chemoattractant Protein-1; TGs triglycerides.
Figure 1.2 Schematic representation of insulin secretion in the pancreatic P-cell by
endogenous stimuli - modified from (Boron and Boulpaep 2005). Nutrient stimuli (such
as glucose, amino acids and FFAs) get shuttled into the P-cell through their respective
transporters. Once inside the cell, through their respective pathways, the stimuli cause an
influx of Ca2+ into the cell and release of insulin (via exocytosis of insulin secretory
granules). Once secreted insulin binds to insulin receptors and increases glucose uptake
and storage as well as increasing fat storage in adipose tissue. Abbreviations: +++ depolarization; GLUT2 - glucose 2 transporter; aa - amino acids; K+ channel; Ca24
channels; ATP - adenosine triphosphate; FFAR1/GPR40 - free fatty acid receptor-I/Gcoupled receptor-40; FFA - free fatty acid
Figure 1.3 Obesity as a conduit to insulin resistance and p-cell dysfunction - modified
from (Kasuga 2006; Shoelson et al. 2007). Adipose tissue in the obese state contributes to
altered adipokine profiles, and lipid accumulation in non-adipose tissues, propagating the
pathogenesis of insulin resistance and P-cell dysfunction. When the cells and peripheral
tissues can no longer respond to insulin, insulin resistance is said to occur. In the insulin
resistant state, the islets make more insulin (hyperinsulinemia) to compensate to maintain
normal glucose homeostasis. The islets "tire" from over-producing insulin and
eventually fail to produce insulin altogether resulting in P-cell failure and T2D.
Abbreviations: TNF-a - Tumor Necrosis Factor alpha; IL-6 - Interleukin 6; PAI-1 Plasminogen Activator Inhibitor-1; MCP-1 - Monocyte Chemoattractant Protein-1; T2D
- type 2 diabetes.

vi

Figure 2.1 In vivo experimental approach establishing effects of overexpressing dsAAV8RIP-eGFP in pancreatic P-cells in mice. Four-month-old male C57B16 mice were
infected with either dsAAV8-RIP-eGFP (P-eGFP-Control) (5.0xl012 viral
genomes/mouse) or saline (284^1/mouse). Body weights (weekly), 4hr fasted blood
glucose readings (biweekly), oral glucose tolerance (end point), and insulin tolerance
(end point) were assessed. Abbreviations: dsAAV8 - double stranded adeno-associated
virus serotype 8; RIP - rat insulin promotor; eGFP - enhanced green fluorescent protein.
Figure 2.2 Immunohistochemical analysis to detect eGFP overexpression in pancreatic Pcells. Overexpression of dsAAV8-RIP-eGFP shows targeted expression of eGFP in (icells (A) and not a-cells (B) of the pancreas of C57B16 mice. (C) Percentage of eGFP
positive immunoreactive area in total islet area. Abbreviations: dsAAV8 - double
stranded adeno-associated virus serotype 8; RIP - rat insulin promotor; eGFP - enhanced
green fluorescent protein; INS - insulin; GLC - glucagon . Saline-treated n=7, p-eGFPControl n=7. Images taken at 20x magnification. Scale bar 50fim.
Figure 2.3 Western blot analysis of dsAAV8-RIP-eGFP expression in the hypothalamus.
Overexpressing dsAAV8-RIP-eGFP in pancreatic P-cells does not cross the BBB
showing no expression in the hypothalamus. 30|ig of protein per sample was loaded and
run (see methods); p-Actin was utilized as a protein control. Abbreviations: dsAAV8 double stranded adeno-associated virus serotype 8; RIP - rat insulin promotor; eGFP enhanced green fluorescent protein; NT - non-transfected MIN6 cells; (-) negative
control; eGFPM - eGFP transfected MIN6 cells; (+) positive control.
Figure 2.4 Western blot analysis of dsAAV8-RIP-eGFP expression in non-pancreatic
tissues. Overexpressing dsAAV8-RIP-eGFP in pancreatic p-cells does not target skeletal
muscle or intestine. Non-specific binding of eGFP was observed in liver tissue in both
dsAAV8-RIP-eGFP mice and saline controls. 30^g of protein per sample was loaded and
run (see methods); P-Actin was utilized as a protein control. Abbreviations: dsAAV8 double stranded adeno-associated virus serotype 8; RIP - rat insulin promotor; eGFP enhanced green fluorescent protein; NT - non-transfected MIN6 cells; (-) negative
control; eGFPM - eGFP transfected MIN6 cells; (+) positive control; SKM - skeletal
muscle.
Figure 2.5 Immunohistochemical analysis of dsAAV8-RIP-eGFP overexpression in non­
pancreatic tissues. Staining revealed no eGFP expression in liver (A) or skeletal muscle
(B) tissues above background staining (secondary antibody AF488 only) in P-eGFPControl mice when compared to saline controls. Pancreas sections (C) were stained as
positive controls to show level of eGFP expression when cells are overexpressing eGFP.
Abbreviations: dsAAV8 - double stranded adeno-associated virus serotype 8; RIP - rat
insulin promotor; eGFP - enhanced green fluorescent protein; 1° - primary; CNTRL control. Images taken at 20x magnification. Scale bar 50(am.

Figure 2.6 Body weight and carbohydrate metabolism from 3wk post-infection with
dsAAV8-RIP-eGFP (p-eGFP-Control) or saline (284|il/mouse) by ip injection.
Overexpression of eGFP in pancreatic P-cells resulted in no change in body weight (A),
4hr FBG (B), glucose tolerance (C, 2g D-glucose/kg), or insulin sensitivity (D, 0.75U
insulin/kg) compared to saline-treated mice on regular chow diet. Abbreviations:
dsAAV8 - double stranded adeno-associated virus serotype 8; RIP - rat insulin promotor;
eGFP - enhanced green fluorescent protein; FBG - fasted blood glucose. Saline-treated
n=7, P-eGFP-Control n=7. Mean values +/- standard error of the mean are shown.
Statistical significace was determined by 2-way ANOVA (over time) with Bonferoni Post
Tests or Student's t-Tests (at specific time points).
Figure 3.1 - Regulation of gene expression by PPARs (Binding of PPAR/Retinoid
Nuclear Receptor Family) modified from (Reddy and Hashimoto 2001). The PPAR/RXR
family is involved in controlling gene transcription at the nuclear level. Abbreviations:
FA - fatty acid; PPAR - peroxisome proliferator-activated receptor; Pa - PPARa; RXR retinoid-X receptor; CRC - corepressor complex; HDACs - histone deacetylases; PPRE
- PPAR response element; CAC - coActivator complex; HATs - histone
acetyltransferases.
Figure 3.2 In vitro experimental approach utilized in the expression of PPARa in MIN6
cells (in vitro). Abbreviations: PPARa - peroxisome proliferator-activated receptor
alpha; MIN6 - mouse insulinoma cell line; BSA - bovine serum albumin; GSIS glucose-stimulated insulin secretion.
Figure 3.3 In vivo experimental approach characterizing the physiological effects of
overexpressing PPARa in the pancreatic P-cells of C57B16 mice in vivo. Four month old
male C57B16 mice were infected with either dsAAV8-RIP-eGFP (p-eGFP-HFD) or
dsAAV8-RIP-PPARa and placed on high-fat diet for 16 weeks. Abbreviations: dsAAV8
- double stranded adeno-associated virus serotype 8; RIP - rat insulin promotor; eGFP enhanced green fluorescent protein; PPARa - peroxisome proliferator-activated receptor
alpha; FBG - fasted blood glucose; HFD - high-fat diet; ip - intraperitoneal.
Figure 3.4 Overexpression of PPARa in MIN6 cells. Overexpression of PPARa in MIN6
cells occurs at physiological levels (A) and upregulates expression of CPT1 with
palmitate treatment (B). Overexpressing PPARa in MIN6 cells did not change insulin
secretion when stimulated with high levels of glucose without palmitate (C).
Abbreviations: PPARa - peroxisome proliferator-activated receptor alpha; MIN6 mouse insulinoma cell line; eGFP - enhanced green fluorescent protein; CPT1 - carnitine
palmitoyl transferase-1; LCAD - long-chain acyl-coA dehydrogenase; UCP2 uncoupling protein-2; AOX - acyl-CoA oxidase. Mean values with standard error of
mean are shown. Statistical significance was determined by 2-way ANOVA with
Bonferoni Post Tests or Student's T-Tests. *P<0.05, **P<0.01, ***P<0.001,
**** P<0 oooi.
Figure 3.5 (A) PPARa is overexpressed in the cytoplasm and nuclei (arrows) of PPPARa-HFD compared to P-eGFP-HFD controls. (B) Overexpression of PPARa in

pancreatic P-cells of obese mice improved oral glucose tolerance (2g/kg D-glucose)
compared to obese controls, with glucose tolerance similar to age-matched, chow mice.
(C) Over time, no significant difference between 4 hr fasted blood glucose was observed.
(D) PPARa overexpression did not affect body weight. (E), nor was insulin sensitivity
affected (1U insulin/kg). Abbreviations: PPARa - peroxisome proliferator-activated
receptor alpha; eGFP - enhanced green fluorescent protein; FBG - fasted blood glucose;
HFD - high-fat diet. P-eGFP-HFD n=6, P-PPARa-HFP n=8. Mean values with SEM are
shown. Statistical significant variation was determined by 2-way ANOVA with
Bonferoni Post Tests or Student's T-Tests. *P<0.05, **P<0.01, ***P<0.001.

Figure 3.6 Overexpression of PPARa in pancreatic P-cells shows a trend towards
improved glucose tolerance over time (2g D-glucose/kg). Oral glucose tolerance tests
over time (A) Baseline, (B) 1-month post-infection, (C) 2-months post-infection, (D) 3months post-infections (E) 4-months post infection. Abbreviations: PPARa - peroxisome
proliferator-activated receptor alpha; eGFP - enhanced green fluorescent protein; FBG fasted blood glucose; HFD - high-fat diet. p-eGFP-HFD n=6, p-PPARa-HFP n=8. Mean
values with SEM are shown. Statistical significant variation was determined by 2-way
ANOVA with Bonferoni Post Tests. *P<0.05, **P<0.01, ***P<0.001.
Figure 3.7 Overexpression of PPARa in pancreatic p-cells maintains 1st phase insulin
secretion in C57B16 mice on high-fat diet compared to obese controls. Glucosestimulated insulin secretion (A) but not overnight and refeed insulin levels (B) was
significantly affected. Additionally, overexpression of PPARa in pancreatic P-cells did
not change islet morphology or P-cell or a-cell mass (C) when compared to obese
controls. Abbreviations: PPARa - peroxisome proliferator-activated receptor alpha; eGFP
- enhanced green fluorescent protein. P-eGFP-HFD n=6, P-PPARa-HFP n=8. Mean
values with SEM are shown. Statistical significant variation was determined by 2-way
ANOVA with Bonferoni Post Tests or Student's T-Tests. *P<0.05, **P<0.01,
***p<0 001. Images taken at 20x magnification. Scale bar 50p.m.
Figure 3.8 Overexpression of PPARa in pancreatic P-cells does not cause changes in
peripheral tissue mass on HFD. Abbreviations: PPARa - peroxisome proliferatoractivated receptor alpha; eGFP - enhanced green fluorescent protein; HFD - high fat
diet; scWAT - subcutaneous white adipose tissue; gWAT - gonodal white adipose tissue.
P-eGFP-HFD n=6, P-PPARa-HFP n=8. Mean values with SEM are shown. Statistical
significant variation was determined by student's t-tests.
Figure 4.1 Comparing male C57B16 littermate controls to db/db (A) and ob/ob (B) mice.
Mice purchased from JAX laboratories at four weeks of age. Images from Jackson
Laboratories website: http://iaxmice.iax.org [electronic] accessed Dec 15 2011.
Figure 4.2 Overexpression of PPARa in p-cells of genetically obese mice (db/db) did not
improve glucose homeostasis. (A) Fast and fed blood glucose levels. (B) body weight,
(C) plasma insulin levels, and (D) insulin sensitivity (0.75U/kg insulin for wild-type
mice; 1.5U/kg insulin for db/db mice) in db/db mice. P-eGFP-db/db n=7, p-PPARa-

ix

db/db n=6. Mean values with SEM are shown. Statistical significant variation was
determined by 2-way ANOVA with Bonferoni Post Tests. *P<0.05, **P<0.01,
***P<0.001.
Figure 4.3 Overexpression of PPARa in P-cells of genetically obese mice (db/db) does
not affect islet morphology of insulin immuno-positive area. Abbreviations: INS insulin; GLC - glucagon. Images taken at 20x magnification. Scale bar 50nm.
Figure 4.4 Overexpression of dsAAV8-RIP-eGFP in P-cells of genetically obese mice
(db/db) is targeted to the p-cells and not a-cells of pancreatic islets. Abbreviations: INS insulin; GLC - glucagon; GFP - green fluorescent protein. Images taken at 20x
magnification. Scale bar 50|im.

x

DEDICATION
I would like to start by recognizing my family and close friends for their
unwavering love and support through the "trials and tribulations" of completing my
Masters, This support has allowed me to develop into the procrastinating-comedicgenius I am today.
Specifically I would like to thank my parents Momma H and Papa Rico for their
infinite wisdom and invaluable love and support. Always telling me that I could do
anything I put my mind to - once again you were right! I would not have had as many
amazing opportunities if it weren't for either of you - Thank you!
To my sister Kelsy, and my brother Colt, I seriously would not know what to do
without either of you. Kelsy -1wouldn't be as proficient in first-aid if it wasn't for you,
so thanks! Never forget "One minute, One hour, One day at a time". Colt -1don't even
know where to begin! I want to thank you for always having a "story" worthy of a good
laugh! Regardless, both of you are always able to turn any situation into an "adventure"
with gratuitous amounts of energy - Thank you!
To my late friend Jonathan Drummond-Webb - you taught me that in order to
succeed you must never give up, no matter how difficult things may become; you also
taught me that balance is key!
Ho der! Ho der! I can't forget my good friend and mentor Cory Brown - thank
you for giving me the opportunity to gain insight into an amazing career. Once again
teaching me that balance is key! Even if that balance is unstable due to an increased
amount of vitamins... HAHAHAHA! Cory - Thanks! I look forward to having you as
MY associate in a few years.

xi

I know there are people I have missed, and I apologize for not being able to
recognize each and every one of you individually. Again, thank you for all the love and
support!

And to Brad... keep reading as the results are LEGEN... wait for it... DARY!

xii

ACKNOWLEDGEMENT
There are a number of people I would like to thank for their astonishing support
throughout the completion of my Masters. First and foremost I express my most sincere
gratitude to my supervisor Sarah Gray for taking me on as her first official graduate
student in the Gray Lab. Sarah - you have provided me invaluable guidance on this
project with the freedom to think critically and outside-of-the-box about this work.
Thank you for the never-ending support and the amazing opportunities - from attending
and presenting at conferences, to writing the manuscript for our PPARa paper. I am most
grateful for these experiences! I've had a most enjoyable experience as a graduate
student, and again thank you for not only being an amazing supervisor, but a good friend
and mentor as well.
I would like to thank my committee members Geoffrey Payne, Dezene Huber and
Andrea Gorrell for providing insights and thoughtful feedback on this project - and
helpful hints on Mac related problems. More importantly, thank you for agreeing to be
apart of my journey as a graduate student. To Luke Harris, thank you for taking the time
and agreeing on being my external examiner.
To my friends - thanks for always providing a good laugh and knowing when it
was time to take a break. Special thanks to members of the Gray Lab, both past and
present. To my sidekick and fellow member of "team 4D" Chris Uy - working with you
has been most wildly inappropriate and entertaining, it is safe to say that OGTTs have not
been the same without you. To members of the Payne lab: Stephanie Sellers - can always
trust you for tips and advice on everything. Geoff Payne, thanks for always being there
for a "quick chat" and more importantly introducing me to "the lists". To Lydia Troc,

xiii

Dee Jones, Shannon Carrol and James Jones - thank you for always being
accommodating with my scheduling and looking after all my "kids",
I wish to thank Dr. Timothy Kieffer for providing our lab with the dsAAV viral
construct, as well as providing constructive review of our experimental design and
manuscript. I would also like to thank Ali Asadi and Michael Riedel for their invaluable
support and guidance on immunohistochemistry and experimental protocols. In addition
I would like to thank Rob Baker, Tim, Ali, Michael, Chris, and Sarah for their feedback
and peer review of our PPARa manuscript and essentially chapters 2-4 of my thesis.
Lastly, I would also like to thank the Canadian Diabetes Association for funding
our project, as well as UNBC Office of Research for awarding me a 2010 UNBC
Research Project Award to further support this work.
Again this thesis would not have been possible without the help and support of all
of you, as well as those not mentioned. Thank you.

xiv

CHAPTER 1

A lipotoxic approach to understanding the link between
obesity and type 2 diabetes

1

1.1 INTRODUCTION
1.1 General introduction to obesity
Obesity is the number one risk factor for developing type 2 diabetes (T2D)
(Smyth and Heron 2006); however, the physiological mechanisms underlying this
association is not fully understood. Obesity results from chronic positive energy balance
with subsequent increase in triglyceride (TG) storage in adipose tissue (van Herpen and
Schrauwen-Hinderling 2008). In addition to T2D, obesity is a risk factor for numerous
diseases including and not limited to: insulin resistance, cardiovascular disease, cancer,
osteoarthritis, and non-alcoholic fatty liver disease (Kahn et al. 2006; Shoelson et al.
2007; van Herpen and Schrauwen-Hinderling 2008; Kusminski etal. 2009). Recently,
rates of obesity, including childhood obesity, have reached epidemic proportions around
the world (Deckelbaum and Williams 2001; Smyth and Heron 2006); where it has been
estimated that obesity and its comorbidities are responsible for approximately 300,000
deaths annually (Dixon 2010). Therefore it is not a surprise that obesity is associated
with a plethora of complications resulting in long term suffering for patients and huge
economic burdens to health care systems around the world (Dixon 2010).
Adipose tissues comprise a complex organ composed of adipocytes, vascular
tissue, and immune cells that has the ability to expand and proliferate to meet fat storage
needs (Gray and Vidal-Puig 2007). In healthy individuals, adipocytes are responsible for
the storage of fats as TGs and additionally act as endocrine cells regulating fat mass,
nutrient homeostasis and immune response (Spiegelman 1998; Rosen and Spiegelman
2006). As seen in figure 1.1, adipocytes are depots for storing energy in the form of TGs
which are

2

Figure 1.1 The adaptability of adipose tissue and its role as a endocrine organ - modified
from (Gray and Vidal-Puig 2007; Shoelson et al. 2007). Healthy adipose tissue is
involved in metabolic homeostasis through the production and secretion of adipokines
(TNF-a, IL-6, MCP-1, PAI-1, leptin, adiponectin and resistin), as well as the storage of
TGs. When the storage capacity of the adipocytes is overloaded, as seen in obesity, lipids
spill-over and accumulate in the surrounding non-adipose tissues. This increase in
adiposity also alters the adipokine profile.TNF-a -Tumor Necrosis Factor alpha; IL-6 Interleukin 6; PAI-1 - Plasminogen Activator Inhibitor-1; MCP-1 - Monocyte
Chemoattractant Protein-1; TGs - triglycerides

3

Obese Adipose
Tissue

Lean Adipose
Tissue
Increased
nutrient
storage

Chronic overnutrition
=> obesity
•

expansion and
proliferation
Safe storage of TGs
- regulate fat mass
- maintains nutrient
homeostasis

"Normal" Adipokine levels.
Leptin, Adiponectin, and
proinflammatory mediators

Altered adipokine profiles:
t Leptin, i Adiponectin, T
proinflammatory mediators

Abnormal lipid accumulation in
non-adipose tissues (liver,
heart, muscle, pancreas) "Lipotoxicity"

broken down into glycerol and fatty acids (FAs) when metabolic demand is increased and
glucose stores are limited (Sethi and Vidal-Puig 2007). Healthy adipocytes have the
ability to proliferate and undergo hypertrophy (Fig. 1.1) to accommodate the storage of
excess lipids in times of over nutrition (Gray and Vidal-Puig 2007). In the non-obese
state, adipocytes are continuously fluctuating between storage and lipolysis of TGs and
FFAs to maintain lipid homeostasis (Greenberg et al. 2011). Lipolysis is the finely
orchestrated regulation of lipid metabolism, controlled by various lipases including:
hormone sensitive lipase (HSL), lipoprotein lipase (LPL) and adipose triglyceride lipase
(ATGL) (Arner 2005; Carmen and Victor 2006; Haemmerle et al. 2006); where these
lipases catalyze the hydrolysis of ester linkages in TGs and diacylglycerols (DAGs) to
produce FFAs and glycerol (Arner 2005; Carmen and Victor 2006). Moreover, the liver
is a primary organ involved in lipid metabolism, responsible for the production of
cholesterols, TGs and lipoproteins (van Herpen and Schrauwen-Hinderling 2008). A
recent study from Haemmerle and colleagues (2006) showed that a decrease in FA
availability leads to increased glucose metabolism in adipose tissue and skeletal muscle
in ATGL knockout mice (Haemmerle et al. 2006). Furthermore, this study showed that
ATGL is a key mediator in TG catabolism in both adipose and non-adipose tissues
(Haemmerle et al. 2006).
Increased levels of basal lipolysis has been observed in obesity, and is thought to
be due to ineffective actions of insulin (unable to inhibit lipolysis), increased levels of
circulating leptin, and tumor necrosis factor-a (Duncan et al. 2007). Therefore, the
inability to inhibit lipolysis in both the fed and fasted state greatly contributes to
increased circulating levels of TGs and FAs, as well as disruption of TG storage in

5

adipocytes (Langin et al. 2005; Duncan et al. 2007). In the obese state, when the storage
capacity of adipose tissue is challenged, excess lipids "leak" out of the adipocytes into
the circulation. This "spillover" of lipids, results in elevated circulating levels of FAs and
TGs contributing to abnormal accumulation of lipids in non-adipose tissues such as
skeletal muscle, liver, heart and J3-cells of the pancreas (Eldor and Raz 2006; van Herpen
and Schrauwen-Hinderling 2008), a phenomenon known as lipotoxicity.

1.2 General introduction to lipotoxicity
Lipid accumulation as a result of lipid spillover has been associated with having
toxic effects in peripheral, non-adipose tissues; a term referred to as lipotoxicity. It
should also be noted that lipotoxicity can also affect individuals who suffer from
lipodistrophy (lack of natuarally occurring adipose tissue), as there is no natural storage
depot for circulating FAs and TGs, therefore lipids begin to accumulate in non-adipose
tissues (Unger 2002).
Increased lipid accumulation in tissues such as liver, skeletal muscle, heart and
pancreas have been associated with a plethora of dysfunctional consequences. Lipotoxic
effects in skeletal muscle and liver have been associated with low-grade inflammation
and insulin resistance; in addition the development of non-alcoholic fatty liver disease is
also thought to be a consequence of lipotoxicity in the liver (van Herpen and SchrauwenHinderling 2008; Chavez and Summers 2010). Abnormal lipid accumulation in the heart
and vasculature has been associated with cardiomyopathy, heart failure ("lipotoxic
heart"), inflammation and endothelial dysfunction (contributing to the progression of
atherosclerosis) (Unger 2002; van Herpen and Schrauwen-Hinderling 2008; Imrie et al.

6

2010; Wende and Abel 2010). It is well established that lipid accumulation within the
pancreatic P-cells has been associated with insulin resistance, P-cell dysfunction, and Pcell failure (Prentki and Nolan 2006; Summers 2006; van Herpen and SchrauwenHinderling 2008; Virtue and Vidal-Puig 2010). Insulin is responsible for activating LPL
activity in adipocytes for increased FA storage, and decreases LPL activity in skeletal
muscle (Farese et al. 1991; Lewis et al. 2002). In the obese state, LPL activity is
inhibited in the adipocytes causing the storage of FAs to be distributed to the circulation
and non-adipose tissues (Sadur et al. 1984; Yost et al. 1995; Lewis et al. 2002), thus
insulin resistance is a "double-edged sword" further contributing to the vicious lipotoxic
cycle. Lipotoxicty and its role in P-cell dysfunction will be discussed later in this review.
There has been great debate in the literature as to whether it is the quantity or
quality of lipid species that has the most detrimental toxic effects in non-adipose tissues.
Ceramides and sphingolipids have been lipid species of intense study in obesity research
as they have been found to be involved in inhibiting glucose uptake in cells as well as
inducing oxidative stress (Holland et al. 2007). Ceramides have also been linked to
influencing the regulation of various adipokines such as TNF-a (Summers 2006), as well
as contributing to apoptosis through increased ROS production and activation of the NFKB pathways (Kusminski et al. 2009; Chavez and Summers 2010) inducing p-cell
dysfunction and insulin resistance, as well as endothelial inflammation and dysfunction.
Moreover it has also been shown that ceramides impair the translocation of GLUT4 on
cellular membranes in muscle, adipose and liver tissue (JeBailey et al. 2007; Hoehn et al.
2008). Combined, ceramide and sphingolipid species have been implicated as the toxic
intermediates involved in lipotoxic accumulation in non-adipose tissues (Chavez et al.

7

2003; Summers 2006; Wende and Abel 2010), as well as contributing to inflammation
through increased ER stress and reactive oxygen species (ROS) (Wende and Abel 2010).
Additionally, adipokines, in association with the lipotoxic effects of lipid
accumulation in non-adipose tissues, exacerbates the use of non-oxidative pathways
(Kusminski et al. 2009) resulting in cellular dysfunction and apoptosis (Gray et al. 2006;
Summers 2006). Thus the combination of lipotoxicity and pro-inflammatory mediators
contribute to insulin resistance, oxidative stress, and P-cell dysfunction (Cave et al.

2008).

1.3 Changes in adipokine profiles: role in p-cell dysfunction and insulin resistance
Until recently, it was thought that the primary role of adipose tissue was energy
homeostasis and a depot for fat storage (Ahima 2006). It wasn't until the discovery of
leptin, an adipocyte derived hormone, that adipose tissue was regarded as an endocrine
organ (Zhang et al. 1994; Kershaw and Flier 2004; Ahima 2006; Friedman 2010). Leptin
has been identified to play a role in fuel metabolism in peripheral tissues (Suzuki et al.
2007), appetite suppression and reduced fat mass (Schroeder-Gloeekler et al. 2007), FA
oxidation in skeletal muscle (Muoio and Lynis Dohm 2002), and glucose metabolism
(Huynh et al. 2010). A more in-depth review of leptin will be covered in chapter 4.
The adipose tissue acts as an endocrine organ producing and secreting adipocyte
derived hormones (adipokines) that play a role in metabolic regulation (Gray and VidalPuig 2007). It has been well established that adipokine production and secretion change
in the obese state (Gray and Vidal-Puig 2007) as seen in figure 1.1. The change in
adipokine profiles in the obese state is thought to contribute to a low-grade inflammatory

8

state and insulin resistance (Eldor and Raz 2006; Gray and Vidal-Puig 2007; Lago et al.
2007). Recent studies have shown that adipokines involved in metabolic homeostasis
include: tumor necrosis factor-a (TNF-a), interluekin-6 (IL-6), monocyte chemoattractant
protein-1 (MCP-1), plasminogen activator inhibitor-1 (PAI-1), resistin, adiponectin and
leptin (Shoelson et al. 2006).
An increase in TNF-a, IL-6, MCP-1, PAI-1, and resistin as seen in obesity
promotes a pro-inflammatory state that contributes to developing insulin resistance and
also potentiates vascular disease (Esposito et al. 2006; Shoelson et al. 2007). Unlike the
other pro-inflammatory adipokines, adiponectin which is reduced in the obese state, has
anti-inflammatory, and insulin-sensitizing properties and has been found to be inhibited
by TNF-a and IL-6 in obese states (Esposito et al. 2006; Lago et al. 2007). Likewise,
leptin acts on the central nervous system and peripheral tissues to reduce fat stores by
suppressing appetite, increasing metabolic rate, and activating thermogenesis (Muoio and
Lynis Dohm 2002; Ceddia 2005; Unger 2005; Zhao et al. 2006; Gray and Vidal-Puig
2007; Friedman 2010), it also functions in glucose metabolism, cytokine secretion,
phagocytosis, and angiogenesis (Otero ct al. 2006; Lago et al. 2007). This ultimately
contributes to localized disturbances in metabolic pathways contributing to increased
macrophage infiltration, insulin resistance, and endothelial damage (Laclaustra et al.
2007; Shoelson et al. 2007). Thus, obesity is a state of heightened inflammation, a
process that contributes to the development of obesity-induced insulin resistance;
therefore, these inflammatory mediators and the pathways in which they activate could be
potential targets for therapeutic interventions or prevention for obesity induced insulin
resistance and (3-cell dysfunction.

9

Lipotoxicity and changes in adipokine profiles have been discussed as obesity
related hypotheses as contributing factors to insulin resistance and P-cell dysfunction.
The remainder of my thesis will focus on the lipotoxic hypothesis and its role in P-cell
dysfunction and failure in the progression of obesity-induced T2D.

1.4 The pancreas: insulin secretion and action
The pancreas functions as both an exocrine and endocrine organ; with the
endocrine pancreas responsible for the production and secretion of several hormones that
regulate carbohydrate metabolism, including insulin. The endocrine pancreas contains
approximately one million islets composed of several cell types (a-cells, P-cells, 8-cells,
F-cells, and e-cells). The pancreatic P-cells produce and secrete insulin promoting
glucose uptake and storage within skeletal muscle and adipose tissue and glucose
production and storage in liver. In addition to its role in regulating glucose metabolism,
insulin also regulates lipid metabolism promoting the storage of fat within adipose tissue
(Evans et al. 2004; Wellen and Hotamisligil 2005; Razani et al. 2008), and acting on the
brain, specifically the hypothalamus to regulate energy balance by reducing food intake
(Choudhury et al. 2005; Kahn et al. 2006).
As shown in figure 1.2, nutrient stimuli such as glucose, amino acids and FFAs,
get shuttled into the P-cell through their respected transporters. Once inside the cell, the
glucose and amino acids (via pyruvate) undergo glycolysis in the mitochondria increasing
intracellular levels of ATP (Las et al. 2006; Nolan et al. 2006). The increase in
intracellular ATP causes ATP-sensitive K+ channels to close, depolarizing the cell and
increasing membrane potential; subsequently opening Ca2+ channels and causing an

10

influx of Ca2+ into the cell (Henquin 2000; Nolan et al. 2006). The increase in
intracellular Ca2+, activates a calmodulin cascade and release of insulin from secretory
granules that undergo exocytosis (Henquin 2000) (Fig 1.2). Additionally, the binding of
FFAs to the free fatty acid receptor-1/G-coupled receptor-40 (FFAR1/GPR40) receptors
on the P-cell membrane causes an increase in intracellular Ca2+ further stimulating the
calmodulin cascade and release of insulin (Prentki and Nolan 2006) (Fig 1.2).
Insulin secretion can also be stimulated by the parasympathetic nervous system
through the binding of acetylcholine (ACh) to the muscarinic receptor (M2) on the p-cell
(Kahn et al. 2006). Binding of ACh can act through either the protein kinase C (PKC)
pathway via phospholipase C or through phosphatidylinositol 3-kinase (PI-3K) and
subsequent increase in Ca2f to stimulate insulin secretion (Kahn et al. 2006; Nolan and
Prentki 2008). Moreover, the insulin secretion from the P-cell is also stimulated
hormonally through the binding of incretin hormones such as glucagon-like peptide 1
(GLP-1), glucagon-dependent insulinotropic peptide (GIP), pituitary adenylate cyclaseactivating polypeptide (PACAP), and vasoactive intestinal polypeptide (VIP) (Inagaki et
al. 1996; Yamamoto et al. 2003; Hoist and Gromada 2004; Kieffer 2004). For example,
binding of GLP-1 results in an increase in intracellular cyclic adenosine monophosphate
(c AMP) causing the stimulation of protein kinase A (PKA) and subsequent closure of K+
channels and depolarization of the p-cell (Kieffer 2004; Kahn et al. 2006); thus
contributing to the influx of Ca2+ and increase in intracellular Ca2f.

11

Figure 1.2 Schematic representation of insulin secretion in the pancreatic p-cell by
endogenous stimuli - modified from (Boron and Boulpaep 2005). Nutrient stimuli (such
as glucose, amino acids and FFAs) get shuttled into the p-cell through their respective
transporters. Once inside the cell, through their respective pathways, the stimuli cause an
influx of Ca2+ into the cell and release of insulin (via exocytosis of insulin secretory
granules). Once secreted insulin binds to insulin receptors and increases glucose uptake
and storage as well as increasing fat storage in adipose tissue. Abbreviations: +++ depolarization; GLUT2 - glucose 2 transporter; aa - amino acids; K+ channel; Ca2+
channels; ATP - adenosine triphosphate; FFAR1/GPR40 - free fatty acid receptor-l/Gcoupled receptor-40; FFA - free fatty acid.

12

Arginine & Lysine potentiate Glucose
entry into the fl-ceil
Insulin released
via exocytosis
O

o o n o
°o 0
G O
A

FFAR1/GPR40

A.A such as
can enter p-ce.

glucose

U3
via pyruvate§
Calmodulin Cascade

Closure of K+ Channel
Ca2+

Ca2
Insulin binds to

Ca2*

Ca2

receptor

0

ATP sensitive K+
channels
++++++++++++

v_yca2+
Insulin acts on peripheral tissues
for glucose uptake and storage
well as increasing fat storage in
adipose tissue

Once secreted, insulin binds to insulin receptors on peripheral tissues such as
muscle, liver and fat tissue, and stimulates tyrosine kinase activity and subsequent
phosphorylation of insulin receptor substrates 1 (IRS-1) and IRS-2 (Aspinwall et al.
2000). This phosphorylation leads to activation of the phosphatidylinositol 3-kinase
(PI3K) pathway and production of downstream intermediates (Summers 2006). One
example of a downstream target of this insulin signal transduction cascade is stimulation
of the translocation of glucose transporter 4 (GLUT4), expressed in both muscle and
adipose tissue, from the cytoplasm to the cell membrane allowing the influx of glucose
into the cell for glycolysis or storage (Rose and Richter 2005; Summers 2006) (Fig 1.2).
Another molecular action of insulin signaling is its ability to increase the action of
lipoprotein lipase (LPL) to promote the storage of FA within the adipocytes (Razani et al.
2008). As highlighted above, insulin secretion and insulin signaling are complex
pathways regulated by many stimuli and affecting many molecular targets; therefore
disruptions to the signal transduction pathways in a variety of cell types can be
detrimental to whole-body carbohydrate metabolism.
There is great debate in the literature about what comes first in the pathogenesis
of T2D: insulin resistance or P-cell dysfunction? Both etiologies are characteristic of
obesity-induced T2D and P-cell dysfunction required for the progression to T2D. Insulin
resistance is a hallmark of the pre-diabetic state and is thought to be a critical
pathophysiological event in the development of obesity-induced diabetes. As discussed
above, changes in adipokine secretion, lipid storage and inflammatory profiles in obesity
induce peripheral insulin resistance, resulting in compensatory hypersecretion of insulin
from pancreatic P-cells to maintain glucose homeostasis (Prentki and Nolan 2006). If p~

14

cell function cannot maintain compensatory increases in insulin secretion impaired
glucose tolerance results and T2D develops (Fig. 1.3) (Gehrmann et al. 2010; Giacca et
al. 2011). Hyperglycemia itself can also contribute to the activation of inflammatory
pathways involving NF-KB and PKC through increased production of reactive oxygen
species (ROS) (Lau et al. 2005) further contributing to p-cell dysfunction. Furthermore,
ineffective insulin action effects lipoprotein metabolism due to a decrease in LPL action
and decreased suppression of lipolysis resulting in increased small dense low-density
lipoprotein (LDL) and decreased high-density lipoprotein (HDL) levels (Razani et al.
2008).

1.5 Pancreatic p-cell dysfunction: the lipotoxic hypothesis
As discussed above, acute exposure of p-cells to free fatty acids (FFAs) is a
physiological stimulus for normal insulin secretion and P-cell function (Nolan et al.
2006). However, it is well established that chronic exposure of p-cells to high levels of
FFAs is detrimental to P-cell health (Lee et al. 2007; Giacca et al. 2011). For example,
Kim and colleagues (2003) showed that reducing circulating lipid in a genetic mouse
model of insulin resistance and diabetes (the MKR mouse model - skeletal musclespecific impairment of IGF-1 receptor) using a hyperlipidemic agent (a fibrate) improved
the diabetic state of this animal; suggesting that high circulating is associated with p-cell
dysfunction (Kim et al. 2003). Excessive amounts of FFAs within the P-cell have been
shown to interrupt glucose-stimulated insulin secretion and increase rates of apoptosis
(Bonora 2008; Morgan 2009).

15

Figure 1.3 Obesity is known to cause insulin resistance and P-cell dysfunction - modified
from (Kasuga 2006; Shoelson et al. 2007). Adipose tissue in the obese state contributes to
altered adipokine profiles, and lipid accumulation in non-adipose tissues, causing insulin
resistance and P-cell dysfunction. In the insulin resistant state, pancreatic islets make
more insulin (hyperinsulinemia) to maintain normal glucose homeostasis. The islets
"tire" from over-producing insulin and eventually fail resulting in T2D.
Abbreviations: T2D - type 2 diabetes.

16

Obese Adipose Tissue

Altered adipokine profile;
t macrophage accumulation

I Adiponectin, TLeptin.

in obese adipose tissue

T proinflammatory mediators

Adipocyte hypertrophy results in
lipid "spillover
-•accumulation of lipids in nonadipose tissue (lipotoxicity)

INSULIN RESISTANCE
fkell Compensation

fkell Failure and T2D

Pancreatic Islets

Ri m m
vawSMM
if ,>i: -M
Insulin
secretion
by jkells

Normal

HYPERINSUUNEMIA

Blood Glucose

17

Decreased

For instance, increased levels of FAs within the P-cell have been shown to modify the
expression of uncoupling protein-2 (UCP2) which is linked to the subsequent decrease in
ATP production (van Herpen and Schrauwen-Hinderling 2008), disrupting insulin
secretion (Poitout and Robertson 2008).
Mediators of FAs including long-chain acyl-CoAs (LC-CoA) have been
implicated in hyperpolarizing the p-cell (reducing the influx of Ca2+ into the P-cell) as
well as downregulating the PKC pathway, further disrupting the exocytosis of insulin
(van Herpen and Schrauwen-Hinderling 2008). Moreover, FFAs have also been linked to
increased apoptosis by enhancing ROS production and cellular stress (Prentki and Nolan
2006) further contributing to P-cell dysfunction. Interestingly, studies involving GPR40
knockout mice showed a reduction in hyperglycemia, hyperinsulinemia when on normal
chow or high fat diet (Steneberg et al. 2005); thus providing further evidence that FAs
shuttled into the p-cell, in excess, can have detrimental effects on P-cell function and
whole-body carbohydrate metabolism. More recent studies involving the GPR40
knockout mouse have shown that in response to endogenous stimuli in both the fasted
and fed states, insulin secretion is impaired in these mice (Latour et al. 2007; Alquier et
al. 2009). Combined, these studies have suggested GPR40 signaling pathways to be
responsible for the potentiating effects of FAs on insulin secretion (Latour et al. 2007;
Alquier et al. 2009).
There is increasing evidence that the type of lipid accumulating within the P-cell
may affect toxicity and p-cell failure (Virtue and Vidal-Puig 2010). In vitro studies
involving the INS-IE or MIN6 p-cell lines have shown higher rates of apoptosis when
treated with the saturated FA palmitate versus the unsaturated FA oleate (Furukawa et al.

18

1999; Karaskov et al. 2006; Frigerio et al. 2010). For example, the accumulation of
diacylglycerols (DAGs) and ceramides in pancreatic p-cells and peripheral tissues have
been shown to cause detrimental effects and may be key intermediates in lipotoxic
induced p-cell failure and insulin resistance (Chavez and Summers 2010; Virtue and
Vidal-Puig 2010). Itani and colleagues (2002) have suggested that DAGs, rather than
ceramides, were primary mediators of lipid-induced insulin resistance using lipidinfusion studies in whole animals (Itani et al. 2002). Conversely, Chavez and colleagues
(2003) have shown endogenous ceramides were required for inhibitory effects of longchain saturated fatty acids on insulin signaling (Chavez et al. 2003) and Holland and
colleagues (2007) further showed that modulating ceramide levels utilizing myriocin (a
potent inhibitor of sphingosine biosynthesis) in obese rodents, ameliorates insulin
resistance and subsequent development of diabetes (Holland et al. 2007). Therefore the (3cell is an attractive target for improved therapeutics and new treatment paradigms.
This introductory chapter has highlighted the effects of obesity on peripheral
insulin resistance and p-cell dysfunction through the "lipotoxic" accumulation of lipids.
To summarize, increases in adiposity causes changes in adipokine profiles and levels of
FAs accumulating and being metabolized in non-adipose tissues. These lipotoxic
disturbances have a strong association with increased rates of insulin resistance and P-cell
dysfunction in obese individuals through the disruption of various signaling pathways
involved. The impact of lipotoxic lipid accumulation and metabolism in pancreatic Pcells under conditions of obesity is the focus of my thesis. My work will help elucidate
the mechanisms involved in P-cell lipotoxicity and may identify this area as a target for
improved therapeutics and treatment paradigms.

19

As such, manipulating how lipids accumulate within P-cells may be a plausible
approach to reducing lipotoxicity and preserving P-cell function. Peroxisome
proliferator-activated receptors (PPARs) are a group of nuclear transcription factors
involved in lipid metabolism (Chinetti et al. 2000; Lee et al. 2007); where PPARa has
been identified as a key regulator of genes involved in P-oxidation, FA uptake, and cooxidation (Lee et al. 2007). PPARa will be discussed in detail in chapter 3. Using an
adeno-associated virus serotype 8 (dsAAV8; discussed in detail in chapter 2) for targeted
overexpression of PPARa in the pancreatic P-cells, my project aims to manipulate lipid
metabolism in P-cells of mice on high-fat diet; with the expectation that overexpression
of PPARa would affect whole-animal carbohydrate metabolism. Moreover, this would
allow us to develop and test the lipotoxic hypothesis in an in vivo model of diet-induced
p-cell lipotoxicity and T2D. Furthermore, we will be able to look at what subset of
PPARa target genes (Acyl-CoA oxidase (AOX), carnitine palmitoyl transferase-1
(CPTl), long chain acyl-coA dehydrogenase (LCAD), and uncoupling protein-2 (UCP2))
are involved in P-oxidative pathways within the P-cells; thus allowing us to elucidate
possible mechanisms involved in protecting the p-cell from lipotoxic lipid accumulation
in an in vivo model.

1.6 Study objectives
Lipid accumulation within the p-cell of the pancreas is a key contributor to
inhibition of insulin secretion and P-cell apoptosis in the development of T2D in obesity.
As such, manipulating how lipids accumulate within p-cells may be a plausible approach
to reducing lipotoxicity and preserving p-cell function. The main objectives of this study
are:

20

1. To establish whether associated-adeno virus serotype 8 (dsAAV8) is an
effective and feasible targeted gene delivery tool to generate in vivo animal
models overexpressing proteins of interest specifically in pancreatic P-cells to
study lipotoxcity in obesity induced T2D (Chapter 2).
2. To characterize the in vivo effects of PPARa overexpression in pancreatic Pcells on lipotoxicity in a diet-induced obese model of T2D (Chapter 3).
3. To characterize the in vivo effects of PPARa overexpression in pancreatic Pcells on lipotoxicity in a genetic model of severe obesity and T2D (db/db
mouse) (Chapter 4).

21

1.7 REFERENCES
Ahima, R. S. (2006). "Adipose tissue as an endocrine organ." Obesity (Silver Spring) 14
Suppl 5: 242S-249S.
Alquier, T., M. L. Peyot, M. G. Latour, M. Kebede, C. M. Sorensen, S. Gesta, C. Ronald
Kahn, R. D. Smith, T. L. Jetton, T. O. Metz, M. Prentki and V. Poitout (2009).
"Deletion of GPR40 impairs glucose-induced insulin secretion in vivo in mice
without affecting intracellular fuel metabolism in islets." Diabetes 58(11): 26072615.
Arner, P. (2005). "Human fat cell lipolysis: biochemistry, regulation and clinical role."
Best Pract Res Clin Endocrinol Metab 19(4): 471-482.
Aspinwall, C. A., W. J. Qian, M. G. Roper, R. N. Kulkarni, C. R. Kahn and R. T.
Kennedy (2000). "Roles of insulin receptor substrate-1, phosphatidylinositol 3kinase, and release of intracellular Ca2+ stores in insulin-stimulated insulin
secretion in beta -cells." J Biol Chem 275(29): 22331-22338.
Bonora, E. (2008). "Protection of pancreatic beta-cells: is it feasible?" Nutr Metab
Cardiovasc Pis 18(1): 74-83.
Boron, W. F. and E. L. Boulpaep (2005). Medical physiology : a cellular and molecular
approach. Philadelphia, Pa., Elsevier Saunders, pg 1075.
Carmen, G. Y. and S. M. Victor (2006). "Signalling mechanisms regulating lipolysis."
Cell Signal 18(4): 401-408.
Cave, M. C., R. T. Hurt, T. H. Frazier, P. J. Matheson, R. N. Garrison, C. J. McClain and
S. A. McClave (2008). "Obesity, inflammation, and the potential application of
pharmaconutrition." Nutr Clin Pract 23(1): 16-34.
Ceddia, R. B. (2005). "Direct metabolic regulation in skeletal muscle and fat tissue by
leptin: implications for glucose and fatty acids homeostasis." Int J Obes (Lond)
29(10): 1175-1183.
Chavez, J. A., T. A. Knotts, L. P. Wang, G. Li, R. T. Dobrowsky, G. L. Florant and S. A.
Summers (2003). "A role for ceramide, but not diacylglycerol, in the antagonism
of insulin signal transduction by saturated fatty acids." J Biol Chem 278(12):
10297-10303.
Chavez, J. A. and S. A. Summers (2010). "Lipid oversupply, selective insulin resistance,
and lipotoxicity: molecular mechanisms." Biochim Biophvs Acta 1801(3): 252265.

22

Chinetti, G., J. C. Fruchart and B. Staels (2000). "Peroxisome proliferator-activated
receptors (PPARs): nuclear receptors at the crossroads between lipid metabolism
and inflammation." InflammRes 49(10): 497-505.
Choudhury, A. I., H. Heffron, M. A. Smith, H. Al-Qassab, A. W. Xu, C. Selman, M.
Simmgen, M. Clements, M. Claret, G. Maccoll, D. C. Bedford, K. Hisadome, I.
Diakonov, V. Moosajee, J. D. Bell, J. R. Speakman, R. L. Batterham, G. S. Barsh,
M. L. Ashford and D. J. Withers (2005). "The role of insulin receptor substrate 2
in hypothalamic and beta cell function." J Clin Invest 115(4): 940-950.
Deckelbaum, R. J. and C. L. Williams (2001). "Childhood obesity: the health issue."
Obes Res 9 Suppl 4: 239S-243S.
Dixon, J. B. (2010). "The effect of obesity on health outcomes." Mol Cell Endocrinol
316(2): 104-108.
Duncan, R. E., M. Ahmadian, K. Jaworski, E. Sarkadi-Nagy and H. S. Sul (2007).
"Regulation of lipolysis in adipocytes." Annu Rev Nutr 27: 79-101.
Eldor, R. and I. Raz (2006). "Lipotoxicity versus adipotoxicity - The deleterious effects
of adipose tissue on beta cells in the pathogenesis of type 2 diabetes." Diabetes
Research and Clinical Practice 74: S3-S8.
Esposito, K., G. Giugliano, N. Scuderi and D. Giugliano (2006). "Role ofadipokines in
the obesity-inflammation relationship: the effect of fat removal." Plast Reconstr
Surg 118(4): 1048-1057; discussion 1058-1049.
Evans, R. M., G. D. Barish and Y. X. Wang (2004). "PPARs and the complex journey to
obesity." Nat Med 10(4): 355-361.
Farese, R. V., Jr., T. J. Yost and R. H. Eckel (1991). "Tissue-specific regulation of
lipoprotein lipase activity by insulin/glucose in normal-weight humans."
Metabolism 40(2): 214-216.
Friedman, J. M. (2010). "A tale of two hormones." Nat Med 16(10): 1100-1106.
Frigerio, F., T. Brun, C. Bartley, A. Usardi, D. Bosco, K. Ravnskjaer, S. Mandrup and P.
Maechler (2010). "Peroxisome proliferator-activated receptor alpha (PPARalpha)
protects against oleate-induced INS-IE beta cell dysfunction by preserving
carbohydrate metabolism." Diabetologia 53(2): 331-340.
Furukawa, H., R. J. Carroll, H. H. Swift and D. F. Steiner (1999). "Long-term elevation
of free fatty acids leads to delayed processing of proinsulin and prohormone
convertases 2 and 3 in the pancreatic beta-cell line MIN6." Diabetes 48(7): 13951401.

23

Gehrmann, W., M. Eisner and S. Lenzen (2010). "Role of metabolically generated
reactive oxygen species for lipotoxicity in pancreatic beta-cells." Diabetes Obes
Metab 12 Suppl 2: 149-158.
Giacca, A., C. Xiao, A. I. Oprescu, A. C. Carpentier and G. F. Lewis (2011). "Lipidinduced pancreatic beta-cell dysfunction: focus on in vivo studies." Am J Physiol
Endocrinol Metab 300(2V E255-262.
Gray, S. L., E. D. Nora, J. Grosse, M. Manieri, T. Stoeger, G. Medina-Gomez, K.
Burling, S. Wattler, A. Russ, G. S. Yeo, V. K. Chatterjee, S. O'Rahilly, P. J.
Voshol, S. Cinti and A. Vidal-Puig (2006). "Leptin deficiency unmasks the
deleterious effects of impaired peroxisome proliferator-activated receptor gamma
function (P465L PPARgamma) in mice." Diabetes 55(10): 2669-2677.
Gray, S. L. and A. J. Vidal-Puig (2007). "Adipose tissue expandability in the
maintenance of metabolic homeostasis." Nutr Rev 65(6 Pt 2): S7-12.
Greenberg, A. S., R. A. Coleman, F. B. Kraemer, J. L. McManaman, M. S. Obin, V. Puri,
Q. W. Yan, H. Miyoshi and D. G. Mashek (2011). "The role of lipid droplets in
metabolic disease in rodents and humans." J Clin Invest 121(6): 2102-2110.
Haemmerle, G., A. Lass, R. Zimmermann, G. Gorkiewicz, C. Meyer, J. Rozman, G.
Heldmaier, R. Maier, C. Theussl, S. Eder, D. Kratky, E. F. Wagner, M.
Klingenspor, G. Hoefler and R. Zechner (2006). "Defective lipolysis and altered
energy metabolism in mice lacking adipose triglyceride lipase." Science
312(5774): 734-737.
Henquin, J. C. (2000). "Triggering and amplifying pathways of regulation of insulin
secretion by glucose." Diabetes 49(11): 1751-1760.
Hoehn, K. L., C. Hohnen-Behrens, A. Cederberg, L. E. Wu, N. Turner, T. Yuasa, Y.
Ebina and D. E. James (2008). "IRS1-independent defects define major nodes of
insulin resistance." Cell Metab 7(5): 421-433.
Holland, W. L., J. T. Brozinick, L. P. Wang, E. D. Hawkins, K. M. Sargent, Y. Liu, K.
Narra, K. L. Hoehn, T. A. Rnotts, A. Siesky, D. H. Nelson, S. K. Karathanasis, G.
K. Fontenot, M. J. Birnbaum and S. A. Summers (2007). "Inhibition of ceramide
synthesis ameliorates glucocorticoid-, saturated-fat-, and obesity-induced insulin
resistance." Cell Metab 5(3): 167-179.
Hoist, J. J. and J. Gromada (2004). "Role of incretin hormones in the regulation of insulin
secretion in diabetic and nondiabetic humans." Am J Physiol Endocrinol Metab
287(2): El99-206.
Huynh, F. K., J. Levi, H. C. Denroche, S. L. Gray, P. J. Voshol, U. H. Neumann, M.
Speck, S. C. Chua, S. D. Covey and T. J. Kieffer (2010). "Disruption of hepatic

24

leptin signaling protects mice from age- and diet-related glucose intolerance."
Diabetes 59(12): 3032-3040.
Imrie, H., A. Abbas and M. Kearney (2010). "Insulin resistance, lipotoxicity and
endothelial dysfunction." Biochim Biophvs Acta 1801(3): 320-326.
Inagaki, N., H. Kuromi and S. Seino (1996). "PACAP/VIP receptors in pancreatic betacells: their roles in insulin secretion." Ann N Y Acad Sci 805: 44-51; discussion
52-43.
Itani, S. I., N. B. Ruderman, F. Schmieder and G. Boden (2002). "Lipid-induced insulin
resistance in human muscle is associated with changes in diacylglycerol, protein
kinase C, and IkappaB-alpha." Diabetes 51(7): 2005-2011.
JeBailey, L., O. Wanono, W. Niu, J. Roessler, A. Rudich and A. Klip (2007). "Ceramideand oxidant-induced insulin resistance involve loss of insulin-dependent Racactivation and actin remodeling in muscle cells." Diabetes 56(2): 394-403.
Kahn, S. E., R. L. Hull and K. M. Utzschneider (2006). "Mechanisms linking obesity to
insulin resistance and type 2 diabetes." Nature 444(7121): 840-846.
Karaskov, E., C. Scott, L. Zhang, T. Teodoro, M. Ravazzola and A. Volchuk (2006).
"Chronic palmitate but not oleate exposure induces endoplasmic reticulum stress,
which may contribute to INS-1 pancreatic beta-cell apoptosis." Endocrinology
147(7): 3398-3407.
Kasuga, M. (2006). "Insulin resistance and pancreatic beta ccll failure." J Clin Invest
116(7): 1756-1760.
Kershaw, E. E. and J. S. Flier (2004). "Adipose tissue as an endocrine organ." J Clin
Endocrinol Metab 89(6): 2548-2556.
Kieffer, T. J. (2004). "Gastro-intestinal hormones GIP and GLP-1." Ann Endocrinol
(Paris) 65(1): 13-21.
Kim, H., M. Haluzik, Z. Asghar, D. Yau, J. W. Joseph, A. M. Fernandez, M. L. Reitman,
S. Yakar, B. Stannard, L. Heron-Milhavet, M. B. Wheeler and D. LeRoith (2003).
"Peroxisome proliferator-activated receptor-alpha agonist treatment in a
transgenic model of type 2 diabetes reverses the lipotoxic state and improves
glucose homeostasis." Diabetes 52(7): 1770-1778.
Kusminski, C. M., S. Shetty, L. Orci, R. H. Unger and P. E. Scherer (2009). "Diabetes
and apoptosis: lipotoxicity." Apoptosis 14(12): 1484-1495.

25

Laclaustra, M., D. Corella and J. M. Ordovas (2007). "Metabolic syndrome
pathophysiology: the role of adipose tissue." Nutr Metab Cardiovasc Pis 17(2):
125-139.
Lago, F., C. Dieguez, J. Gomez-Reino and O. Gualillo (2007). "The emerging role of
adipokines as mediators of inflammation and immune responses." Cytokine
Growth Factor Rev 18(3-4): 313-325.
Langin, D., A. Dicker, G. Tavernier, J. Hoffstedt, A. Mairal, M. Ryden, E. Arner, A.
Sicard, C. M. Jenkins, N. Viguerie, V. van Harmelen, R. W. Gross, C. Holm and
P. Arner (2005). "Adipocyte lipases and defect of lipolysis in human obesity."
Diabetes 54(11): 3190-3197.
Las, G., N. Mayorek, K. Dickstein and J. Bar-Tana (2006). "Modulation of insulin
secretion by fatty acyl analogs." Diabetes 55(12): 3478-3485.
Latour, M. G., T. Alquier, E. Oseid, C. Tremblay, T. L. Jetton, J. Luo, D. C. Lin and V.
Poitout (2007). "GPR40 is necessary but not sufficient for fatty acid stimulation
of insulin secretion in vivo." Diabetes 56(4): 1087-1094.
Lau, D. C., B. Dhillon, H. Yan, P. E. Szmitko and S. Verma (2005). "Adipokines:
molecular links between obesity and atheroslcerosis." Am J Physiol Heart Circ
Physiol 288(5): H2031-2041.
Lee, Y., M. Ravazzola, B. H. Park, Y. K. Bashmakov, L. Orci and R. H. Unger (2007).
"Metabolic mechanisms of failure of intraportally transplanted pancreatic betacells in rats: role of lipotoxicity and prevention by leptin." Diabetes 56(9): 22952301.
Lewis, G. F., A. Carpentier, K. Adeli and A. Giacca (2002). "Disordered fat storage and
mobilization in the pathogenesis of insulin resistance and type 2 diabetes." Endocr
Rev 23(2): 201-229.
Morgan, N. G. (2009). "Fatty acids and beta-cell toxicity." Curr Opin Clin Nutr Metab
Care 12(2): 117-122.
Muoio, D. M. and G. Lynis Dohm (2002). "Peripheral metabolic actions of leptin." Best
Pract Res Clin Endocrinol Metab 16(4): 653-666.
Nolan, C. J., M. S. Madiraju, V. Delghingaro-Augusto, M. L. Peyot and M. Prentki
(2006). "Fatty acid signaling in the beta-cell and insulin secretion." Diabetes 55
Suppl 2: S16-23.
Nolan, C. J. and M. Prentki (2008). "The islet beta-cell: fuel responsive and vulnerable."
Trends Endocrinol Metab 19(8): 285-291.

26

Otero, M., R. Lago, R. Gomez, F. Lago, C. Dieguez, J. J. Gomez-Reino and O. Gualillo
(2006). "Changes in plasma levels of fat-derived hormones adiponectin, leptin,
resistin and visfatin in patients with rheumatoid arthritis." Ann Rheum Pis 65(9):
1198-1201.
Poitout, V. and R. P. Robertson (2008). "Glucolipotoxicity: fuel excess and beta-cell
dysfunction." Endocr Rev 29(3): 351-366.
Prentki, M. and C. J. Nolan (2006). "Islet beta cell failure in type 2 diabetes." J Clin
Invest 116(7): 1802-1812.
Razani, B., M. V. Chakravarthy and C. F. Semenkovich (2008). "Insulin resistance and
atherosclerosis." Endocrinol Metab Clin North Am 37(3): 603-621, viii.
Rose, A. J. and E. A. Richter (2005). "Skeletal muscle glucose uptake during exercise:
how is it regulated?" Physiology (Bethesda) 20: 260-270.
Rosen, E. D. and B. M. Spiegelman (2006). "Adipocytes as regulators of energy balance
and glucose homeostasis." Nature 444(7121): 847-853.
Sadur, C. N., T. J. Yost and R. H. Eckel (1984). "Insulin responsiveness of adipose tissue
lipoprotein lipase is delayed but preserved in obesity." J Clin Endocrinol Metab
59(6): 1176-1182.
Schroeder-Gloeckler, J. M, S. M. Rahman, R. C. Janssen, L. Qiao, J. Shao, M. Roper, S.
J. Fischer, E. Lowe, D. J. Orlicky, J. L. McManaman, C. Palmer, W. L. Gitomer,
W. Huang, R. M. O'Doherty, T. C. Becker, D. J. Klemm, D. R. Jensen, L. K.
Pulawa, R. H. Eckel and J. E. Friedman (2007). "CCAAT/enhancer-binding
protein beta deletion reduces adiposity, hepatic steatosis, and diabetes in
Lepr(db/db) mice." J Biol Chem 282(21): 15717-15729.
Sethi, J. K. and A. J. Vidal-Puig (2007). "Thematic review series: adipocyte biology.
Adipose tissue function and plasticity orchestrate nutritional adaptation." J Lipid
Res 48(6): 1253-1262.
Shoelson, S. E., L. Herrero and A. Naaz (2007). "Obesity, inflammation, and insulin
resistance." Gastroenterology 132(6): 2169-2180.
Shoelson, S. E., J. Lee and A. B. Goldfine (2006). "Inflammation and insulin resistance."
J Clin Invest 116(7): 1793-1801.
Smyth, S. and A. Heron (2006). "Diabetes and obesity: the twin epidemics." Nat Med
12(1): 75-80.
Spiegelman, B. M. (1998). "PPAR-gamma: adipogenic regulator and thiazolidinedione
receptor." Diabetes 47(4): 507-514.

27

Steneberg, P., N. Rubins, R. Bartoov-Shifman, M. D. Walker and H. Edlund (2005). "The
FFA receptor GPR40 links hyperinsulinemia, hepatic steatosis, and impaired
glucose homeostasis in mouse." Cell Metab 1(4): 245-258.
Summers, S. A. (2006). "Ceramides in insulin resistance and lipotoxicity." Prog Lipid
Res 45(1): 42-72.
Suzuki, A., S. Okamoto, S. Lee, K. Saito, T. Shiuchi and Y. Minokoshi (2007). "Leptin
stimulates fatty acid oxidation and peroxisome proliferator-activated receptor
alpha gene expression in mouse C2C12 myoblasts by changing the subcellular
localization of the alpha2 form of AMP-activated protein kinase." Mol Cell Biol
27(12): 4317-4327.
Unger, R. H. (2002). "Lipotoxic diseases." Annu Rev Med 53: 319-336.
Unger, R. H. (2005). "Longevity, lipotoxicity and leptin: the adipocyte defense against
feasting and famine." Biochimie 87(1): 57-64.
van Herpen, N. A. and V. B. Schrauwen-Hinderling (2008). "Lipid accumulation in nonadipose tissue and lipotoxicity." Physiol Behav 94(2): 231-241.
Virtue, S. and A. Vidal-Puig (2010). "Adipose tissue expandability, lipotoxicity and the
Metabolic Syndrome—an allostatic perspective." Biochim Biophvs Acta 1801(3):
338-349.
Wellen, K. E. and G. S. Hotamisligil (2005). "Inflammation, stress, and diabetes." J Clin
Invest 115(5): 1111-1119.
Wende, A. R. and E. D. Abel (2010). "Lipotoxicity in the heart." Biochim Biophvs Acta
1801(3): 311-319.
Yamamoto, K., H. Hashimoto, S. Tomimoto, N. Shintani, J. Miyazaki, F. Tashiro, H.
Aihara, T. Nammo, M. Li, K. Yamagata, J. Miyagawa, Y. Matsuzawa, Y.
Kawabata, Y. Fukuyama, K. Koga, W. Mori, K. Tanaka, T. Matsuda and A. Baba
(2003). "Overexpression of PACAP in transgenic mouse pancreatic beta-cells
enhances insulin secretion and ameliorates streptozotocin-induced diabetes."
Diabetes 52(5): 1155-1162.
Yost, T. J., K. K. Froyd, D. R. Jensen and R. H. Eckel (1995). "Change in skeletal muscle
lipoprotein lipase activity in response to insulin/glucose in non-insulin-dependent
diabetes mellitus." Metabolism 44(6): 786-790.
Zhang, Y., R. Proenca, M. Maffei, M. Barone, L. Leopold and J. M. Friedman (1994).
"Positional cloning of the mouse obese gene and its human homologue." Nature
372(6505): 425-432.

28

Zhao, Y. F., D. D. Feng and C. Chen (2006). "Contribution of adipocyte-derived factors
to beta-cell dysfunction in diabetes." Int J Biochem Cell Biol 38(5-6): 804-819.

29

CHAPTER 2

Utilizing dsAAV8 as a Tool to Overexpress Proteins Specifically in the Pancreatic PCell In Vivo

A version of this chapter has been published as an abstract:
Hogh, K-Lynn N., Uy, Christopher E., Fraser, J., Asadi, A., Baker, Robert K., Riedel,
Michael J., Gray, Sarah L. 2011. Overexpression of PPARa in pancreatic (3-cells
improves glucose tolerance in diet-induced obese mice. Canadian Journal of Diabetes.
35(4): 417. Canadian Diabetes Association AGM & Professional Meetings. Toronto ON.
Oct 26-29 2011.

30

2.1 INTRODUCTION
Transgenic or knockout mouse models have been used to study various pathways
and mechanisms involved in human diseases. Transgenic models are tools utilized to
study gene function; specifically they provide in vivo models to examine the effects of
overexpressing or knocking out genes of interest proving to be a critical link between
bedside and bench (Miesfeld 1999). Additionally, the development of the Cre/loxP
system for animal transgenics has allowed for infinite possibilities for conditional
knockouts including developmental stage and tissue-specific gene knockout (Nagy 2000).
As outlined in chapter 1, obesity has been implicated in increasing adiposity in nonadipose tissues such as the p-cells of the pancreas contributing to insulin resistance, p-cell
dysfunction and development of T2D (Kasuga 2006; Prentki and Nolan 2006; van
Herpen and Schrauwen-Hinderling 2008). Thus making the P-cell an ideal target for
elucidating the mechanisms involved in p-cell lipotoxicity in obesity-induced T2D.
Therefore mouse models for p-cell-specific overexpression or gene knockouts are very
relevant to the remainder of this study.
Tissue specific promoters such as the mouse insulin promoter (MIP) and rat
insulin promoter (RIP) have been used to develop P-cell specific transgenic mouse
models (Gannon et al. 2000; Hara et al. 2003; Dahlhoff et al. 2011) by driving the gene or
protein of interest directly to the insulin producing P-cells of the pancreas. It should be
noted that the human genome contains a single copy of the insulin gene, whereas two
variations are found in the rat (RIP1 and RIP2) (Odagiri et al. 1996; Hay and Docherty
2006). RIP1 and RIP2 vary in size (448bp and 668bp respectively), however they both
target the P-cells of the pancreas (Gannon et al. 2000; Hay and Docherty 2006). Hara et

31

al. (2003) developed transgenic mice expressing enhanced green fluorescent protein
(eGFP) in pancreatic P-cells under the direction of the MIP (Hara et al. 2003). In
addition, Hara and colleagues (2003) were able to show that under the control of MIP,
eGFP was targeted to the P-cells and not the a-cells of the pancreas utilizing FACS to
sort isolated islets (Hara et al. 2003), further confirming site-specific expression.
It should be noted that utilizing the RIP to target the P-cells of the pancreas in a
RIP-Cre transgenic has been associated with "extrapancreatic" expression in neural
tissues of the brain (Gannon et al. 2000; Dahlhoff et al. 2011). Choudhury and
colleagues (2005) were able to show expression of eGFP in the hypothalamic and
forebrain neurons in addition to the P-cells of the pancreas in their RIPCreZEG
transgenic mouse (Choudhury et al. 2005). This neuronal expression utilizing RIP-Cre
transgenic mice was further supported by the results obtained by Choi and colleagues
(2008) where RIPCre+Pte«fl,fl mice were found to be PTEN deficient in the insulin
secreting neurons in the hypothalamus and not the p-cells of the pancreas (Choi et al.
2008). Moreover, Gannon and colleagues (2000) expressed that caution needs to be
exercised when using RIP2-Cre mice, as RIP2 directs expression of the gene of interest
during embryogenesis in both the pancreas and brain, as well, the activation of RIP
during early development may interfere with the populations of cells becoming P-cells
(Gannon et al. 2000). All of this information needs to be taken into consideration when
deciding if a transgenic mouse model is the most appropriate tool for P-cell-specific gene
expression for in vivo overexpression studies.
Novel methods involving the transfer of genes into specific tissues of interest
using viral delivery have become more widely accepted and used in place of traditional

32

transgenic models. One emerging field is the use of adeno-associated viruses as a mode
of viral gene delivery. Currently, three classifications of adeno-associated viruses exist:
single stranded adeno-associated virus (AAV), recombinant adeno-associated virus
(rAAV) and the double-stranded adeno-associated virus (dsAAV) (Wang et al. 2004; Wu
et al. 2006); in addition there are several serotypes and hundreds of variations of AAVbased vectors (Wu et al. 2006).
Adeno-associated viruses are small, non-pathogenic, non-replicating, members of
the Parvovirdiae family, requiring a helper virus for appropriate infection and sitespecific integration into tissues of interest (Wang et al. 2004; Inagaki et al. 2006; Wu et
al. 2006). AAVs also exhibit low immune response, as well they can be used to transfect
both dividing and non-dividing cell types (Gao et al. 2002; Gaddy et al. 2010; Riedel et
al. 2010), making them an ideal and efficient tool for viral-mediated gene delivery.
Tissue-specific delivery of the AAVs is dependent on the serotype capsid with which it is
associated (Inagaki et al. 2006). Serotypes and their tissue specificity include: AAV1
(CNS, skeletal muscle and adipose tissue), AAV2 (kidney), AAV4 (CNS, and
photoreceptors), AAVS (CNS, and photoreceptors), AAV6 (skeletal muscle), AAV7
(skeletal muscle), AAV8 (skeletal muscle, liver, heart and pancreas) and AAV9 (skeletal
muscle, liver, lung) (Chao et al. 2000; Gao et al. 2002; Loiler et al. 2003; Wang et al.
2004; Wu et al. 2006). Given AAV8 delivery is directed at tissues in the gut, therefore,
site-specific delivery to the p-cells of the pancreas could be enhanced utilizing tissue
specific promoters such as MIP or RIP (Wu et al. 2006).
Based on the various tissue types dsAAVs can target as well as their low immune
response, dsAAVs are becoming an increasingly attractive tool for gene therapy.

33

Recently, Gaddy and colleagues (2011) have utilized dsAAV8 driven by MIP to target
interleukin-4 (IL-4) as well as combinations of glucagon-like peptide-1 and hepatocyte
growth factor/NKl with IL-4 to the pancreatic P-cells in NOD mice (model of T1D)
(Gaddy et al. 2011). Using dsAAV8, they were able to demonstrate that IL-4 as well as
the various combinations (GLP-1 + IL-4 and NK1 + IL-4) reverse hyperglycemia in
NOD mice through a single ip injection (Gaddy et al. 2011). Moreover, Montane and
colleagues (2011) utilized dsAAV8 to target CCL22 (recruits Treg cells) to the p-cells of
NOD mice, through an intraductal injection (Montane et al. 2011). Their results suggest
that increasing expression of CCL22 in the pancreatic P-cells attenuates the autoimmune
destruction of P-cells associated in T1D through the increased recruitment of Tregs
(Montane et al. 2011). Combined, these studies show the remarkable potential of
utilizing dsAAVs for human gene therapy.
Double-stranded adeno-associated (dsAAV) viral vectors have been used as non­
invasive tools for tissue-specific gene delivery to pancreatic p-cells. Extensive in vivo
studies were conducted administering eGFP with various AAV serotypes under the
direction of MIP to C57B16 mice via intraperitoneal, intraductal, and intravenous
injection (Wang et al. 2006). Wang and colleagues (2006) concluded that viral delivery
via interperitoneal injections were as effective as intraductal and intravenous when viral
dose was increase to 5x10" viral/genomes per mouse (Wang et al. 2006); moreover
dsAAV8 was more effective than dsAAVl, dsAAV2, dsAAV5 and dsAAV6 when
targeting the pancreatic p-cells (Wang et al. 2006). In addition gene expression in
pancreatic islets was observed for four months post infection via intraperitoneal injection
(Wang et al. 2006). More recently, Kieffer and colleagues (2011) have conducted long-

34

term expression studies, showing expression of dsAAV8-MIP-eGFP in the pancreatic Pcells one year post-infection (Kieffer, TJ - personal communication).
Furthermore, under the direction of MIP, Wang and colleagues did not detect
eGFP expression in brain tissue of infected mice (Wang et al. 2006), indicating that using
dsAAV8-MIP or dsAAV8-RIP to target pancreatic P-cells is an effective method for gene
delivery without crossing the blood brain barrier. It should be noted that previous studies
have indicated that utilizing dsAAV8 under the direction of MIP or RIP may cross the
BBB due to dsAAV8's ability to increase vascular permeability in endothelial cell lining
of blood vessels (Inagaki et al. 2006; Wu et al. 2006); further studies investigating the
vasculature leakiness of dsAAV8 is required.
More recently, Gaddy and colleagues (2010) have been able to successfully
overexpress eGFP within pancreatic P-cells without causing changes in body weight or
carbohydrate metabolism utilizing dsAAV8 (Gaddy et al. 2010; Riedel et al. 2010).
These studies demonstrate using dsAAV8-RIP-eGFP as a control vector for in vivo
overexpression studies is an appropriate tool for viral-mediated tissue specific gene
delivery. Moreover, the use of dsAAV8 allows for targeted gene delivery at any stage in
the rodent's life; essentially providing a model of "inducible transgenics" without the
complications associated with conventional transgenic mouse models. Additionally
dsAAV8 can be delivered prior to or after a treatment such as high fat diet; as well it can
be delivered to various mouse breeds including the "standard" C57B16 or various
transgenic models including db/db or ob/ob mouse (to be discussed in chapter four).
The objective of this study is to establish an in vivo model and protocol of viralmediated gene delivery in our lab. This study will serve as control for data collection and

35

analysis prior to characterizing the in vivo effects of dsAAV8-RIP-PPARa
overexpression in p-cell lipotoxicity in a diet-induced obese model of T2D.

36

2.2 MATERIALS AND METHODS
Mice.
All animal studies were approved by the University of Northern British Columbia
Animal Care and Use Committee (protocol number 2011-21). For all experiments, 6week-old, male, C57B16 mice were purchased from Charles River Laboratories
(Wilmington MA, USA) unless otherwise stated. Mice were maintained on a 12 hr
light/dark cycle and received standard rodent chow diet (Rodent LabDiet, 5001, Leduc
AB, Canada) ad libitum unless otherwise stated. Mice were allowed to acclimatize to the
animal facility for 1 week prior to performing any experimental procedures. Body weight,
4hr fasted blood glucose (OneTouch Ultra, Lifescan, Burnaby BC, Canada), oral glucose
tolerance tests (OGTT) and insulin tolerance tests (ITT) were performed prior to viral
injections to assess baseline carbohydrate metabolism.
Double-stranded adeno-associated virus serotype 8.
dsAAV8 transfer vectors were designed utilizing the rat insulin 1 promoter (RIP)
(410 bp) placed upstream of either a sequence encoding eGFP (720bp) or the PPARa
(1407bp) open reading frame, followed by the SV40 polyadenylation signal. Complete
RIP-eGFP (5328bp) and RIP-PPARa (6015bp) vectors were sent to Children's Hospital
of Philadelphia (CHOP) Research Vector Core Services (Philadelphia PA, USA) for
AAV8 virus preparation.
Pancreatic p-cell specific expression of eGFP.
At 8 wks of age, C57B16 mice were infected with dsAAV8-RIP-eGFP virus by ip
injection (n=7; 5xl012 viral genomes/284 |il/mouse) (P-eGFP-Chow) and control mice
(saline) were given an ip injection of saline (n=7; 284(il/mouse) (Gaddy et al. 2010;

37

Riedel et al. 2010) (Fig. 2.1). Body weights, glucose tolerance and insulin sensitivity
were assessed prior to and three weeks post-infection. Three weeks post-infection
animals were sacrificed and pancreas was collected and stored in 4% paraformaldehyde
for immunohistological analysis.
Insulin tolerance tests.
Mice were fasted for 4hrs and given an ip injection of human synthetic insulin at
0.75U/kg or l.OU/kg (Novolin Ge, Toronto ON, Canada). Blood was sampled (l-2|il)
from the saphenous vein and blood glucose measured (mmol/L) at 10, 20 30, 60, and 120
min post injection, using a handheld glucometer (OneTouch Ultra Lifescan, Burnaby BC,
Canada).
Oral glucose tolerance and glucose-stimulated insulin secretion.
Mice were fasted for 16 hrs and given 2g/kg D-glucose by oral gavage. Blood
(15-20(^1) was sampled at 5, 10 and 180 minutes post glucose gavage from the saphenous
vein and blood glucose (mmol/L) measured in 1-2(^1 blood at 5, 10, 30, 60, 120 and 180
minutes post gavage using a handheld glucometer (OneTouch Ultra Lifescan, Burnaby
BC, Canada) (Huynh et al. 2010).
Immunohistological analysis.
Whole mouse pancreas were fixed in 4% paraformaldehyde, embedded in paraffin
and sectioned (5^m); n=5 per group (Wax-it Histology Services; Vancouver BC,
Canada). All sections were de-paraffinized in xylene, rehydrated in ethanol (100%, 95%,
and 70%) and rinsed in lxPBS as described previously (Riedel et al. 2010). Sections
were incubated with polyclonal primary antibody to rabbit anti-eGFP (1:500) (Al 1122,
Invitrogen Molecular Probes, Carlsbad CA, USA), polyclonal guinea pig anti-insulin

38

(1:1000) (4011-0IF, Millipore, Billerica MA, USA) and a monoclonal primary antibody
to mouse anti-glucagon (1:1000) (G2654, Sigma, Oakville ON, Canada) overnight.
Appropriate secondary whole (heavy and light chain) antibodies conjugated to Alexafluor
488 (A21206 or A21202) or 594 (A11076 or A11032) (1:1000) (Invitrogen Molecular
Probes, Carlsbad CA, USA) were used to detect primary antibody immunoreactivity. All
samples were visualized using a fluorescent light microscope (Olympus BX61) and
images analyzed using Cell Sens Software (Olympus, Markham ON, Canada).
Western blot analysis.
Hypothalamus, liver, intestine, and skeletal muscle samples were collected and
flash frozen. Protein was extracted using RIPA buffer (Thermo Scientific, Rockford IL,
USA) and quantified using a BCA assay (Thermo Scientific, Rockford IL, USA). Protein
(30|4.g) was separated on a 12% SDS-PAGE gel and transferred to a PVDF membrane
(Millipore, Billerica MA, USA). Membranes were blocked with 5% non-fat dry milk in
TBS-Tween 20 followed by overnight incubations with a polyclonal primary antibody to
rabbit anti-eGFP (1:1000) (A11122, Invitrogen Molecular Probes, Carlsbad CA, USA), a
monoclonal primary antibody to mouse anti-P-Actin (A5441, Sigma, Oakville ON,
Canada), or a monoclonal primary antibody to mouse anti-a-tubulin (1:3000) (T8203,
Sigma, Oakville ON, Canada) were used to normalize protein levels. Secondary
horseradish peroxidase-conjugated antibodies (1:5000) (anti-rabbit IgG A4914, antimouse IgG, A8924, Sigma, Oakville ON, Canada) were incubated for lhr and visualized
by chemiluminescence (Amersham ECL plus, Baie d'Urfe QC, Canada) using the
Carestream Software and Kodak Imager (4000MM Pro) (Kodak, Woodbridge CT, USA).

39

Statistical analysis.
Results are expressed as mean ± standard error of the mean. Analyses were
performed using paired student's t-test and 1-way ANOVA (significance between two
groups), or 2-way ANOVAs (significance between groups over time) with Bonferoni
Post tests using Graphpad Prism 5.0 software (La Jolla CA, USA). Significance was
declared if p-values were less than 0.05.

40

Figure 2.1 In vivo experimental approach establishing effects of overexpressing dsAAV8RIP-eGFP in pancreatic p-cells in mice. Four-month-old male C57B16 mice were
infected with either dsAAV8-RIP-eGFP (P-eGFP-Control) (5.0xl012 viral
genomes/mouse) or saline (284|J/mouse). Body weights (weekly), 4hr fasted blood
glucose readings (biweekly), oral glucose tolerance (end point), and insulin tolerance
(end point) were assessed. Additionally western blot analysis was utilized to determine if
eGFP was being expressed in other tissues other than pancreatic P-cells. Abbreviations:
dsAAV8 - double stranded adeno-associated virus serotype 8; RIP - rat insulin promotor;
eGFP - enhanced green fluorescent protein.

41

dsAAV8-RIP-eGFP
Ip injection dO

Saline
Baseline characteristics:
- Body weight
- OGTT
-ITT

Weekly Monitoring:
- Body weight
- 4hr FBG (Biweekly)

42

2.3 RESULTS
Overexpression of dsAAV8-RIP-eGFP is targeted to P-cells and not the a-cells of the
pancreas.
Immunohistochemical analysis of pancreas sections collected from dsAAV8-RIPeGFP infected mice show eGFP immunofluorescence colocalized with insulin
immunofluorescence (Fig. 2.2a) as indicated by the green and red overlay; whereas no
colocalization was observed between eGFP and glucagon immunofluorescence (Fig.
2.2b). These results are supported by previous studies from Gaddy et al (2010) and Riedel
et al (2010); further confirming that eGFP protein expression using dsAAV8-RIP-eGFP
is localized to the P-cell with no expression in the a-cell of the islets or the exocrine
tissue of the pancreas. As expected, no eGFP expression was observed in pancreatic
sections collected from saline infected mice. Moreover, eGFP was found to be expressed
in 60% of the total islet area in eGFP infected islets from an ip injection (Fig 2.2c).
Pancreatic p-cell specific overexpression of eGFP driven by the rat insulin promoter
does not cross the blood brain barrier.
Due to the observation that RIP-Cre transgenic mice have been shown to drive
recombination of conditional gene knockouts in hypothalamic neurons as well as
pancreatic p-cells (Choudhury et al. 2005; Choi et al. 2008), we examined if eGFP
expressed from dsAAV8-RIP-eGFP and delivered by dsAAV8 was expressed in
hypothalamic neurons of dsAAV-RlP-eGFP infected mice. Western analysis of protein
extracts from hypothalamic tissue we detected no expression of eGFP suggesting the
adeno-associated virus did not cross the BBB or the RIP promoter was not active in
neurons of the hypothalamus in these mice (Fig. 2.3).

43

Figure 2.2 Immunohistochemical analysis to detect eGFP overexpression in pancreatic Pcells. Overexpression of dsAAV8-RIP-eGFP shows targeted expression of eGFP in Pcells (A) and not a-cells (B) of the pancreas of C57B16 mice. (C) Percentage of eGFP
immunoreactive area in total islet area. Abbreviations: dsAAV8 - double stranded adenoassociated virus serotype 8; RIP - rat insulin promotor; eGFP - enhanced green
fluorescent protein; INS - insulin; GLC - glucagon . Saline-treated n=7, P-eGFP-Control
n=7. Images taken at 20x magnification. Scale bar 50p.m.

44

n
Percent of eGFP positive area in total islet area

Saline

(J-eGFP-Control

Saline

(3-eGFP-Control

03

Figure 2.3 Western blot analysis of dsAAV8-RIP-eGFP expression in non-pancreatic
tissues. Overexpressing dsAAV8-RIP-eGFP in pancreatic p-cells does not cross the BBB
showing no expression in the hypothalamus. 30]ig of protein per sample was loaded and
run (see methods); (3-Actin was utilized as a protein control. Abbreviations: dsAAV8 double stranded adeno-associated virus serotype 8; RIP - rat insulin promotor; eGFP enhanced green fluorescent protein; NT - non-transfected MIN6 cells; (-) negative
control; eGFPM - eGFP transfected MIN6 cells; (+) positive control.

46

+

eGFPM HI

Saline

H2

P eGFP Control

H3

HI

H2
p-Actin

eGFP

47

Overexpression of dsAAV8-RIP-eGFP is not expressed in skeletal muscle or liver.
We examined expression of eGFP in peripheral tissues (liver, intestine and
skeletal muscle) of mice that received virus carrying dsAAV8-RIP-eGFP and saline
control mice, using western blot analysis. No eGFP expression was observed in skeletal
muscle or intestine protein extracts in both dsAAV8-RIP-eGFP expressing mice and
saline control mice. Non-specific bands were observed in skeletal muscle and liver
protein extracts of both |3-eGFP-control and saline mice (Fig. 2.4). It should be noted that
the increased brightness observed in liver protein extracts raised concern and required
further investigation as dsAAV8 has been reported to target liver and skeletal muscle
tissue in addition to the pancreas (Chao et al. 2000; Gao et al. 2002; Wang et al. 2004;
Wu et al. 2006); therefore we had to confirm if the non-specific bands were real.
To do this, we decided to perform immunohistochemical analysis using the same
antibodies utilized of the western blot. Skeletal muscle and liver tissue samples of both
P-eGFP-control and saline mice were sectioned and stained for eGFP using
immunohistochemistry. It was observed that eGFP was not expressed in either skeletal
muscle or liver tissue (Fig. 2.5a) in both P-eGFP-control and saline mice. Intensity of
eGFP observed was identical to the background staining in the no primary (1°) antibody
control. As an additional control for immune reactivity, pancreatic sections (Fig. 2.5b)
were stained for eGFP and insulin. This allowed us to confirm that under the same
conditions and concentrations the antibody to eGFP and blocking solutions utilized for
immunohistochemical analysis was able to detect eGFP in pancreatic P-cells as
previously shown.

48

Figure 2.4 Western blot analysis of dsAAV8-RJP-eGFP expression in non-pancreatic
tissues. Overexpressing dsAAV8-RIP-eGFP in pancreatic P-cells does not target skeletal
muscle or intestine. Non-specific binding of eGFP was observed in liver tissue in both
dsAAV8-RIP-eGFP mice and saline controls. 30(ig of protein per sample was loaded and
run (see methods); P-Actin was utilized as a protein control. Abbreviations: dsAAV8 double stranded adeno-associated virus serotype 8; RIP - rat insulin promotor; eGFP enhanced green fluorescent protein; NT - non-transfected MIN6 cells; (-) negative
control; eGFPM - eGFP transfected MIN6 cells; (+) positive control; SKM - skeletal
muscle.

49

Liver

SKM
eGFPM

Saline eGFP

Intestine

Saline eGFP Saline eGFP

3-Actin

eGFP

50

Figure 2.5 Immunohistoehemical analysis of dsAAV8-RIP-eGFP overexpression in non­
pancreatic tissues. Staining revealed no eGFP expression in liver (A) or skeletal muscle
(B) tissues above background staining (secondary antibody AF488 only) in p-eGFPControl mice when compared to saline controls. Pancreas sections (C) were stained as
positive controls to show level of eGFP expression when cells are overexpressing eGFP.
Abbreviations: dsAAV8 - double stranded adeno-associated virus serotype 8; RIP - rat
insulin promotor; eGFP - enhanced green fluorescent protein; 10 - primary; CNTRL control. Images taken at 20x magnification. Scale bar 50|xm.

51

Skeletal Muscle

Liver Tissue

52

Pancreatic p-cell specific overexpression of eGFP using dsAAV8-RIP in mice does
not affect carbohydrate metabolism.
We utilized a RIP driven expression vector delivered by dsAAV8 to generate
mice overexpressing eGFP specifically in pancreatic P-cells. We confirmed that control
mice expressed eGFP specifically in pancreatic P-cells (dsAAV8-RIP-eGFP) with no
effect on body weight, 4 hr fasted blood glucose levels, oral glucose tolerance or insulin
sensitivity when compared to control mice injected with saline (Fig. 2.6 a-d). These
results, and similar results from others (Gaddy et al. 2010) confirm dsAAV8-RIP-eGFP is
an appropriate control virus for in vivo overexpression studies using dsAAV8.

53

Figure 2.6 Body weight and carbohydrate metabolism from 3wk post-infection with
dsAAV8-RIP-eGFP (P-eGFP-Control) or saline (284|^l/mouse) by ip injection.
Overexpression of eGFP in pancreatic P-cells resulted in no change in body weight (A),
4hr FBG (B), glucose tolerance (C, 2g D-glucose/kg), or insulin sensitivity (D, 0.75U
insulin/kg) compared to saline-treated mice on regular chow diet. Abbreviations:
dsAAV8 - double stranded adeno-associated virus serotype 8; RIP - rat insulin promotor;
eGFP - enhanced green fluorescent protein; FBG - fasted blood glucose. Saline-treated
n=7, P-eGFP-Control n=7. Mean values +/- standard error of the mean are shown.
Statistical significace was tested by 2-way ANOVA (over time) with Bonferoni Post
Tests or Student's t-Tests (at specific time points).

54

Body Weight (g)

Blood Glucose (mmol/L)

un

t-n

Blood Glucose

03

O

(Fold-Change from Basal)
Blood Glucose (mmol/L)

W 3.

2.4 DISCUSSION
Transgenic mice driven by the RIP start expressing the gene or protein of interest
as early as embryonic day 13.5 (Hara et al. 2003); thus, showing overxpression of the
gene of interest before birth, from El 3.5. In addition, when utilizing RIP-Cre
transgenics, there is a possibility that the protein of interest will also be expressed in the
hypothalamic neurons of the brain (Choudhury et al. 2005; Choi et al. 2008; Dahlhoff et
al. 2011). It has been described previously, that as little as a 10% reduction in body
weight can have significant improvements in whole body carbohydrate metabolism
(Smyth and Heron 2006). Since the hypothalamus is responsible for appetite regulation
(Inui 1999), overexpression of proteins in the hypothalamus by RIP can impact
carbohydrate metabolism and p-cell function. Choi and colleagues (2008) speculated that
manipulating hypothalamic neuronal activity by overexpressing Cre and increased
protein production can regulate whole body growth (Choi et al. 2008) as seen in their
RIP-Cre mouse. These characteristics of RIP transgenics were considered when deciding
on the most appropriate method for implementing P-cell specific overexpression of
PPARa and assessing its effects on p~cell lipotoxicity in a diet-induced obese model of pcell failure and T2D. If we were to use a RIP-PPARa transgenic mouse overxpressing
PPARa, we would induce PPARa expression from El3.5 in the developing pancreas as
well as the potential expression in the adult hypothalamus. Thus, we would not be able to
easily discern if the physiological results obtained are solely from pancreatic p-cell
overexpression of PPARa or additionally related to these cofounding expression patterns.
Therefore methods of inducible overexpression seem more favorable when characterizing
genes of interest in an in vivo model.

56

Recently, a new gene delivery tool has been developed for targeted delivery of
proteins to p-cells of the pancreas via intraperitoneal injection utilizing dsAAV8 vectors
(Wang et al. 2006; Gaddy et al. 2010; Riedel et al. 2010) under the direction of the ratinsulin promoter. Here we demonstrate that viral delivery of dsAAV8-RIP-eGFP is
specifically targeted to pancreatic P-cells and not a-cells (Fig. 2.2 a, b) or exocrine tissue
of pancreas. Overall these results indicate that the delivery of dsAAV8-RIP-eGFP via
intraperitoneal injection prove to be an effective, non-invasive method of viral gene
transfer for targeted protein delivery to the p-cells of the pancreas.
By overexpressing eGFP in the P-cells of the pancreas, we are forcing the P-cell
to increase the production of foreign proteins. This increased protein production could
potentially lead to decreased insulin secretion and the development of P-cell dysfunction
or P-cell exhaustion. Therefore it was crucial to determine if expressing foreign proteins
would affect the overall health of the P-cell. We determined that overexpression of
dsAAV8-RIP-eGFP in the pancreatic p-cells did not affect body weight or overall
carbohydrate metabolism (Fig. 2.6), further proving to be a useful control vector for
future in vivo studies involving diabetic models.
Importantly, we have also confirmed that dsAAV8-RIP-eGFP does not cross the
BBB (Fig. 2.4) similar to the results obtained by Wang and colleagues (2006), thus
avoiding gene expression in hypothalamic neurons that may cause changes in appetite
regulation controlled by the hypothalamus (Devaskar et al. 1994; Gannon et al. 2000).
eGFP has been shown to be expressed in liver and skeletal muscle (Inagaki et al. 2006;
Wu et al. 2006) when using dsAAV8. During western blot analysis non-specific bands
were observed in both skeletal muscle and liver protein extracts (Fig. 2.4) from P-eGFP-

57

control and saline mice. However, after close observation the bands observed were not
detected at 27kDa (eGFP positive control) they were found to have a slightly higher
molecular weight as seen in the shift on the membrane. It should be noted that protein
extracts from liver in P-eGFP-control mice were found to have bands of increased
intensity around 27kDa, indicating that eGFP may be expressed in these tissues; thus
immunohistochemical analysis was also performed. Moreover, our group concluded that
these bands were indeed non-specific based on the observation that chemiluminescence
was detected in protein extracts of saline injected mice in both liver and skeletal muscle.
Due to these unexpected results from western blot analysis, our group has
confirmed that eGFP is not expressed in skeletal muscle or liver tissue of P-eGFP-control
mice, using immunohistochemical analysis of paraffin embedded sections, that no eGFP
staining was observed above background fluorescence (Fig 2.5a, b). To show positive
staining of eGFP, pancreatic tissue sections were stained and used as a positive control
for "real" eGFP staining (Fig. 2.5c). One may argue that there are intensely stained areas
of green in the liver section of P-eGFP-control mice, however these intense patches of
green were also observed in saline islets (Fig. 2.5c middle panel) indicating that these
could be autofluorescing red blood cells, increased background staining, or non-specific
staining observed in western results.
Based on our results and those obtained by our colleagues (Gaddy et al. 2010;
Riedel et al. 2010), it should be noted that utilizing dsAAV8 for P-cell specific gene
delivery is an appropriate vector for developing and characterizing in vivo models of pcell overexpression. In addition we have been able to show effective gene delivery (Fig.
2.2a, b) to the target tissue (P-cells) through a non-invasive interperitoneal injection.

58

Furthermore, we have shown eGFP expression to be observed in 60% of total islet area of
infected islets (Fig 2.2c). Importantly, the use of an ip injection opposed to intraductal
injections allows user groups to avoid complications associated with invasive surgery
such as recovery time, weight loss and potential death. Having shown the same
efficiency of viral delivery as our colleagues (Wang et al. 2006; Riedel et al. 2010),
utilizing the interperitoneal injection for our future studies will prove to be critical, as we
want to ensure that any changes observed in our model is due solely to the
overexpression of PPARs in the p-cells, and not due to weight loss caused by the invasive
surgery of performing intraductal injections.
It has been proposed by Wang et al (2006), Gaddy et al (2010) and Riedel et al
(2010) that there is the potential of utilizing dsAAV8 as a potential therapeutic for
targeted pharmaceuticals or as a method of targeted gene therapy in diabetic individuals
(Gaddy et al. 2010; Riedel et al. 2010). Again, the use of dsAAV8 under the control of
RIP is also attractive as it specifically targets the pancreatic p-cells, therefore if it were to
be used as a method of gene therapy in diabetes treatments, we could potentially avoid
systemic complications as seen with some pharmaceuticals. As previously discussed,
Gaddy et al. (2011) and Montane et al. (2011) have both utilized dsAAV8 mediated gene
delivery to either reverse hyperglycemia or protect against further autoimmune
destruction of P-cells in T1D mice (Gaddy et al. 2011; Montane et al. 2011). Moreover,
improvements were seen after a single ip or intraductal injection (Gaddy et al. 2011;
Montane et al. 2011). These studies have shown that dsAAV8 could be a potential
therapeutic for the treatment of T1D, thus making it especially appealing to current
patients, as well as parents of T1D kids as an alternative to islet transplantation.

59

The results obtained in this study were similar to those obtained by Gaddy et al
(2010) and Riedel et al (2010); further proving to be an effective tool in in vivo diabetic
models opposed to traditional models of transgenics. The major findings from this
chapter are:
1. dsAAV8 is an effective tool for gene delivery to the pancreatic P-cells.
2. Overexpression of dsAAV8-RIP-eGFP is observed in p-cells and not a-cells
of the pancreas as early as three weeks post infection.
3. Overexpression of dsAAV8-RIP-eGFP is not expressed in the hypothalamus
of the brain, or peripheral tissues (skeletal muscle, liver and intestine).
4. Overexpression of dsAAV8-RIP-eGFP within the pancreatic p-cells does not
affect body weight or carbohydrate metabolism.

60

2.5 REFERENCES
Chao, H., Y. Liu, J. Rabinowitz, C. Li, R. J. Samulski and C. E. Walsh (2000). "Several
log increase in therapeutic transgene delivery by distinct adeno-associated viral
serotype vectors." Mol Ther 2(6): 619-623.
Choi, D., K. T. Nguyen, L. Wang, S. A. Schroer, A. Suzuki, T. W. Mak and M. Woo
(2008). "Partial deletion of Pten in the hypothalamus leads to growth defects that
cannot be rescued by exogenous growth hormone." Endocrinology 149(9): 43824386.
Choudhury, A. I., H. Heffron, M. A. Smith, H. Al-Qassab, A. W. Xu, C. Selman, M.
Simmgen, M. Clements, M. Claret, G. Maccoll, D. C. Bedford, K. Hisadome, I.
Diakonov, V. Moosajee, J. D. Bell, J. R. Speakman, R. L. Batterham, G. S. Barsh,
M. L. Ashford and D. J. Withers (2005). "The role of insulin receptor substrate 2
in hypothalamic and beta cell function." J Clin Invest 115(4): 940-950.
Dahlhoff, M., M. Grzech, F. A. Habermann, E. Wolf and M. R. Schneider (2011). "A
transgenic mouse line expressing ere recombinase in pancreatic beta-cells."
Genesis.
Devaskar, S. U., S. J. Giddings, P. A. Rajakumar, L. R. Carnaghi, R. K. Menon and D. S.
Zahm (1994). "Insulin gene expression and insulin synthesis in mammalian
neuronal cells." J Biol Chem 269(11): 8445-8454.
Gaddy, D. F., M. J. Riedel, S. Bertera, T. J. Kieffer and P. D. Robbins (2011). "dsAAV8mediated gene transfer and beta-cell expression of IL-4 and beta-cell growth
factors are capable of reversing early-onset diabetes in NOD mice." Gene Ther.
Gaddy, D. F., M. J. Riedel, S. Pejawar-Gaddy, T. J. Kieffer and P. D. Robbins (2010). "In
vivo expression of HGF/NK1 and GLP-1 From dsAAV vectors enhances
pancreatic ss-cell proliferation and improves pathology in the db/db mouse model
of diabetes." Diabetes 59(12): 3108-3116.
Gannon, M., C. Shiota, C. Postic, C. V. Wright and M. Magnuson (2000). "Analysis of
the Cre-mediated recombination driven by rat insulin promoter in embryonic and
adult mouse pancreas." Genesis 26(2): 139-142.
Gao, G. P., M. R. Alvira, L. Wang, R. Calcedo, J. Johnston and J. M. Wilson (2002).
"Novel adeno-associated viruses from rhesus monkeys as vectors for human gene
therapy." Proc Natl Acad Sci U S A 99(18): 11854-11859.
Hara, M., X. Wang, T. Kawamura, V. P. Bindokas, R. F. Dizon, S. Y. Alcoser, M. A.
Magnuson and G. I. Bell (2003). "Transgenic mice with green fluorescent proteinlabeled pancreatic beta -cells." Am J Physiol Endocrinol Metab 284(1): El 77183.

61

Hay, C. W. and K. Docherty (2006). "Comparative analysis of insulin gene promoters:
implications for diabetes research." Diabetes 55(12): 3201-3213.
Huynh, F. K., J. Levi, H. C. Denroche, S. L. Gray, P. J. Voshol, U. H. Neumann, M.
Speck, S. C. Chua, S. D. Covey and T. J. Kieffer (2010). "Disruption of hepatic
leptin signaling protects mice from age- and diet-related glucose intolerance."
Diabetes 59(12): 3032-3040.
Inagaki, K., S. Fuess, T. A. Storm, G. A. Gibson, C. F. McTiernan, M. A. Kay and H.
Nakai (2006). "Robust systemic transduction with AAV9 vectors in mice:
efficient global cardiac gene transfer superior to that of AAV8." Mol Ther 14(1):
45-53.
Inui, A. (1999). "Feeding and body-weight regulation by hypothalamic neuropeptides—
mediation of the actions of leptin." Trends Neurosci 22(2): 62-67.
Kasuga, M. (2006). "Insulin resistance and pancreatic beta cell failure." J Clin Invest
116(7): 1756-1760.
Kieffer, Timmothy J. 2011. Personal communication.
Loiler, S. A., T. J. Conlon, S. Song, Q. Tang, K. H. Warrington, A. Agarwal, M.
Kapturczak, C. Li, C. Ricordi, M. A. Atkinson, N. Muzyczka and T. R. Flotte
(2003). "Targeting recombinant adeno-associated virus vectors to enhance gene
transfer to pancreatic islets and liver." Gene Ther 10(18): 1551-1558.
Miesfeld, R. L. (1999). Applied molecular genetics. New York, Wiley-Liss. pg.218.
Montane, J., L. Bischoff, G. Soukhatcheva, D. L. Dai, G. Hardenberg, M. K. Levings, P.
C. Orban, T. J. Kieffer, R. Tan and C. B. Verchere (2011). "Prevention of murine
autoimmune diabetes by CCL22-mediated Treg recruitment to the pancreatic
islets." J Clin Invest 121(8): 3024-3028.
Nagy, A. (2000). "Cre recombinase: the universal reagent for genome tailoring." Genesis
26(2): 99-109.
Odagiri, H., J. Wang and M. S. German (1996). "Function of the human insulin promoter
in primary cultured islet cells." J Biol Chem 271C4): 1909-1915.
Prentki, M. and C. J. Nolan (2006). "Islet beta cell failure in type 2 diabetes." J Clin
Invest 116(7): 1802-1812.
Riedel, M. J., D. F. Gaddy, A. Asadi, P. D. Robbins and T. J. Kieffer (2010). "DsAAV8mediated expression of glucagon-like peptide-1 in pancreatic beta-cells
ameliorates streptozotocin-induced diabetes." Gene Ther 17(2): 171-180.

62

Smyth, S. and A. Heron (2006). "Diabetes and obesity: the twin epidemics." Nat Med
12(1): 75-80.
van Herpen, N. A. and V. B. Schrauwen-Hinderling (2008). "Lipid accumulation in nonadipose tissue and lipotoxicity." Physiol Behav 94(2): 231-241.
Wang, A. Y., P. D. Peng, A. Ehrhardt, T. A. Storm and M. A. Kay (2004). "Comparison
of adenoviral and adeno-associated viral vectors for pancreatic gene delivery in
vivo." Hum Gene Ther 15(4): 405-413.
Wang, Z., T. Zhu, K. K. Rehman, S. Bertera, J. Zhang, C. Chen, G. Papworth, S.
Watkins, M. Trucco, P. D. Robbins, J. Li and X. Xiao (2006). "Widespread and
stable pancreatic gene transfer by adeno-associated virus vectors via different
routes." Diabetes 55(4): 875-884.
Wu, Z., A. Asokan and R. J. Samulski (2006). "Adeno-associated virus serotypes: vector
toolkit for human gene therapy." Mol Ther 14(3): 316-327.

63

CHAPTER 3

Overexpression of PPARa in the Pancreatic p-cells Improves Carbohydrate
Metabolism in a Model of Diet-induced Obesity

A version of this chapter has been submitted as an abstract:
Hogh, K-Lynn N., Uy, Christopher E., Fraser, J., Asadi, A., Baker, Robert K., Riedel,
Michael J., Gray, Sarah L. 2011. Overexpression of PPARa in pancreatic P-cells
improves glucose tolerance in diet-induced obese mice. Canadian Journal of Diabetes.
35(4): 417. Canadian Diabetes Association AGM & Professional Meetings. Toronto ON.
Oct 26-29 2011.
A version of this chapter has been submitted:
Hogh, K-Lynn N., Uy, Christopher E., Asadi, A., Baker, Robert K., Riedel, Michael J.,
Gray, Sarah L. 2012. Overexpression of PPARa in pancreatic P-cells improves glucose
tolerance in diet-induced obese mice. Endocrinology. Manuscript Submission number:
EN-12-1110.

64

3.1 INTRODUCTION
As previously outlined in chapter one, lipotoxicity is implicated as a mechanism
in p-cell dysfunction and development of obesity-induced T2D in (Virtue and Vidal-Puig
2010). Therefore protecting the pancreatic P-cells from increased lipid accumulation may
be a plausible approach to reducing lipotoxicity and preserving P-cell function.
The peroxisome proliferator-activated receptors (PPARs) are nuclear transcription
factors involved in the regulation of lipid metabolism (Chinetti et al. 2000). PPARa is
often expressed in tissues including the liver, skeletal muscle, heart and pancreas (Lee et
al. 2003). Activation of PPARa upregulates expression of p-oxidative genes (Tordjman
et al. 2002; Lalloyer et al. 2006; Medina-Gomez et al. 2007) with subsequent
improvements in glucose homeostasis by decreasing circulating lipids and lipid
accumulation in non-adipose tissues such as liver and skeletal muscle, consequently
reducing lipotoxicity and increasing insulin sensitivity (Sugden et al. 2003; Lalloyer et al.
2006). Figure 3.1 illustrates the binding of PPARa to RXR where it forms a heterodimer
prior to nuclear internalization. Once in the nucleus, the PPARa/RXR heterodimer binds
to the PPAR response element (PPRE) where gene transcription remains inactive until the
activating ligand (FA or FA derivatives, or PPAR agonist) binds to PPARa/RXR, causing
the release of the corepressor complex (CRC) and histone deacetylases (HDACs) and
subsequent binding of the coactivator complex (CAC) which recruits histone
acetyltransferases (HATs). The PPARa/RXR/CAC complex is then active and the
transcription of downstream target genes can occur, including the transcription of genes
involved in fatty acid metabolism and p-oxidation (Reddy and Hashimoto 2001; Mandard
et al. 2004).

65

Figure 3.1 - Regulation of gene expression by PPARs (Binding of PPAR/Retinoid
Nuclear Receptor Family) modified from (Reddy and Hashimoto 2001). The PPAR/RXR
family is involved in controlling gene transcription at the nuclear level. Abbreviations:
FA - fatty acid; PPAR - peroxisome proliferator-activated receptor; Pa - PPARa; RXR retinoid-X receptor; CRC - corepressor complex; HDACs - histone deacetylases; PPRE
- PPAR response element; CAC - coActivator complex; HATs - histone
acetyltransferases.

66

Active transport of FA or PPAR
gk.
agonists into cell

Heterodimer formation

nuclear localization

FAs or PPAR agonists
diffuses through nueteus

HDACs

Nucleus
Inactive complex
igene repression}

Recruits HATs
FA or PPAR
agonist binding

Active complex
(gene transcription)

T gene transcription

cytoplasm

When PPARa is activated, numerous downstream target genes involved in (3oxidation and lipid metabolism are turned on (Mandard et al. 2004). Some of the genes
upregulated by PPARa include: Acyl-CoA oxidase (AOX), carnitine palmitoyl
transferase-1 (CPT1), long chain acyl-coA dehydrogenase (LCAD), and uncoupling
protein-2 (UCP2) (Reddy and Hashimoto 2001; Lee et al. 2003). Expression of these
target genes varies depending on tissue selected (Mandard et al. 2004). Increased
expression and PPARa activation occurs largely in the liver (Lee et al. 2003), where a
decrease in triglyceride synthesis and increased oxidation of fatty acids is observed
(Frederiksen et al. 2004). It should be noted that previous studies have reported that
prolonged exposure to increased PPARa activity in the liver has been linked to
heptacellular carcinoma in rats and mice (Qin et al. 1997; Gonzalez et al. 1998; Reddy
and Hashimoto 2001). In contrast, PPARs have been found to be nonmutagenic in nature
after increasing metabolic activity (Gonzalez et al. 1998; Reddy and Hashimoto 2001);
therefore proving to be a potential tool in tissue-specific gene manipulation in in vivo
studies.
Studies utilizing PPARa null mice or systemic administration of PPARa agonists
have contributed greatly to elucidating the physiological role of PPARa. Loss-of-function
studies have shown that animals lacking PPARa are protected against high-fat diet
induced obesity and insulin resistance (Guerre-Millo et al. 2001); where PPARa was
found to be non-essential for the maintenance of euglycemia, but required to maintain the
P-cell adaptive response to hyperglycemia (Guerre-Millo et al. 2001; Bihan et al. 2005;
Yessoufou et al. 2009). Moreover, Lalloyer and colleagues (2006) utilized PPARa-null
ob/ob mice to show that PPARa deficiency in a severely obese model (ob/ob) resulted in

68

increased P-cell dysfunction with reduced islet area and decreased glucose-stimulated
insulin secretion (Lalloyer et al. 2006). It should also be noted that PPARa-null mice
often suffer from hypoglycemia under prolonged fasting (Guerre-Millo et al. 2001;
Lalloyer et al. 2006). This hypoglycemia is believed to be attributed to depleted
glycogen stores in PPARa-null mice, (Kersten et al. 1999; Lee et al. 2003; Mandard et al.
2004)
Gain of function studies utilizing systemic administration of PPARa agonists in
OLETF rats, prevented FFA-induced P-cell dysfunction (Koh et al. 2003; Lalloyer et al.
2006). PPARa agonists have been shown to improve hepatic insulin sensitivity by
enhancing hepatic expression of p-oxidative genes (Bergeron et al. 2006), strongly
supporting the notion that PPARa agonists decrease lipid accumulation in peripheral
tissues such as liver (Holness et al. 2003; Koh et al. 2003; Bergeron et al. 2006).
Additionally, Yajima and colleagues (2003) have shown that administrating a
combination of PPARa and PPARy agonists increased glucose-stimulated insulin
secretion by increasing insulin stores in P-cells of db/db mice (Yajima et al. 2003).
Because the above studies report the effects of systemic PPARa deletion or agonism, the
direct effect of PPARa on pancreatic P-cell function cannot conclusively be determined
as direct or secondary and thus it remains unclear if the beneficial effects of PPARa on Pcell function are due to reductions in circulating lipid levels via actions on the liver, or
direct effects on the p-cell itself.
Studies utilizing both isolated islets and P-cell lines have provided evidence that
PPARa activation is able to improve p-cell function directly. Hellemans et al (2007)
showed that in isolated rat islets, activation of PPARa protected against palmitate-

69

induced toxicity through increased mitochondrial and peroxisomal P-oxidation
(Hellemans et al. 2007). More recently, Frigerio and colleagues (2010) utilized
adenoviruses to overexpress PPARa and retinoid X receptor (RXR) in the INS-IE p-cell
line (Frigerio et al. 2010). Overexpressing PPARa in this clonal cell line resulted in
restored glucose-stimulated insulin secretion in oleate-treated cells by promoting glucose
metabolism and fatty acid storage (Frigerio et al. 2010). Frigerio et al (2010) proposed
that overexpression of PPARa in the INS-IE cells increased fatty acid turnover through
consumption via p-oxidation; it was also proposed that the protective effects observed
with PPARa overexpression could be due to increased triglyceride synthesis (Frigerio et
al. 2010). Further supporting the protective effects of PPARa, Lalloyer et al (2007) were
able to show that treatment with PPARa agonists under lipotoxic conditions improved
insulin secretion in isolated human islets (Lalloyer et al. 2006). These improvements
were associated with decreased islet triglyceride content and decreased palmitate-induced
apoptosis (Lalloyer et al. 2006). Together, these studies provide evidence that activation
of PPARa in isolated islets and p-cell lines may protect against lipotoxic induced P-cell
dysfunction through the regulation of lipid metabolism in islets.
Based on the above in vivo and in vitro studies showing favorable effects of
PPARa agonism on p-cell function in the context of lipid exposure and high-fat feeding,
we hypothesized that overexpression of PPARa specifically in pancreatic P-cells of obese
mice, in vivo, would preserve pancreatic P-cell function and delay the onset of obesityinduced diabetes.

70

3.2 MATERIALS AND METHODS
Cell Culture.
There are several p-cell lines currently utilized to study the in vitro effects of
lipotoxicity on the P-cell and its role in the pathogenesis of T2D. When available,
isolated islets are preferred; however islets are difficult to isolate, and can become
expensive to obtain, as whole mice must be sacrificed for the collection of islets. In
addition to primary islets, insulinoma cell lines are commercially available for in vitro
studies looking at p-cell function. Of the P-cell lines, the MIN6 and INS-IE cells are
often most utilized for their P-cell characteristics (Xiao et al. 2001; Tordjman et al. 2002;
Ravnskjaer et al. 2005; Frigerio et al. 2010). The use of these cell lines will depend on
what tests, and data one wants to collect. INS-IE cells have been found to be more easily
cultured, however they have less regulation of insulin secretion and higher basal insulin
levels without a stimulus (Skelin et al. 2010). Whereas the MIN6 cells, act and respond
more like P-cells, in a glucose dependent manner; where insulin is secreted appropriately
in response to a glucose stimulus (Skelin et al. 2010).
MIN6 cells (passage 15- 25) were cultured at 37°C and 5% CO2 in media
containing Dulbecco's Modified Eagle's Media (DMEM) (D5671, Sigma, Oakville ON,
Canada), 200mM L-glutamine, 50jjmol/L P-mercaptoethanol, 10% FBS (vol/vol), and
100 U/ml penicillin-streptomycin). Cells were transfected at 80-90% confluencey as
previously described (Dalby et al. 2004) using lipofectamine 2000 (lfil) (Invitrogen,
Burlington ON, Canada) and 1.6(ig of plasmid (plasmid dsAAV8-RIP-eGFP or plasmid
dsAAV8-RIP-PPARa) (Fig. 3.2). Enhanced green fluorescent protein (eGFP) was
visualized by fluorescent microscopy to assess transfection efficiency 24hrs post

71

transfection; experiments that produced 60% or more eGFP expressing cells were
considered to be successfully transfected. For experiments requiring palmitate treatment,
cells were exposed to the above culture media containing OjxM or 250[iM BSA-coupled
palmitate (6:1) (Gwiazda et al. 2009) for 48hrs one day post-transfection. 20mM stock
palmitic acid was prepared daily as follows: 5.6mg of palmitic acid was dissolved in 1ml
of H2O containing l(il ofNaOH at 70°C; once dissolved 0.5ml of 20mM palmitic acid
was added to 1.65ml of 20% FA free BSA, and added to 17.85ml of cell culture media
for a final stock concentration of 500^M. Stock palmitate solutions were then diluted to
working concentrations of 250fiM prior to treating cells.
RNA extraction and cDNA generation.
RNA was extracted (RNeasy kit, Qiagen, Valencia CA, USA) from cells 24 hrs
post transfection. Genomic DNA was removed from RNA extracts using lOx TURBO
DNAse buffer (5|il) and TURBO DNAse (1 jal) and incubated at 37°C for 1 hr as per the
manufacturers protcol (TURBO DNAse Kit, Ambion, Burlington ON, Canada). RNA
concentration and purity were assessed by spectrophotometry (nanodrop
spectrophotometer, ND-1000, Thermo Scientific, Rockford IL, USA) and RNA integrity
was assessed by visualizing intact 18s and 28s rRNA bands on a 1.5% agarose gel. Intact
RNA (500ng) was reverse transcribed to cDNA using random primers (5jj.1), dNTPs
(1 (.il), dH^O (jc-jj-1 to total volume of 13^1) and incubated at 65°C for 5min, then first
strand buffer (4|il), 0.1M DTT (1 j_il) and superscriptlll (1 jj.1) added to each reaction and
incubated in the thermocycler as per the manufacturers protocol (Superscript III Reverse
Transcriptase kit, Invitrogen, Burlington ON, Canada).
Quantitative Real-time PCR.

72

PPARa mRNA expression levels in MIN6 cells and induction of PPARa target
gene mRNA expression were assessed using quantitative real-time PCR normalized to
the reference genes p-Actin and 18s. Taqman primer and probe sequences for PPARa,
carnitine palmitoyl transferase-1 (CPT1), long-chain acyl-CoA dehydrogenase (LCAD),
Acyl-CoA oxidase (AOX), uncoupling protein-2 (UCP2), P-actin and 18s are shown in
Table 1 (Sigma,) and qPCR master mix contained: iQ Supermix, Taqman forward and
reverse primers (5|iM), Taqman probes (5JJM), RNAse free H2O, cDNA (lfil) (BioRad
Laboratories, Hercules CA, USA; Sigma, Oakville ON, Canada; Ambion, Austin TX,
USA). The following reaction conditions were used for each RT-PCR: one cycle of 50°C
for 2min, 95°C for lOmin followed by 40 cycles of 95°C for 15sec, 60°C for lmin
(BioRad iQ5 Multicolor RT-PCR Detection System, BioRad Laboratories, Hercules CA,
USA). All qRT-PCR reactions followed the MIQE guidelines (Bustin et al. 2009) where:
1) Each biological replicate (experimental and control) was completed in
triplicate
2) RNA extracts were treated with DNAse to remove genomic DNA
3) RNA quality was assessed using slab gel electrophoresis
4) cDNA was prepared immediately after RNA quality assessment
5) Primers and probes were previously designed by groups using qRT-PCR
6) R2 values were 0.980 or greater, with efficiencies between 90-115%
7) Several reference genes (18S and p-Actin) were used for normalization
8) Each biological replicated was run as a technical triplicate for maximum
reproducibility.

73

Table 3.1 Taqman primer and probe sequences used to assess mRNA expression levels of
PPARa and PPARa target genes using quantitative PCR.

Gene
PPARa
CPT1
LCAD
AOX
UCP2
(3-Actin
18S

Forward Primer (5'-3')
CCTCAGGGTACCACTACGGAGT

Reverse Primer (5'-3')

Probe (5'-3')

GCCGAATAGTTCGCCGAAA

CACGCATGTGAAGGCTGTAAGGGCTT

GCGTGCCAGCCACAATTC

TCCATGCGGTAATATGCTTCAT

CCGGTACTTGGATTCTGTGCGGCC

GCATGAAACCAAACGTCTGGA

TGTTTTGTAATTCAGATGCCCAGT

TCCGGTTCTGCTTCCATGGCAAAA

AATTGGCACCTACGCCCAG

AGTGGTTTCCAAGCCTCGAA

CGGAGATGGGCCACGGAACTCA

GATCTCATCACTTTCCCTCTGGATA

CCCTTGACTCTCCCCTTGG

CGCCAAGGTCCGGCTGCAGA

GCTCTGGCTCCTAGCACCAT

GCCACCGATCCACACAGAGT

GATCAAGATCATGCTCCTCCTGAGCGC

CGGCTACCACATCCAAGGAA

GTCGGAATTAC CGCGGCT

GAGGGCAAGTCTGGTGCCAG

74

Glucose-stimulated insulin secretion.
MIN6 cells were cultured and transfected with respective plasmids (plasmid
dsAAV8-RIP-eGFP and plasmid dsAAV8-RIP-PPARa) and treated with either 0|iM or
250|iM BSA coupled-palmitate for 48 hrs as described above. Cells were incubated for
lhr in glucose-free KRH Buffer (5M NaCl, 1M KC1, 1M Mg2S04, 1M NaHCCh, 1M
CaCl2, 0.5M KH2P04, 1M HEPES, 0.5g BSA) (Sigma, Oakville ON, Canada), before
being exposed to basal (2.8mmol/l) and stimulating (20mmol/l) levels of D-glucose for 1
hour each (Frigerio et al. 2010). After each incubation, 1ml of media was collected and
insulin levels quantified. 5^1 of each sample was run in triplicate with conjugate buffer
(75|il) and shaken at 800rpm on a microplate shaker for 2 hrs at room temperature.
Samples were then washed with wash buffer and incubated for 15min at 800rpm with
TMB substrate. Stop solution was then added to samples and quantified at 450nm on a
plate reader (Ultrasensitive insulin ELISA assay, 80-INSMSU-E10, ALPCO, Salem NH,
USA). Protein was extracted using 100(j.l RIPA buffer/well per 24-well plate (lOpl
HALT buffer and 10|il EDTA per 1ml RIPA) (Thermo Scientific, Rockford IL, USA)
and quantified in using a bicinchoninic acid (BCA) assay. 25^1 of each sample was run
in triplicate with 200^1 of working reagent and incubated at 37°C for 30min. Plates were
cooled to room temperature prior to quantifying at 560nm on a plate reader (Thermo
Scientific, Rockford IL, USA). Secreted insulin levels (ng/ml) were normalized to total
cellular protein (mg/ml) per well (ng/ml/mg protein).

75

Figure 3.2 In vitro experimental approach utilized in the expression of PPARa in MIN6
cells (in vitro). Abbreviations: PPARa - peroxisome proliferator-activated receptor
alpha; MIN6 - mouse insulinoma cell line; BSA - bovine serum albumin; GSIS glucose-stimulated insulin secretion.

76

Transfection

o
oo o
"" ' o

BSA-coupled palmitate

OO

o
(Control)

•Outcomes:
Overexpression
•Induction of target genes
•Functional Assay

o

o
Transfection

o
° BSA-coupled palmitate
o o
>
- oo

o

o°
(PPARa)

Legend for plasmids:

backbone
backbone

RIP

(Treatment N=4)

(Control N=4)

77

•

GSIS

Mice.
AH animal studies were approved by the University of Northern British Columbia
Animal Care and Use Committee (protocol number 2011-21). For all experiments, 6week-old, male, C57B16 mice were purchased from Charles River Laboratories
(Wilmington MA, USA) unless otherwise stated. Mice were maintained on a 12 hr
light/dark cycle and received standard rodent chow diet (Rodent LabDiet, 5001, Leduc
AB, Canada) ad libitum unless otherwise stated. Mice were allowed to acclimatize to the
animal facility for 1 week prior to performing any experimental procedures. Body weight,
4 hr fasted blood glucose (OneTouch Ultra, Lifescan, Burnaby BC, Canada), oral glucose
tolerance tests (OGTT) and insulin tolerance tests (ITT) were performed prior to viral
injections to assess baseline carbohydrate metabolism.
Double-stranded adeno-associated virus serotype 8.
dsAAV8 transfer vectors were designed utilizing the rat insulin 1 promoter (RIP)
(410 bp) placed upstream of either a sequence encoding eGFP (720bp) or the mouse
PPARa (1407bp) open reading frame, followed by the SV40 polyadenylation signal.
Complete dsAAV8-RIP-eGFP (5328bp) and dsAAV8-RIP-PPARa (6015bp) vectors
were sent to Children's Hospital Of Philadelphia (CHOP) Research Vector Core Services
(Philadelphia PA, USA) for AAV8 virus preparation
Pancreatic P-cell specific overexpression of PPARa in high fat diet-induced obese
mice.
At 4-months old, C57B16 mice were infected with dsAAV8-RIP-PPARa virus (PPPARa-HFD, n=8; 5xl012 viral genomes/814.3}il/mouse) or dsAAV8-RIP-eGFP virus

78

(P-eGFP-HFD control group, n=6; 5xl012 viral genomes/552.5|il/mouse) via ip injection.
Body weights were monitored weekly; 4 hr fasted blood glucose was monitored biweekly
and glucose tolerance and insulin sensitivity were assessed monthly by OGTT and ITT
respectively. Two days post injection mice were switched to a high fat diet containing
45% kcal as fat (D12451, Research Diets, New Brunswick NJ, USA) ad libitum
throughout the remainder of the experiment (20 weeks) when all animals were sacrificed
(Fig. 3.3). Tissues were collected and flash frozen or fixed in 4% paraformaldehyde for
48hrs and then stored in 70% EtOH. Whole pancreas sections were prepared by WAXIT histological services (Vancouver BC, Canada).
Insulin tolerance tests.
Mice were fasted for 4 hrs and given an ip injection of human synthetic insulin at
0.75U/kg or l.OU/kg (Novolin Ge, Toronto ON, Canada). Blood was sampled (l-2jxl)
from the saphenous vein and blood glucose measured (mmol/L) at 10, 20 30, 60, and 120
min post injection using handheld glucometer (OneTouch Ultra, Lifescan, Burnaby BC,
Canada).
Oral glucose tolerance and glucose-stimulated insulin secretion.
Mice were fasted for 16 hrs and given 2g/kg D-glucose by oral gavage. Plasma
(15-20|xl) was sampled for insulin measurement at 5, 10 and 180 minutes post glucose
gavage from the saphenous vein and blood glucose (mmol/L) measured in 1 -2|il blood at
5, 10, 30, 60, 120 and 180 minutes post gavage using handheld glucometer (OneTouch
Ultra, Lifescan, Burnaby BC, Canada) (Huynh et al. 2010).
Overnight fasted and re-fed plasma insulin levels.

79

Mice were fasted for 16 hrs and blood collected in heparinized capillary tubes
(Fisher Scientific, Ottawa ON, Canada) from the saphenous vein. Food was reintroduced
for 2 hrs and plasma collected again. Blood glucose was determined using a handheld
glucometer (OneTouch Ultra, Lifescan, Burnaby BC, Canada) and plasma insulin levels
were assessed by ELISA (Ultrasensitive insulin ELISA assay, 80-INSMSU-E10,
ALPCO, Salem NH, USA).
Immunohistological analysis.
Whole mouse pancreas sections fixed in 4% paraformaldehyde and embedded in
paraffin were sectioned at 5^m thickness; n=5 per group (Wax-it Histology Services;
Vancouver BC, Canada). All sections were de-paraffinized and rehydrated as described
previously in chapter 2 (Riedel et al. 2010). Sections were incubated with polyclonal
primary antibodies to rabbit anti-eGFP (1:500) (Al 1122, Invitrogen Molecular Probes,
Carlsbad CA, USA), polyclonal guinea pig anti-insulin (1:1000) (4011-01F, Millipore,
Billerica MA, USA) and a monoclonal primary antibody to mouse anti-glucagon (1:1000)
(G2654, Sigma) overnight. Appropriate secondary whole (heavy and light chain)
antibodies conjugated to Alexafluor 488 (A21206 or A21202) or 594 (A11076 or
Al 1032) (1:1000) (Invitrogen Molecular Probes) were used to detect primary antibody
immunoreactivity. All samples were visualized using a fluorescent light microscope
(Olympus BX61) and images analyzed using Cell Sens Software (Olympus, Markham
ON, Canada).
p-cell mass measurements.
Insulin immunoreactive-positive area was measured in serial sections of the whole
pancreas (2 serial sections, 200^m apart from the A. head, B. middle and C. tail of the

80

pancreas (total 3 sections/mouse, n= 4 per group)). Images were captured using the
ImageXpress® Micro Imaging System and analyzed using MetaXpress® Software
(Molecular Devices Corporation, Sunnyvale, CA, USA). Total insulin-positive area/total
pancreas area was multiplied by weight of the whole pancreas (mg) to determine P-cell
mass (Huynh et al. 2010).
Statistical analysis.
Results are expressed as mean ± standard error of the mean. Analyses were
performed using paired student's t-test and 1-way ANOVA (significance between two
groups), or 2-way ANOVAs (significance between groups over time) with Bonferoni
Post tests using Graphpad Prism 5.0 software (La Jolla CA, USA). Significance was
declared if p-values were less than 0.05. *P<0.05, **P<0.01, ***P<0.001.

81

Figure 3.3 In vivo experimental approach characterizing the physiological effects of
overexpressing PPARa in the pancreatic p-cells of C57B16 mice in vivo. Four month old
male C57B16 mice were infected with either dsAAV8-RIP-eGFP ((3-eGFP-HFD) or
dsAAV8-RIP-PPARa and placed on high-fat diet for 16 weeks. Abbreviations: dsAAV8
- double stranded adeno-associated virus serotype 8; RIP - rat insulin promotor; eGFP enhanced green fluorescent protein; PPARa - peroxisome proliferator-activated receptor
alpha; FBG - fasted blood glucose; HFD - high-fat diet; ip - intraperitoneal.

82

Establish baseline characteristics

dsAAV8-RIP-eGFP

ip injection

dsAAV8RIP-PPARcc

3 days pi
Inducing obesity - i6wk HFD

•

0

Expected outcomes:
Obesity induced T2D

Assessments:
Body weight
4hr fasted blood glucose
Glucose tolerance
Insulin sensitivity
Glucose-stimulated insulin secretion

Expected outcomes:
"Delayed" T2D

I (3-cell apoptosis

t (3-oxidation

I (3-oxidation

1 P-cell apoptosis

t Insulin Secretion
t

(3~cell lipotoxicity

Normal insulin Secretion

I P-cell lipotoxicity

3.3 RESULTS
Overexpression of pro-oxidative PPARa in MIN6 cells at a physiological level.
MIN6 cells successfully transfected with dsAAV8-RJP-PPARa plasmid showed a
253 + 28 fold increase in PPARa mRNA expression compared to control cells
overexpressing dsAAV8-RIP-eGFP plasmid (1.0 ± 0.05) (Fig. 3.4a). The level of
overexpression in MIN6 cells using plasmid dsAAV8-RIP-PPARa was compared to
PPARa mRNA expression levels observed in fasted liver tissue. Comparison allowed us
to determine that the levels of PPARa mRNA overexpression achieved in MIN6 cells
with the above expression vector were within a physiological range, comparable to levels
observed in fasted liver.

Overexpression of pro-oxidative PPARa in MIN6 cells results in upregulation of the
PPARa target gene CPT-1.
In cells overexpressing PPARa mRNA and exposed to palmitate (250|iM) we
detected upregulation of one of the four PPARa target genes measured (CPT1, LCAD,
AOX, and UCP2) (Fig. 3.4b). The 2-fold increase in CPT1 expression that we observed
has been observed previously in cell models of increased PPARa activity (Xiao et al.
2001; Ravnskjaer et al. 2005; Hellemans et al. 2007; Frigerio et al. 2010). No significant
increase in LCAD, AOX or UCP2 was observed in cells overexpressing PPARa with
palmitate treatment.

84

Figure 3.4 Overexpression of PPARa in MIN6 cells. Overexpression of PPARa in MIN6
cells occurs at physiological levels (A) and upregulates expression of CPT1 with
palmitate treatment (B). Overexpressing PPARa in MIN6 cells did not change insulin
secretion when stimulated with high levels of glucose without palmitate (C).
Abbreviations: PPARa - peroxisome proliferator-activated receptor alpha; MIN6 mouse insulinoma cell line; eGFP - enhanced green fluorescent protein; CPT1 - carnitine
palmitoyl transferase-1; LCAD - long-chain acyl-coA dehydrogenase; UCP2 uncoupling protein-2; AOX - acyl-CoA oxidase . Mean values with standard error of
mean are shown. Statistical significance was determined by 2-way ANOVA with
Bonferoni Post Tests or Student's T-Tests. *P<0.05, **P<0.01, ***P<0.001.
**** P<0 oooi

85

insulin Secreted (ng/ml/mg protein)

PPARa mRNA expression / |5-Actin mRNA
expression

O
D

O O

-*

>

O

_S_Q_P

3

&

CO

On

Insulin Secreted (ng/ml/mg protein)

CD

z
z zz
o> <J>

"o o re o
73 -0 7D "0

PPARa overexpression in MIN6 cells protects against palmitate-induced
impairment of glucose stimulated insulin secretion (GSIS).
Overexpression of PPARa in MIN6 cells in the absence of palmitate did not alter
glucose stimulated insulin secretion (Fig. 3.4c left panel). As expected due to lipotoxic
effects of palmitate on P-cell insulin secretion, blunted insulin levels were observed in the
non-transfected, eGFP and PPARa MIN6 cells when treated with 250nM of palmitate
compared to 0(iM palmitate. No significant difference was detected when comparing
stimulation indexes of all groups (Fig. 3.4c inset). However, in the presence of palmitate,
PPARa overexpression protected against palmitate-induced impairment of glucosestimulated insulin secretion (Fig. 3.4c right panel). These results are further supported by
previous studies utilizing MIN6 and INS1-E P-cell lines (Ravnskjaer et al. 2005;
Hellemans et al. 2007; Frigerio et al. 2010).

Overexpression of PPARa in pancreatic p-cells protects against obesity-induced
glucose intolerance.
Increased PPARa overexpression was observed in the cytoplasm and nuclei in
islets of P-PPARa-HFD mice compared to P-eGFP-HFD controls (Fig. 3a); arrows
indicate increased nuclear staining. Fluorescent dyes were reversed (insulin green and
PPARa red) in P-eGFP-HFD islets to ensure endogenous levels of PPARa were not
mistaken for fluorescence from the presence of our control vector, eGFP. Sixteen weeks
post-infection, we observed significantly improved glucose tolerance and lower overnight
fasting blood glucose levels in diet-induced obese mice overexpressing PPARa (pPPARa-HFD) in pancreatic p-cells compared to diet-induced obese control mice (P-

87

eGFP-HFD) (Fig. 3.5a). In fact, the improvement in glucose tolerance in p-PPARct-HFD
mice is equal to that of age-matched, chow-fed control mice; a substantial improvement
considering these mice have been on a HFD diet for 16 weeks (Fig. 3.5a).
Specifically, blood glucose levels taken 10 minutes post glucose gavage were
significantly lower in (3-PPARa-HFD (20.13 ± 0.46 mmol/L) mice compared to P-eGFPHFD controls (22.67 ± 0.75 mmol/L). It should be noted that although not significant
over time, significantly lower 4 hr fasted blood glucose levels were observed in PPPARa-HFD mice at two significantly reduced time points (Fig. 3.5b) compared to PeGFP-HFD control mice. Improvements in glucose tolerance in obese P-PPARa-HFD
mice were not associated with reduction in body weight (Fig. 3.5c) or improvement in
whole body insulin sensitivity (Fig. 3.5d) compared to P-eGFP-HFD control mice
suggesting improvement in insulin sensitivity did not account for the improvement in
glucose tolerance. Moreover, a trend in improving glucose tolerance over time was also
observed (Fig. 3.6 a-e).

88

Figure 3.5 (A) PPARa is overexpressed in the cytoplasm and nuclei (arrows) of PPPARa-HFD compared to P-eGFP-HFD controls. (B) Overexpression of PPARa in
pancreatic p-cells of obese mice improved oral glucose tolerance (2g/kg D-glucose)
compared to obese controls, with glucose tolerance similar to age-matched, chow mice.
(C) Over time, no significant difference between 4 hr fasted blood glucose was observed.
(D) PPARa overexpression did not affect body weight. (E), nor was insulin sensitivity
affected (1U insulin/kg). Abbreviations: PPARa - peroxisome proliferator-activated
receptor alpha; eGFP - enhanced green fluorescent protein; FBG - fasted blood glucose;
HFD - high-fat diet. P-eGFP-HFD n=6, p-PPARa-HFP n=8. Mean values with SEM are
shown. Statistical significant variation was determined by 2-way ANOVA with
Bonferoni Post Tests or Student's T-Tests. *P<0.05, **P<0.01, ***P<0.001.

89

50prn

B
15
Infection & HFD

*- Chow
• P-eGFP-HFD
o p-PPARa-HFD

= 10

I

TR 5

» p-eGFP-HFD
Q 8-PPARa-HFD
30

60

90
120
Time (minutes)

150

10

180

20

30

40

Age (weeks)

Infection & HFD

m V 0.5

» P-eGFP-HFD
Q B-PPARa-HFD

• p-eGFP-HFD
o p-PPARa-HFD
10

20

30

40

20
30
40
Time (minutes)

Age (weeks)

90

PPARa overexpression in pancreatic p-cells maintains 1st phase insulin secretion in
obesity.
Circulating insulin levels in P-PPARa-HFD (2.05 ±0.19 ng) mice were
significantly higher than P-eGFP-HFD controls (1.05 ± 0.20 ng) 5 minutes post glucose
gavage (Fig. 3.7a). No significant difference in fasting or refeed plasma insulin levels
were observed (Fig. 3.7b) in P-PPARa-HFD mice compared to P-eGFP-HFD control
mice (Fig. 3.7b). We did not observe any difference in islet morphology or p-cell mass in
the two groups of mice (Fig. 3.7c). Additionally, Figure 3.8 shows no significant
difference in body weight or tissue mass (liver, pancreas, gonadal white adipose, or
subcutaneous white adipose) from either P-eGFP-HFD or P-PPARa-HFD groups, further
suggesting that improvements in whole-body carbohydrate metabolism observed were
associated with changes in p-cell function and not body composition.

91

Figure 3.6 Overexpression of PPARa in pancreatic P-cells shows a trend towards
improved glucose tolerance over time (2g D-glucose/kg). Oral glucose tolerance tests
over time (A) Baseline, (B) 1-month post-infection, (C) 2-months post-infection, (D) 3months post-infections (E) 4-months post infection. Abbreviations: PPARa - peroxisome
proliferator-activated receptor alpha; eGFP - enhanced green fluorescent protein; FBG fasted blood glucose; HFD - high-fat diet. |3-eGFP-HFD n=6, P-PPARa-HFP n=8. Mean
values with SEM are shown. Statistical significant variation was determined by 2-way
ANOVA with Bonferoni Post Tests. *P<0.05, **P<0.01, ***P<0.001.

92

a p-eGFP-HFD
o P-PPARa-HFD

3-eGFP-HFD
o 3-PPARa-HFD

60

30

90
120
Time (minutes)

60

3-eGFP-HFD
o 3-PPARa-HFD

60

90
120
Time (minutes)

60

90
120
Time (minutes)

90
120
Time (minutes)

3-months post infection

-*• Chow-fed Age Matched
» P-eGFP-HFD
o P-PPARa-HFD

30

180

» p-eGFP-HFD
o p-PPARa-HFD

2-months post infection

0

150

1-month post infection

Baseline

60

90
120
Time (minutes)

150

180

4-months post infection

93

180

Figure 3.7 Overexpression of PPARa in pancreatic P-cells maintains 1st phase insulin
secretion in C57B16 mice on high-fat diet compared to obese controls. Glucosestimulated insulin secretion (A) but not overnight and refeed insulin levels (B) was
significantly affected. Additionally, overexpression of PPARa in pancreatic p-cells did
not change islet morphology or P-cell or a-cell mass (C) when compared to obese
controls. Abbreviations: PPARa - peroxisome proliferator-activated receptor alpha; eGFP
- enhanced green fluorescent protein. p-eGFP-HFD n=6, p-PPARa-HFP n=8. Mean
values with SEM are shown. Statistical significant variation was determined by 2-way
ANOVA with Bonferoni Post Tests or Student's T-Tests. *P<0.05, **P<0.01,
***p<0 001. Images taken at 20x magnification. Scale bar 50|im.

94

P-PPARa-HFD P-eGFP-HFD

(i-cell and a-cell mass (g)

Chow

Stimulation Index
(Glucose-stimulated Insulin Secretion)
a

to

t>-

a>

^
a

03
Plasma Insulin (rig/mL)
Stimulation Index

Figure 3.8 Overexpression of PPARa in pancreatic P-cells does not cause changes in
peripheral tissue mass on HFD. Abbreviations: PPARa - peroxisome proliferatoractivated receptor alpha; eGFP - enhanced green fluorescent protein; HFD - high fat
diet; scWAT - subcutaneous white adipose tissue; gWAT - gonodal white adipose tissue.
(3-eGFP-HFD n=6, (3-PPARa-HFP n=8. Mean values with SEM are shown. Statistical
significant variation was determined by student's t-tests.

96

• (3-eGFP-HFD
• (3-PPARa-HFD

Pancreas

scWAT

97

gWAT

3.4 DISCUSSION
Our group has shown for the first time that PPARu overexpression in pancreatic
P-cells, in vivo, improves glucose tolerance and maintains 1st phase insulin secretion on
HFD in a diet-induced obese model of T2D. Beneficial effects of systemic PPARa
agonism on P-cell function and carbohydrate metabolism have been demonstrated
(Guerre-Millo et al. 2000; Holness et al. 2003; Bergeron et al. 2006), however the impact
of P-cell-specific PPARa overexpression on whole-body carbohydrate metabolism has
yet to be explored in an in vivo model of obesity-induced T2D. Given the pro-oxidative
potential of PPARa, we hypothesized that specific activation of PPARa in pancreatic pcells of obese mice may prevent lipid-induced p-cell failure. We show in vivo
overexpression of PPARa specifically in pancreatic P-cells significantly improves whole
animal glucose tolerance in diet-induced obese mice to levels equal to that of agematched, chow-fed, control mice (Fig. 3.5a). This is a substantial improvement
considering p-PPARa-HFD mice have been exposed to a HFD for 16 weeks and we
would not expect improvements in glucose tolerance to exceed that of the age-matched
chow mice. This improvement in glucose tolerance is not due to reductions in body
weight or improvements in insulin sensitivity. Instead we show 1st phase insulin
secretion (5 minutes post glucose-gavage) is higher in P-PPARa-HFD mice compared to
obese control mice. In addition to improvements in glucose tolerance, we observed lower
overnight fasted blood glucose levels with a trend of decreased 4 hr fasted blood glucose
levels. Despite increased insulin secretion, fasting and fed plasma insulin levels were not
significantly higher in p-PPARa-HFD mice compared to control mice. Morphological
analysis of pancreatic tissue did not show increased P-cell mass, suggesting P-cell

98

specific PPARa overexpression improved p-cell function rather than increasing P-cell
mass.
Further studies are required to determine the lipidomic profile of any accumulated
lipids within the pancreatic P-cells of both our p-eGFP-HFD and p-PPARa-HFD mice.
Additionally experiments will need to be conducted to determine the rate of lipid
turnover within the pancreatic P-cells, as the majority of in vivo work attributes
improvements in whole animal carbohydrate metabolism to lipid turnover in the liver. As
Lee et al. (2003) have suggested that the increase in liver lipid accumulation and liver
mass in PPARa-null mice further supports PPARa's role in lipid regulation, as well the
liver being a site of lipid turnover (Lee et al. 2003). The authors also speculated that the
hypoglycemia, and elevated FA plasma levels observed in PPARa-null mice were caused
by the defective FA oxidation and uptake in the liver (Lee et al. 2003). Furthermore, a
study involving fibrate treatment in primates resulted in an increased liver mass
associated with an increase in number of peroxisomes, resulting in an increase in poxidation (Hoivik et al. 2004). Combined, these studies suggest increased liver mass
does affect PPARa's role in lipid metabolism, which subsequently effects whole-body
carbohydrate metabolism. Together these studies have indicated that improvements in
whole animal carbohydrate metabolism were due to PPARa's role in lipid turnover in the
liver. Therefore, it is important that our group rule out the liver as a possible source of
carbohydrate improvement. As discussed in chapter 2, our group has ruled out dsAAV8RIP-eGFP expression in the liver tissue of infected mice; therefore we assume dsAAV8RIP-PPARa would not be expressed in these tissues. Moreover, as seen in figure 3.8, we
have shown no significant difference in liver mass between P-eGFP-HFD and P-PPARa-

99

HFD mice, thus we suggest improvements observed were not due to changes in liver lipid
metabolism. This data supports our observation that improvement in glucose tolerance in
P-PPARa-HFD mice was due to the direct action of overexpressing PPARa in the
pancreatic P-cells and not due to peroxisome proliferation and increased PPARa activity
in the liver.
Utilizing ob/ob mice, Lalloyer and colleagues were able to show that PPARa
deficiency resulted in impaired GSIS and defective islet function (Lalloyer et al. 2006),
suggesting PPARa may play an important role in preserving p-cell function in the obese
state. Our results support a direct role for PPARa in improving pancreatic P-cell
function, with overexpression of PPARa specifically within the pancreatic P-cells
maintaining 1st phase insulin secretion impaired by obesity. Frigerio and colleagues
(2010) have performed extensive in vitro studies that support this finding. Utilizing the
INS IE cell line, they have shown that overexpression of PPARa is able to restore
glucose-stimulated insulin secretion in the presence of oleate (Frigerio et al. 2010), while
downregulation of PPARa expression exacerbated lipid-induced dysfunction (Frigerio et
al. 2010).
As with previous studies, our group has been able to show, in vitro, that
overexpression of PPARa has protective effects against lipotoxic dysfunction in the
presence of palmitate, which may be due to the increased P-oxidative activity from the
induction of PPARa target genes. When activated PPARa increases transcription of
downstream target genes involved in P-oxidation (Mandard et al. 2004); therefore it
would be expected that in the presence of palmitate MIN6 cells overexpressing PPARa
would show an induction of target genes. We show in the presence of palmitate, that the

100

PPARa target gene CPT1 is significantly increased in cells overexpressing PPARa
(Ravnskjaer et al. 2005; Hellemans et al. 2007; Frigerio et al. 2010). CPT1 was found to
have a two-fold increase (2.4+0.30) compared to eGFP-MIN6 controls (1.0+0.18),
similar to results obtained by Frigerio and colleagues (2010). Levels of LCAD, AOX,
and UCP2 induction were not found to be significantly increased, therefore we must also
consider the fact that these PPARa overexpression studies also overexpressed an
adenovirus for RXR in addition to PPARa (Ravnskjaer et al. 2005; Hellemans et al.
2007; Frigerio et al. 2010). Overexpressing RXR in addition to PPARa may allow for
increased formation of the RXR-PPAR heterodimer, and subsequent increase in
transcription of the downstream (3-oxidative genes (Fig. 3.1).
Therefore it is quite possible that the lack of increased P-oxidative gene induction
observed is due to an excess of PPARa in the presence of endogenous levels of RXR
within the MIN6 cell or the appropriate activating ligand for PPARa is not present in
sufficient quantities. However, consistent with the previous studies our group has been
able to show the overexpressing PPARa in MIN6 cells protects against lipotoxic
impairment of glucose-stimuated insulin secretion (GSIS), showing that in vitro PPARa
overexpression in the presence of palmitate protects MIN6 cells and enhances glucosestimulated insulin secretion. These findings are consistent with previous studies that have
shown PPARa to protect p-cells from lipid-induced impairment of GSIS in INS-IE cells
(Ravnskjaer et al. 2005; Lalloyer et al. 2006; Sun et al. 2008; Frigerio et al. 2010).
Frigerio and colleagues (2010) have suggested that the improvement observed with
PPARa activation is due to an increase in glucose metabolic pathways as well as safe FA
storage in the form of neutral lipids such as TGs (Frigerio et al. 2010). Additionally, this

101

group was able to show that downregulation of PPARa worsened oleate-induced
dysfunction in INS-IE cells (Frigerio et al. 2010); further supporting our results that
PPARa overexpression has protective effects against palmitate-induced dysfunction.
The lack of upregulation of PPARa genes may be due to the fact that palmitate
may not be the appropriate ligand for PPARa; thus trying in vitro experiments with a
different FA such as oleate or various ceramides could be used. After reviewing the
literature, most studies utilize palmitate as their fatty acid treatment for either their MIN6
or INS-1 cells. Studies have shown that palmitate treatment should be kept to a
maximum of 48 hrs before proceeding with the remainder of the desired treatments.
Hellemans et al. (2007), Frigerio et al. (2009), and Thorn and Bergsten (2010) have done
extensive studies showing that cellular apoptosis increases with palmitate treatments in
excess of 48 hrs (Hellemans et al. 2007; Frigerio et al. 2010; Thorn and Bergsten 2010);
therefore we kept our palmitate incubations to 48 hrs at a concentration of 250|iM.
Whereas it was found that oleate was not as toxic to the MIN6 and INS-1 cells in excess
of 48hrs (Frigerio et al 2009).
It has been documented that the rate of turnover of human pancreatic p-cells is
slow (Riedel et al. 2010; Skelin et al. 2010), whereas the turnover time in murine models
is approximately 47 days (Wang et al. 2004). Wang and colleagues (2004) have
suggested it is very likely that P-cells infected with adeno-associated viruses are lost due
to normal maintenance and cellular apoptosis (Wang et al. 2004). Recycling rates of
PPARa overexpressing P-cells may explain why significantly lower 4 hr fasted blood
glucose was observed during only two weeks (no significance over time) (Fig. 3.5b) and
why impaired glucose tolerance was not maintained.

102

Synthetic PPARa agonists, such as fibrates, are approved for human use to lower
elevated lipid profiles in individuals with hypertriglyceridemia; further, their systemic
administration has been shown to induce improvements in carbohydrate metabolism
(Staels et al. 2008). Our results suggest that PPARa may have direct effects on P-cell
function that may be contributing to the improvements in carbohydrate metabolism
observed with systemic administration of fibrates. Our model which specifically
upregulates PPARa activity in pancreatic P-cells is the first in vivo model of P-cellspecific PPARa overexpression and the first model that conclusively shows P-cell
specific effects of PPARa agonism can impact whole-animal glucose homeostasis
independently of systemic effects on liver and muscle lipid metabolism. Furthermore, our
study has shown that targeted delivery of PPARa to the p-cell could serve as a potential
site for therapeutic intervention for the preservation of P-cell function, in islet
transplantation or in the treatment of obesity-induced T2D. In conclusion, we have
demonstrated that targeted delivery of PPARa specifically to pancreatic P-cells in vivo
preserves P-cell function and protects against glucose intolerance in diet-induced obesity,
thus providing a valuable in vivo model to elucidate the mechanisms involved in p-cell
lipotoxicity in obesity-induced T2D. The major findings from this chapter are:
1. We have developed the 1st in vivo model of PPARa overexpression in
pancreatic P-cells to further elucidate the mechanisms involved in P-cell
lipotoxicity in a diet-induced obese model of T2D.
2. Overexpression of dsAAV8-RIP-PPARa in pancreatic P-cells improves
glucose tolerance in a diet-induced obese model of T2D.

103

3. Overexpression of dsAAV8-RIP-PPARa in the pancreatic P-cells maintains
1st phase insulin secretion impaired by obesity.
4. Overexpression of dsAAV8-RIP-PPARa within the pancreatic P-cells does
not affect body weight, insulin sensitivity or weight gain in peripheral tissues.
5. Using AAV8 plasmid, PPARa overexpression in MIN6 occurs at
physiological levels and upregulates the ^-oxidative target gene CPT1 in the
presence of palmitate.
6. Overexpression of PPARa plasmid in MIN6 maintains glucose-stimulated
insulin secretion when treated with palmitate.

104

3.5 REFERENCES
Bergeron, R., J. Yao, J. W. Woods, E. I. Zycband, C. Liu, Z. Li, A. Adams, J. P. Berger,
B. B. Zhang, D. E. Moller and T. W. Doebber (2006). "Peroxisome proliferatoractivated receptor (PPAR)-alpha agonism prevents the onset of type 2 diabetes in
Zucker diabetic fatty rats: A comparison with PPAR gamma agonism."
Endocrinology 147(9): 4252-4262.
Bihan, H., C. Rouault, G. Reach, V. Poitout, B. Staels and M. Guerre-Millo (2005).
"Pancreatic islet response to hyperglycemia is dependent on peroxisome
proliferator-activated receptor alpha (PPARalpha)." FEBS Lett 579(11): 22842288.
Bustin, S. A., V. Benes, J. A. Garson, J. Hellemans, J. Huggett, M. Kubista, R. Mueller,
T. Nolan, M. W. Pfaffl, G. L. Shipley, J. Vandesompele and C. T. Wittwer
(2009). "The MIQE guidelines: minimum information for publication of
quantitative real-time PCR experiments." Clin Chem 55(4): 611-622.
Chinetti, G., J. C. Fruchart and B. Staels (2000). "Peroxisome proliferator-activated
receptors (PPARs): nuclear receptors at the crossroads between lipid metabolism
and inflammation." Inflamm Res 49(10): 497-505.
Dalby, B., S. Cates, A. Harris, E. C. Ohki, M. L. Tilkins, P. J. Price and V. C. Ciccarone
(2004). "Advanced transfection with Lipofectamine 2000 reagent: primary
neurons, siRNA, and high-throughput applications." Methods 33(2): 95-103.
Eisner, M., W. Gehrmann and S. Lenzen (2011). "Peroxisome-generated hydrogen
peroxide as important mediator of lipotoxicity in insulin-producing cells."
Diabetes 60(1): 200-208.
Frederiksen, K. S., E. M. Wulff, P. Sauerberg, J. P. Mogensen, L. Jeppesen and J.
Fleckner (2004). "Prediction of PPAR-alpha ligand-mediated physiological
changes using gene expression profiles." J Lipid Res 45(3): 592-601.
Frigerio, F., T. Brun, C. Bartley, A. Usardi, D. Bosco, K. Ravnskjaer, S. Mandrup and P.
Maechler (2010). "Peroxisome proliferator-activated receptor alpha (PPARalpha)
protects against oleate-induced INS-IE beta cell dysfunction by preserving
carbohydrate metabolism." Diabetologia 53(2): 331-340.
Gehrmann, W., M. Eisner and S. Lenzen (2010). "Role of metabolically generated
reactive oxygen species for lipotoxicity in pancreatic beta-cells." Diabetes Obes
Metab 12 Suppl 2: 149-158.
Giacca, A., C. Xiao, A. I. Oprescu, A. C. Carpentier and G. F. Lewis (2011). "Lipidinduced pancreatic beta-cell dysfunction: focus on in vivo studies." Am J Physiol
Endocrinol Metab 300(2): E255-262.

105

Gonzalez, F. J., J. M. Peters and R. C. Cattley (1998). "Mechanism of action of the
nongenotoxic peroxisome proliferators: role of the peroxisome proliferatoractivator receptor alpha." J Natl Cancer Inst 90(22): 1702-1709.
Guerre-Millo, M., P. Gervois, E. Raspe, L. Madsen, P. Poulain, B. Derudas, J. M.
Herbert, D. A. Winegar, T. M. Willson, J. C. Fruchart, R. K. Berge and B. Staels
(2000). "Peroxisome proliferator-activated receptor alpha activators improve
insulin sensitivity and reduce adiposity." J Biol Chem 275(22): 16638-16642.
Guerre-Millo, M., C. Rouault, P. Poulain, J. Andre, V. Poitout, J. M. Peters, F. J.
Gonzalez, J. C. Fruchart, G. Reach and B. Staels (2001). "PPAR-alpha-null mice
are protected from high-fat diet-induced insulin resistance." Diabetes 50(12):
2809-2814.
Gwiazda, K. S., T. L. Yang, Y. Lin and J. D. Johnson (2009). "Effects of palmitate on ER
and cytosolic Ca2+ homeostasis in beta-cells." Am J Physiol Endocrinol Metab
296(4): E690-701.
Hellemans, K., K. Kerckhofs, J. C. Hannaert, G. Martens, P. Van Veldhoven and D.
Pipeleers (2007). "Peroxisome proliferator-activated receptor alpha-retinoid X
receptor agonists induce beta-cell protection against palmitate toxicity." FEBS J
274(23): 6094-6105.
Hoivik, D. J., C. W. Quails, Jr., R. C. Mirabile, N. F. Cariello, C. L. Kimbrough, H. M.
Colton, S. P. Anderson, M. J. Santostefano, R. J. Morgan, R. R. Dahl, A. R.
Brown, Z. Zhao, P. N. Mudd, Jr., W. B. Oliver, Jr., H. R. Brown and R. T. Miller
(2004). "Fibrates induce hepatic peroxisome and mitochondrial proliferation
without overt evidence of cellular proliferation and oxidative stress in
cynomolgus monkeys." Carcinogenesis 25(9): 1757-1769.
Holness, M. J., N. D. Smith, G. K. Greenwood and M. C. Sugden (2003). "Acute (24 h)
activation of peroxisome proliferator-activated receptor-alpha (PPARalpha)
reverses high-fat feeding-induced insulin hypersecretion in vivo and in perifiised
pancreatic islets." J Endocrinol 177(2): 197-205.
Huynh, F. K., J. Levi, H. C. Denroche, S. L. Gray, P. J. Voshol, U. H. Neumann, M.
Speck, S. C. Chua, S. D. Covey and T. J. Kieffer (2010). "Disruption of hepatic
leptin signaling protects mice from age- and diet-related glucose intolerance."
Diabetes 59(12): 3032-3040.
Kersten, S., J. Seydoux, J. M. Peters, F. J. Gonzalez, B. Desvergne and W. Wahli (1999).
"Peroxisome proliferator-activated receptor alpha mediates the adaptive response
to fasting." J Clin Invest 103(11): 1489-1498.

106

Koh, E. H., M. S. Kim, J. Y. Park, H. S. Kim, J. Y. Youn, H. S. Park, J. H. Youn and K.
U. Lee (2003). "Peroxisome proliferator-activated receptor (PPAR)-alpha
activation prevents diabetes in OLETF rats: comparison with PPAR-gamma
activation." Diabetes 52(9): 2331-2337.
Koves, T. R., J. R. Ussher, R. C. Noland, D. Slentz, M. Mosedale, O. Ilkayeva, J. Bain,
R. Stevens, J. R. Dyck, C. B. Newgard, G. D. Lopaschuk and D. M. Muoio
(2008). "Mitochondrial overload and incomplete fatty acid oxidation contribute to
skeletal muscle insulin resistance." Cell Metab 7(1): 45-56.
Lalloyer, F., B. Vandewalle, F. Percevault, G. Torpier, J. Kerr-Conte, M. Oosterveer, R.
Paumelle, J. C. Fruchart, F. Kuipers, F. Pattou, C. Fievet and B. Staels (2006).
"Peroxisome proliferator-activated receptor alpha improves pancreatic adaptation
to insulin resistance in obese mice and reduces lipotoxicity in human islets."
Diabetes 55(6): 1605-1613.
Lee, C. H., P. Olson and R. M. Evans (2003). "Minireview: lipid metabolism, metabolic
diseases, and peroxisome proliferator-activated receptors." Endocrinology 144(6):
2201-2207.
Loh, K., H. Deng, A. Fukushima, X. Cai, B. Boivin, S. Galic, C. Bruce, B. J. Shields, B.
Skiba, L. M. Ooms, N. Stepto, B. Wu, C. A. Mitchell, N. K. Tonks, M. J. Watt,
M. A. Febbraio, P. J. Crack, S. Andrikopoulos and T. Tiganis (2009). "Reactive
oxygen species enhance insulin sensitivity." Cell Metab 10(4): 260-272.
Mandard, S., M. Muller and S. Kersten (2004). "Peroxisome proliferator-activated
receptor alpha target genes." Cell Mol Life Sci 61(4): 393-416.
Medina-Gomez, G., S. L. Gray, L. Yetukuri, K. Shimomura, S. Virtue, M. Campbell, R.
K. Curtis, M. Jimenez-Linan, M. Blount, G. S. Yeo, M. Lopez, T. SeppanenLaakso, F. M. Ashcroft, M. Oresic and A. Vidal-Puig (2007). "PPAR gamma 2
prevents lipotoxicity by controlling adipose tissue expandability and peripheral
lipid metabolism." PLoS Genet 3(4): e64.
Oprescu, A. I., G. Bikopoulos, A. Naassan, E. M. Allister, C. Tang, E. Park, H. Uchino,
G. F. Lewis, I. G. Fantus, M. Rozakis-Adcock, M. B. Wheeler and A. Giacca
(2007). "Free fatty acid-induced reduction in glucose-stimulated insulin secretion:
evidence for a role of oxidative stress in vitro and in vivo." Diabetes 56(12):
2927-2937.
Qin, Y. M., M. H. Poutanen, H. M. Helander, A. P. Kvist, K. M. Siivari, W. Schmitz, E.
Conzelmann, U. Hellman and J. K. Hiltunen (1997). "Peroxisomal
multifunctional enzyme of beta-oxidation metabolizing D-3-hydroxyacyl-CoA
esters in rat liver; molecular cloning, expression and characterization." Biochem J
321 (Pt 1): 21-28.

107

Ravnskjaer, K., M. Boergesen, B. Rubi, J. K. Larsen, T. Nielsen, J. Fridriksson, P.
Maechler and S. Mandrup (2005). "Peroxisome proliferator-activated receptor
alpha (PPARalpha) potentiates, whereas PPARgamma attenuates, glucosestimulated insulin secretion in pancreatic beta-cells." Endocrinology 146(8):
3266-3276.
Reddy, J. K. and T. Hashimoto (2001). "Peroxisomal beta-oxidation and peroxisome
proliferator-activated receptor alpha: an adaptive metabolic system." Annu Rev
Nutr 21: 193-230.
Riedel, M. J., D. F. Gaddy, A. Asadi, P. D. Robbins and T. J. Kieffer (2010). "DsAAV8mediated expression of glucagon-like peptide-1 in pancreatic beta-cells
ameliorates streptozotocin-induced diabetes." Gene Ther 17(2): 171-180.
Skelin, M., M. Rupnik and A. Cencic (2010). "Pancreatic beta cell lines and their
applications in diabetes mellitus research." ALTEX 27(2): 105-113.
Staels, B., M. Maes and A. Zambon (2008). "Fibrates and future PPARalpha agonists in
the treatment of cardiovascular disease." Nat Clin Pract Cardiovasc Med 5(9):
542-553.
Sugden, M. C., G. K. Greenwood, N. D. Smith and M. J. Holness (2003). "Peroxisome
proliferator-activated receptor-alpha activation during pregnancy attenuates
glucose-stimulated insulin hypersecretion in vivo by increasing insulin sensitivity,
without impairing pregnancy-induced increases in beta-cell glucose sensing and
responsiveness." Endocrinology 144(1): 146-153.
Sun, Y., L. Zhang, H. F. Gu, W. Han, M. Ren, F. Wang, B. Gong, L. Wang, H. Guo, W.
Xin, J. Zhao and L. Gao (2008). "Peroxisome proliferator-activated receptor-alpha
regulates the expression of pancreatic/duodenal homeobox-1 in rat insulinoma
(INS-1) cells and ameliorates glucose-induced insulin secretion impaired by
palmitate." Endocrinology 149(2): 662-671.
Thorn, K. and P. Bergsten (2010). "Fatty acid-induced oxidation and triglyceride
formation is higher in insulin-producing MIN6 cells exposed to oleate compared
to palmitate." J Cell Biochem 111(2): 497-507.
Tordjman, K., K. N. Standley, C. Bernal-Mizrachi, T. C. Leone, T. Coleman, D. P. Kelly
and C. F. Semenkovich (2002). "PPARalpha suppresses insulin secretion and
induces UCP2 in insulinoma cells." J Lipid Res 43(6): 936-943.
Virtue, S. and A. Vidal-Puig (2010). "Adipose tissue expandability, lipotoxicity and the
Metabolic Syndrome—an allostatic perspective." Biochim Biophvs Acta 1801(3):
338-349.

108

Wang, A. Y., P. D. Peng, A. Ehrhardt, T. A. Storm and M. A. Kay (2004). "Comparison
of adenoviral and adeno-associated viral vectors for pancreatic gene delivery in
vivo." Hum Gene Ther 15(4): 405-413.
Xiao, C., A. Giacca and G. F. Lewis (2008). "Oral taurine but not N-acetylcysteine
ameliorates NEFA-induced impairment in insulin sensitivity and beta cell
function in obese and overweight, non-diabetic men." Diabetologia 51(1): 139146.
Xiao, J., S. Gregersen, M. Kruhoffer, S. B. Pedersen, T. F. Orntoft and K. Hermansen
(2001). "The effect of chronic exposure to fatty acids on gene expression in clonal
insulin-producing cells: studies using high density oligonucleotide microarray."
Endocrinology 142(11): 4777-4784.
Yajima, K., H. Hirose, H. Fujita, Y. Seto, K. Ukeda, K. Miyashita, T. Kawai, Y.
Yamamoto, T. Ogawa, T. Yamada and T. Saruta (2003). "Combination therapy
with PPARgamma and PPARalpha agonists increases glucose-stimulated insulin
secretion in db/db mice." Am J Physiol Endocrinol Metab 284(5): E966-971.
Yessoufou, A., J. M. Ategbo, E. Attakpa, A. Hichami, K. Moutairou, K. L. Dramane and
N. A. Khan (2009). "Peroxisome proliferator-activated receptor-alpha modulates
insulin gene transcription factors and inflammation in adipose tissues in mice."
Mol Cell Biochem 323(1-2): 101-111.

109

APPENDIX

Figure SI. Transfection efficiency of MIN6-eGFP cells. (A) 30% efficiency; 1 day posttransfection. (B) 50-60% efficiency; 2 days post-transfection. Image taken with FITC
filter at lOx magnification using confocal microscope (Olympus).

110

eGFPl

eGFP2

eGFP3

eGFP4

PPARaiPPARa2

PPARui

PPARa*

Figure S2. RNA Quality Control Gel for MIN6-eGFP and MIN6-PPARa Transfected
Cells. Running Conditions (1.5% Agarose, lx TAE Running Buffer, 100V, 1 hour,
Stained with EtBr). All samples show clean 18S and 28S bands indicating no
degradation of RNA collected from the transfected MIN6 cells.

Ill

No
digcit
eGFP

eGFP

1:10

No

eGFP

d gest
PPARa

PPARa

1:10
PPARa

Figure S3. Double Restriction Digests of Purified Plasmid Samples for Viral Construct
Preparation. Restriction digests were run using no digest, pure plasmid, and 1:10 dilution
of plasmid. Restriction Enzymes for eGFP (Mlul and NotI), PPARa (Hindlll and Mlul).
Running Conditions (1.5% Agarose, 0.5x TBE Running Buffer, 100V, 1 hour, Stained
with SYBR Safe).

112

CHAPTER 4

Overexpression of PPARa in Pancreatic p-cells Does Not Improve Glucose
Tolerance in a Severely Obese Genetic Model (db/db mouse).

A version of this chapter has been submitted:
Hogh, K-Lynn N., Uy, Christopher E., Asadi, A., Baker, Robert K., Riedel, Michael J.,
Gray, Sarah L. 2012. Overexpression of PPARa in pancreatic P-cells improves glucose
tolerance in diet-induced obese mice. Endocrinology. Manuscript Submission number:
EN-12-1110.

113

4.1 INTRODUCTION
Animals have been used in diabetes research as early as the 1880's (Rees and
Alcolado 2005). The use of animals was best exemplified by Banting and Best in the
1920's, when they used pancreatectomized dogs for the isolation and discovery of insulin
(Banting et al. 1922; Bliss 1982; Rosenfeld 2002; Rees and Alcolado 2005). The use of
mouse models in research has become increasingly important to elucidate the
mechanisms involved in the progression of obesity-induced T2D. In addition to the dietinduced obese model of T2D (C57B16 mice on HFD) used in chapter three, there are
various obese and non-obese rodent models utilized in diabetes research, including: i)
spontaneous/genetically derived (ie. ob/ob and db/db), ii) diet-induced (ie. C57B16), iii)
chemically induced (ie. alloxan or streptozotocin), iv) surgically induced (ie. lesion of
ventromedial hypothalamus), and v) transgenic/knock-out mice (ie. 03, GLUT-4, and
IRS-1) (Rees and Alcolado 2005; Srinivasan and Ramarao 2007; Shafrir and Ziv 2009).
As our lab is interested in elucidating the mechanisms involved in P-cell lipotoxicity and
obesity-induced T2D, the severely obese ob/ob or db/db mouse models (Fig 4.1) are most
appropriate for future studies involving the overexpression of PPARa in pancreatic Pcells. Phenotypically the ob/ob and db/db mice are severely obese, hyperphagic, insulin
resistant, hyperinsulinemic and hyperglycemic (Coleman and Hummel 1967; Coleman
and Hummel 1973; Srinivasan and Ramarao 2007). Both of these mouse models involve
either a mutation in the leptin gene (ob/ob) or leptin receptor (db/db) (Coleman and
Hummel 1967; Coleman and Hummel 1973).

114

Figure 4.1 Comparing male C57B16 littermate controls to db/db (A) and ob/ob (B) mice.
Mice purchased from JAX laboratories at four weeks of age. Images from Jackson
Laboratories website: http://jaxmice.jax.org [electronic document] accessed Dec 15 2011.

115

116

The adipocyte-derived hormone leptin acts on the central nervous system and
peripheral tissues to reduce fat stores by suppressing appetite, increasing metabolic rate,
and activating thermogenesis (Muoio and Lynis Dohm 2002; Ceddia 2005; Unger 2005;
Zhao et al. 2006; Gray and Vidal-Puig 2007; Friedman 2010). In a negative feedback
loop, leptin acts on the receptors of the hypothalamus to regulate appetite and energy
homeostasis (Friedman 2010); where increases in adiposity results in increased leptin
levels and vice versa (Schroeder-Gloeckler et al. 2007; Friedman 2010). Leptin has also
been implicated to have direct effects on glucose metabolism similar to that of insulin
(Huynh et al. 2010). Kieffer and colleagues (1997) utilized patch clamps in ob/ob mice
to show that leptin reduces insulin secretion through the activation of the KATP channels
in the P-cells of the pancreas (Kieffer et al. 1997). These results were further supported
by the work completed by Lee and Romsos (2003), where the authors were able to show
that when treated with exogenous leptin, hypersecretion of insulin was normalized in
ob/ob mice (Lee and Romsos 2003). Further adding to leptin's role in P-cell function,
studies involving leptin therapy have shown a reversal in hyperglycemia in diabetic
mouse models (Chinookoswong et al. 1999; Hidaka et al. 2002; Wang et al. 2010;
Denroche et al. 2011) by lowering blood glucose and plasma insulin without affecting
body weight (Kulkarni et al. 1997; Seufert et al. 1999; Gray et al. 2010). Clinically,
Farooqi et al. (1999) were able to show that administration of recombinant leptin in
humans reduces body weight and decreases food intake, as seen with their nine-year old
patient with a frame-shift mutation in the leptin gene (Farooqi et al. 1999). This study
further confirmed the importance of leptin in energy balance and appetite regulation
(Farooqi et al. 1999).

117

The discovery of naturally occurring leptin mutations in mice has provided to be a
useful tool in diabetes research, as it provides to be a model of severe obesity and
diabetes. Leptin deficient (ob/ob) and leptin receptor deficient (db/db) mice were
characterized by George Snell and Doug Coleman and colleagues from the Jackson
Laboratories between 1950 and 1970 (Coleman and Hummel 1967; Coleman and
Hummel 1973; Friedman 2010). Collectively the ob/ob and db/db mice show highly
elevated plasma insulin levels, severely increased body mass, hyperphagia, no satiety,
and hyperglycemia as early as three to four weeks of age (Coleman and Hummel 1967;
Coleman and Hummel 1973; Zhang et al. 1994; Kobayashi et al. 2000). In 1994, Zhang
and colleagues utilized positional cloning in C57B16 and DBA/2JA mice to determine
that ob gene product was involved in the regulation of body fat deposition (Zhang et al.
1994). More importantly, this study identified the ob gene as the leptin gene (Zhang et
al. 1994).
The ob/ob mouse is characterized by a mutation in the ob gene, which results in
severe obesity through the disruption of the leptin signaling pathway (Zhang et al. 1994;
Farooqi et al. 2002). The ob/ob mouse is characterized by an autosomal recessive
mutation on chromosome 6 on the ob gene (Coleman and Hummel 1973; Srinivasan and
Ramarao 2007). In addition to severe obesity, ob/ob mice develop extreme
hyperglycemia and hyperinsulinemia by nine weeks of age, which results in hypertrophy
and degranulation of pancreatic p-cells (Coleman and Hummel 1973; Srinivasan and
Ramarao 2007). Interestingly, the ob/ob mice have also been observed to have transient
hyperglycemia, followed by hyperinsulinemia and euglycemia (Coleman and Hummel
1973).

118

In contrast to the ob/ob mouse, the db/db model is characterized by severe
obesity, hyperinsulinemia, hyperglycemia, and dyslipidemia as early as three weeks of
age (Coleman and Hummel 1967; Kieffer and Habener 2000). The db/db mutation is
characterized by an autosomal recessive mutation on chromosome 4 of the db gene
(Coleman and Hummel 1967; Srinivasan and Ramarao 2007; Shafrir and Ziv 2009),
resulting in a defective leptin receptor encoded by the db gene (Coleman and Hummel
1967; Friedman 2010). It should be noted that degranulation and increased apoptosis can
be observed as early as 25 days after birth in db/db islets (Coleman and Hummel 1967;
Kobayashi et al. 2000). Additionally islets of db/db mice have been observed to fail via
increased pancreatic necrosis and atrophy (Coleman and Hummel 1967; Kobayashi et al.
2000; Shafrir and Ziv 2009), thus resulting in end-stage p-cell failure. Therefore, as the
severity of obesity and development of the diabetic phenotype occurs at an early age in
both ob/ob and db/db mice, these mouse models are ideal for short-term studies
elucidating the mechanisms involved in P-cell lipotoxicity, severe obesity and diabetes.
The objective of this study is to utilize the db/db model of genetic obesity to
replicate and tease apart the observations made in our model of P-cell specific
overexpression of PPARa in a diet-induced model of obesity and T2D. We hypothesize
that overexpression of PPARa in the pancreatic P-cells of db/db mice will delay the
progression and severity of P-cell dysfunction in these mice compared to $-e,GY?-db/db
controls. Additionally, this study will allow us to test the effectiveness and potency of
PPARa overexpression in a severe model of genetic obesity; thus further characterizing
the role of PPARa overexpression in pancreatic P-cells in vivo.

119

4.2 MATERIALS AND METHODS
Mice.
All animal studies were approved by the University of Northern British Columbia
Animal Care and Use Committee (protocol number 2011-21). For all experiments, 3week-old, male, C57B16 mice (littermate controls) and db/db mice (BKS.Cg-w +/+
LeprdbIJ) were purchased from Jackson Laboratories (Bar Harbor ME, USA). Mice were
maintained on a 12 hr light/dark cycle and received standard rodent chow diet (Rodent
LabDiet, 5001, Leduc AB, Canada) ad libitum unless otherwise stated. Mice were
allowed to acclimatize to the animal facility for 1 week prior to performing any
experimental procedures. Body weight, 4hr fasted blood glucose (OneTouch Ultra,
Lifescan, Burnaby BC, Canada), oral glucose tolerance tests (via OGTT) and insulin
sensitivity tests (via ITT) were performed prior to viral injections to assess baseline
carbohydrate metabolism as described below and in chapter 3.
Pancreatic p-cell specific overexpression of PPARa in genetically obese mice.
Six-week-old male db/db mice were infected with dsAAV8-RIP-PPARa adenoassociated virus (P-PPARa-t/M/6, n=6; 5x1012 viral genomes/583(il/mouse) or dsAAV8RIP-eGFP virus (p-eGFP-db/db control group, n=7; 5x1012 viral genomes/574(xl/mouse)
by ip injection. A group of age-matched, male, wildtype, C57B16 mice were given an ip
injection of saline to serve as lean controls (n=7; 574^1 saline/mouse). Body weight was
monitored weekly, and blood glucose levels (OneTouch Ultra, Lifescan Burnaby BC,
Canada) and circulating plasma insulin levels (ALPCO) were monitored twice weekly.
Insulin sensitivity (ITT) was also assessed. All animals were sacrificed 4 weeks post­
infection by C02 euthanization and cerebral-spinal dislocation. Tissues were collected

120

by dissection and flash frozen or fixed in 4% paraformaldehyde in IX PBS for 48 hrs and
then stored in 70% EtOH.
Insulin tolerance tests.
Mice were fasted for 4 hrs and given an ip injection of human synthetic insulin at
0.75U/kg or l.OU/kg (Novolin Ge, Toronto ON, Canada). Blood was sampled (1-2 ^1)
from the saphenous vein and blood glucose measured (mmol/L) at 10, 20 30, 60, and 120
min post injection (OneTouch Ultra, Lifescan Burnaby BC, Canada).
Glucose-stimulated insulin secretion.
Mice were fasted for 16 hrs and given 2g/kg D-glucose by oral gavage. Blood
(15-20 |il) was sampled at 5, 10 and 180 minutes post glucose gavage from the saphenous
vein and blood glucose (mmol/L) (OneTouch Ultra, Lifescan, Burnaby BC, Canada)
(Huynh et al. 2010).
Overnight fasted and re-fed plasma insulin levels.
Mice were fasted for 16 hrs and blood collected in heparinized capillary tubes
(Fisher Scientific, Ottawa ON, Canada) from the saphenous vein. Food was reintroduced
for 2 hrs and blood collected again. Blood glucose was determined using a hand held
glucometer (OneTouch Ultra, Lifescan, Burnaby BC, Canada) and plasma insulin levels
were assessed by ELISA. 5(^1 of each sample was run in triplicate with conjugate buffer
(75^1) and shaken at 800rpm on a microplate shaker for 2 hrs at room temperature.
Samples were then washed with wash buffer and incubated for 15 min at 800rpm with
TMB substrate. Stop solution was then added to samples and quantified at 450nm on a
plate reader (Ultrasensitive insulin ELISA assay, 80-INSMSU-E10, ALPCO, Salem NH,
USA).

121

Immunohistological analysis.
Whole mouse pancreas sections were previously fixed in 4% paraformaldehyde
and embedded in paraffin and sectioned at 5|am thickness; n=5 per group (Wax-it
Histology Services; Vancouver BC, Canada). All sections were de-paraffinized and
rehydrated as described previously in chapters 2 and 3(Riedel et al. 2010). Sections were
incubated with polyclonal primary antibodies to rabbit anti-eGFP (1:500) (Al 1122,
Invitrogen Molecular Probes, Carlsbad CA, USA), polyclonal guinea pig anti-insulin
(1:1000) (4011-01F, Millipore, Billerica MA, USA) and a monoclonal primary antibody
to mouse anti-glucagon (1:1000) (G2654, Sigma) overnight. Appropriate secondary
whole (heavy and light chain) antibodies conjugated to Alexafluor 488 (A21206 or
A21202) or 594 (Al 1076 or Al 1032) (1:1000) (Invitrogen Molecular Probes) were used
to detect primary antibody immunoreactivity. All sections were blocked using serumfree blocking solution (DAKO, Burlington ON, Canada) and heat-induced antigen
retrieval performed using 6M citrate buffer. All samples were visualized using a
fluorescent light microscope (Olympus BX61) and images observed using Cell Sens
Software (Olympus, Markham ON, Canada).
Statistical analysts.
Results are expressed as mean ± standard error of the mean. Analyses were
performed using paired student's t-test and 1-way ANOVA (significance between two
groups), or 2-way ANOVAs (significance between groups over time) with Bonferoni
Post tests using Graphpad Prism 5.0 software (La Jolla CA, USA). Significance was
declared if p-values were less than 0.05. *P<0.05, **P<0.01, ***P<0.001.

122

4.3 RESULTS
Overexpression of PPARa in pancreatic p-cells does not improve carbohydrate
metabolism in a model of severe genetic obesity {db/db).
P-eGFP-db/db control mice and p-PPARa-db/db mice had no significant
difference for 2 hr fed blood glucose levels (Fig. 4.2a). PPARa overexpression
specifically in pancreatic p-cells did not significantly affect body weight (Fig. 4.2b), or
plasma (circulating) insulin levels (Fig. 4.2c) when compared to obese controls. As
expected, both fasted and fed blood glucose and plasma insulin levels of P-eGFP-db/db
and fy-WARst-db/db mice were significantly higher compared to C57B16 littermate
controls. Additionally insulin sensitivity did not differ between groups, however as
expected, both P-eGFP-db/db and P-PPARa-db/db are significantly more insulin resistant
than the wild type controls (Fig. 4.2d). As expected with the insulin sensitivity (ITT) the
wild type controls had a 50% reduction in blood glucose (10 minutes post insulin
injection) and by 30 minutes post infection blood glucose levels were on the rise. The
complete opposite was observed with the P-eGFP-db/db and p-PPARa-db/db mice,
where a spike in blood glucose levels was observed 10 minutes post-injection; this rise in
blood glucose could be attributed to their severe insulin resistance as well as an increase
in counter regulatory and stress hormones.

123

Figure 4.2 Overexpression of PPARa in p-cells of genetically obese mice (db/db) did not
improve glucose homeostasis. (A) Fast and fed blood glucose levels. (B) body weight,
(C) plasma insulin levels, and (D) insulin sensitivity (0.75U/kg insulin for wild-type
mice; 1.5U/kg insulin for db/db mice) in db/db mice.
-db/db n=7, p-PPARadb/db n=6. *P<0.05.

124

Plasma insulin Concentration (ng/mL)

o

Blood Glucose (mmol/L)

TJ CD =.•

•o CD 9-

JJ TJ

73 U

a

Blood Glucose (mmol/L)

Body Weight (g)

g,
>

0 •»
"D<p 5
:pD9>X"0-Tv^

0 •*
CT) ~
> TVS'

II
$ Cr

Overexpression of PPARa in pancreatic p-cells does not affect islet morphology in
genetically obese mice (db/db)
Immunohistochemical analysis of insulin and glucagon in pancreatic p-cells
overexpressing PPARa did not reveal any difference in insulin or glucagon positive
immunoreactivity when compared to p-eGFP-db/db controls (Fig. 4.3). Additionally,
islets were stained for eGFP/insulin and eGFP/glucagon immunoreactivity (Fig. 4.4)
showing eGFP expression in islets of the db/db mice four weeks post infection. It has
been suggested that dsAAV8 vectors do not elicit an immune response (Gao et al. 2002;
Wang et al. 2006; Gaddy et al. 2010), however further analysis using appropriate
apoptotic staining is required to confirm these results in db/db mice. Furthermore, total
insulin and glucagon positive stained areas were not analyzed as no physiological
changes were observed, therefore p-cell and a-cell masses were not calculated.

126

Figure 4.3 Overexpression of PPARa in P-cells of genetically obese mice (db/db) does
not affect islet morphology of insulin immuno-positive area. Abbreviations: INS insulin; GLC - glucagon. Images taken at 20x magnification. Scale bar 50|am.

127

8ZX

uirlos

Figure 4.4 Overexpression of dsAAV8-RIP-eGFP in P-cells of genetically obese mice
(idb/db) is targeted to the P-cells and not a-cells of pancreatic islets. Abbreviations: INS insulin; GLC - glucagon; GFP - green fluorescent protein. Images taken at 20x
magnification. Scale bar 50(im.

129

0£I

UJTIOS

4.4 DISCUSSION
Utilizing a genetic model of severe obesity, specifically a mutation with the leptin
receptor (db/db mice), our group characterized the effects of p-cell specific
overexpression of PPARa to ascertain if improvements seen with glucose tolerance in a
HFD model of obesity would be observed in a more severe model of genetic obesity.
Our group has demonstrated that overxpressing PPARa in the pancreatic P-cells of db/db
mice has no protective effects against P-cell dysfunction when compared to P-eGFPdb/db controls. This study was carried out for a total of four weeks, where mice were
infected for four weeks prior to collection. We speculate that the lack of protective
effects observed in this model compared to the diet-induced model maybe; i) the db/db
model of obesity is too severe and the levels of circulating TGs and FAs have
overwhelmed the P-cell causing p-cell dysfunction, ii) p-cells of the db/db mice are
severely impaired and have reached P-cell failure, and iii) four weeks of overexpression
is too short to see the beneficial effects of PPARa observed in our diet-induced model.
Gaddy and colleagues (2010) utilized the db/db mouse model to determine if
expression of GLP-1 via dsAAV8 to the pancreatic P-cells improves the diabetic state
(Gaddy et al. 2010). AAV direct targeting of GLP-1 in the P-cells has been shown
previously to enhance islet proliferation and delay the progression of diabetes in db/db
mice (Gaddy et al. 2010). Additionally, the authors used a dose of 4xlOnvg/mouse for
their db/db mice and speculated that increasing the viral dose (greater than 10l2vg/mouse)
would greatly enhance the efficacy of viral transduction compensating for increased body
mass of db/db mice (Gaddy et al. 2010). Therefore, improvements in glucose tolerance
may have been observed in P-PPARa-db/db mice had we increased the viral load per

131

mouse, as opposed to giving the standard 5xl012 vg/mouse. Additionally it has been
suggested that the effectiveness of dsAAV8 virus delivery can be seen as early as four
weeks post infection (Wu et al. 2006). We have conclusively shown in chapter 2, that
eGFP is expressed in the pancreatic P-cells as early as three weeks post infection when
utilizing dsAAV8-RIP-eGFP. Moreover, we have shown eGFP to be expressed in the
pancreatic p-cells in db/db mice four weeks post infection (Fig. 4.4). Therefore it is
possible that PPARa expression is present in the islets of db/db mice; however, as the
duration of our study lasted four weeks post infection, the physiological effects and
beneficial potential of PPARa overexpression may not have been observed. For example
we would expect PPARa overexpression to turn on genes involved in P-oxidation, but
was the duration long enough to decrease the amount of circulating lipids?
We speculate that had we extended the db/db study by four to six weeks,
improvements similar to those observed in P-PPARa-HFD mice may have been
observed. The severity of the db/db phenotype was an indicator to terminate the study
four weeks post infection. As shown in figure 4.2 a-c, blood glucose levels, body
weights, circulating plasma insulin were significantly higher than age-matched C57B16
littermate controls; indicating that the health of the pancreatic P-cells in the db/db mice
were getting progressively worse. Both p-eGFP-db/db and P-PPARa-db/db mice showed
severe insulin resistance when compared to C57B16 littermate controls (Fig. 4.2d); as
blood glucose levels reached highs of 24.5mmol/L versus dropping to 4.8mmol/L
(C57B16) post insulin injection. Moreover, it should be noted that a glucose tolerance
test (OGTT) was not conducted on the db/db mice due to the severity of their phenotype;
additionally we would have expected glucose levels post gavage to be extremely high,

132

and possibly too high to be detected by a handheld glucometer, given the rise in blood
glucose levels observed when mice were challenged with 1,5U/kg of insulin (Fig. 4.2d).
It should also be noted that due to a lack of physiological changes observed, further
metabolic and immunohistochemical analyses of these islets was not performed.
The whole body improvement in carbohydrate metabolism achieved with
pancreatic p-cell specific overexpression of PPARa in a diet-induced model of obesity
was not replicated in the severely obese, diabetic db/db mouse. The severely impaired
carbohydrate metabolism of this genetic model of obesity was not reversed by four weeks
of |3-cell specific overexpression of PPARa, suggesting that the short duration of PPARa
overexpression may not have been sufficient to improve P-cell function or that the
metabolic changes induced by PPARa by four weeks of overexpression could not
overcome the extreme insulin resistance and lipidemic state induced by the lack of leptin
signaling in these severely obese and diabetic mice.

133

4.5 REFERENCES
Banting, F. G., C. H. Best, J. B. Collip, W. R. Campbell and A. A. Fletcher (1922).
"Pancreatic Extracts in the Treatment of Diabetes Mellitus." Can Med Assoc J
12(3): 141-146.
Bliss, M. (1982). "Banting's, Best's, and Collip's accounts of the discovery of insulin."
Bull Hist Med 56(4): 554-568.
Ceddia, R. B. (2005). "Direct metabolic regulation in skeletal muscle and fat tissue by
leptin: implications for glucose and fatty acids homeostasis." Int J Obes (Lond)
29(10): 1175-1183.
Chinookoswong, N., J. L. Wang and Z. Q. Shi (1999). "Leptin restores euglycemia and
normalizes glucose turnover in insulin-deficient diabetes in the rat." Diabetes
48(7): 1487-1492.
Coleman, D. L. and K. P. Hummel (1967). "Studies with the mutation, diabetes, in the
mouse." Diabetoloeia 3(2): 238-248.
Coleman, D. L. and K. P. Hummel (1973). "The influence of genetic background on the
expression of the obese (Ob) gene in the mouse." Diabetologia 9(4): 287-293.
Denroche, H. C., J. Levi, R. D. Wideman, R. M. Sequeira, F. K. Huynh, S. D. Covey and
T. J. Kieffer (2011). "Leptin therapy reverses hyperglycemia in mice with
streptozotocin-induced diabetes, independent of hepatic leptin signaling."
Diabetes 60(5): 1414-1423.
Farooqi, I. S., S. A. Jebb, G. Langmack, E. Lawrence, C. H. Cheetham, A. M. Prentice, I.
A. Hughes, M. A. McCamish and S. O'Rahilly (1999). "Effects of recombinant
leptin therapy in a child with congenital leptin deficiency." N Engl J Med
341(12): 879-884.
Farooqi, I. S., G. Matarese, G. M. Lord, J. M. Keogh, E. Lawrence, C. Agwu, V. Sanna,
S. A. Jebb, F. Perna, S. Fontana, R. I. Lechler, A. M. DePaoli and S. O'Rahilly
(2002). "Beneficial effects of leptin on obesity, T cell hyporesponsiveness, and
neuroendocrine/metabolic dysfunction of human congenital leptin deficiency." J
Clin Invest 110(8): 1093-1103.
Friedman, J. M. (2010). "A tale of two hormones." Nat Med 16(10): 1100-1106.
Gaddy, D. F., M. J. Riedel, S. Pejawar-Gaddy, T. J. Kieffer and P. D. Robbins (2010). "In
vivo expression of HGF/NK1 and GLP-1 From dsAAV vectors enhances
pancreatic ss-cell proliferation and improves pathology in the db/db mouse model
of diabetes." Diabetes 59(12): 3108-3116.

134

Gao, G. P., M. R. Alvira, L. Wang, R. Calcedo, J. Johnston and J. M. Wilson (2002).
"Novel adeno-associated viruses from rhesus monkeys as vectors for human gene
therapy." Proc Natl Acad Sci U S A 99(18): 11854-11859.
Gray, S. L., C. Donald, A. Jetha, S. D. Covey and T. J. Kieffer (2010).
"Hyperinsulinemia precedes insulin resistance in mice lacking pancreatic beta-cell
leptin signaling." Endocrinology 151(9): 4178-4186.
Gray, S. L. and A. J. Vidal-Puig (2007). "Adipose tissue expandability in the
maintenance of metabolic homeostasis." Nutr Rev 65(6 Pt 2): S7-12.
Hidaka, S., H. Yoshimatsu, S. Kondou, Y. Tsuruta, K. Oka, H. Noguchi, K. Okamoto, H.
Sakino, Y. Teshima, T. Okeda and T. Sakata (2002). "Chronic central leptin
infusion restores hyperglycemia independent of food intake and insulin level in
streptozotocin-induced diabetic rats." FASEB J 16(6): 509-518.
Huynh, F. K., J. Levi, H. C. Denroche, S. L. Gray, P. J. Voshol, U. H. Neumann, M.
Speck, S. C. Chua, S. D. Covey and T. J. Kieffer (2010). "Disruption of hepatic
leptin signaling protects mice from age- and diet-related glucose intolerance."
Diabetes 59(12): 3032-3040.
Jackson Laboratories Online 2011. Images of ob/ob and db/db mice.
http://jaxmice.jax.org [electronic document] accessed Dec 15 2011.
Kieffer, T. J. and J. F. Habener (2000). "The adipoinsular axis: effects of leptin on
pancreatic beta-cells." Am J Physiol Endocrinol Metab 278(1): E1-E14.
Kieffer, T. J., R. S. Heller, C. A. Leech, G. G. Holz and J. F. Habener (1997). "Leptin
suppression of insulin secretion by the activation of ATP-sensitive K+ channels in
pancreatic beta-cells." Diabetes 46(6): 1087-1093.
Kobayashi, K., T. M. Forte, S. Taniguchi, B. Y. Ishida, K. Oka and L. Chan (2000). "The
db/db mouse, a model for diabetic dyslipidemia: molecular characterization and
effects of Western diet feeding." Metabolism 49(1): 22-31.
Kulkarni, R. N., Z. L. Wang, R. M. Wang, J. D. Hurley, D. M. Smith, M. A. Ghatei, D. J.
Withers, J. V. Gardiner, C. J. Bailey and S. R. Bloom (1997). "Leptin rapidly
suppresses insulin release from insulinoma cells, rat and human islets and, in
vivo, in mice." J Clin Invest 100(11): 2729-2736.
Lee, J. W. and D. R. Romsos (2003). "Leptin administration normalizes insulin secretion
from islets of Lep(ob)/Lep(ob) mice by food intake-dependent and -independent
mechanisms." Exp Biol Med (Mavwood) 228(2): 183-187.
Muoio, D. M. and G. Lynis Dohm (2002). "Peripheral metabolic actions of leptin." Best
Pract Res Clin Endocrinol Metab 16(4): 653-666.

135

Rees, D. A. and J. C. Alcolado (2005). "Animal models of diabetes mellitus." Diabet
MM 22(4): 359-370.
Riedel, M. J., D. F. Gaddy, A. Asadi, P. D. Robbins and T. J. Kieffer (2010). "DsAAV8mediated expression of glucagon-like peptide-1 in pancreatic beta-cells
ameliorates streptozotocin-induced diabetes." Gene Ther 17(2): 171-180.
Rosenfeld, L. (2002). "Insulin: discovery and controversy." Clin Chem 48(12): 22702288.
Schroeder-Gloeckler, J. M., S. M. Rahman, R. C. Janssen, L. Qiao, J. Shao, M. Roper, S.
J. Fischer, E. Lowe, D. J. Orlicky, J. L. McManaman, C. Palmer, W. L. Gitomer,
W. Huang, R. M. O'Doherty, T. C. Becker, D. J. Klemm, D. R. Jensen, L. K.
Pulawa, R. H. Eckel and J. E. Friedman (2007). "CCAAT/enhancer-binding
protein beta deletion reduces adiposity, hepatic steatosis, and diabetes in
Lepr(db/db) mice." J Biol Chem 282(21): 15717-15729.
Seufert, J., T. J. Kieffer and J. F. Habener (1999). "Leptin inhibits insulin gene
transcription and reverses hyperinsulinemia in leptin-deficient ob/ob mice." Proc
Natl Acad Sci U S A 96(2): 674-679.
Shafrir, E. and E. Ziv (2009). "A useful list of spontaneously arising animal models of
obesity and diabetes." Am J Physiol Endocrinol Metab 296(6): E1450-1452.
Srinivasan, K. and P. Ramarao (2007). "Animal models in type 2 diabetes research: an
overview." Indian J Med Res 125(3): 451-472.
Unger, R. H. (2005). "Longevity, lipotoxicity and leptin: the adipocyte defense against
feasting and famine." Biochimie 87(1): 57-64.
Wang, M. Y., L. Chen, G. O. Clark, Y. Lee, R. D. Stevens, O. R. Ilkayeva, B. R. Wenner,
J. R. Bain, M. J. Charron, C. B. Newgard and R. H. Unger (2010). "Leptin
therapy in insulin-deficient type I diabetes." Proc Natl Acad Sci USA 107(11):
4813-4819.
Wang, Z., T. Zhu, K. K. Rehman, S. Bertera, J. Zhang, C. Chen, G. Papworth, S.
Watkins, M. Trucco, P. D. Robbins, J. Li and X. Xiao (2006). "Widespread and
stable pancreatic gene transfer by adeno-associated virus vectors via different
routes." Diabetes 55(4): 875-884.
Wu, Z., A. Asokan and R. J. Samulski (2006). "Adeno-associated virus serotypes: vector
toolkit for human gene therapy." Mol Ther 14(3): 316-327.

136

Zhang, Y., R. Proenca, M. Maffei, M. Barone, L. Leopold and J. M. Friedman (1994).
"Positional cloning of the mouse obese gene and its human homologue." Nature
372(6505): 425-432.

Zhao, Y. F., D. D. Feng and C. Chen (2006). "Contribution of adipocyte-derived factors
to beta-cell dysfunction in diabetes." Int J Biochem Cell Biol 38(5-6): 804-819.

137

CHAPTER 5

Developing a model of PPARa overexpression in the pancreatic P-cells in vivo:
concluding remarks, future directions and significance

138

5.1 CONCLUDING REMARKS
It has been well established that lipotoxicity is an underlying mechanism involved
in P-cell dysfunction and obesity-induced T2D (Kasuga 2006; Prentki and Nolan 2006;
Poitout and Robertson 2008). Moreover, obesity, its associated comorbities and T2D
have reached epidemic levels in the past few years and are placing an overwhelming
economic burden on health care systems worldwide (Dixon 2010). Therefore it is
important to elucidate the mechanisms involved in obesity-induced p-cell lipotoxicity to
postulate appropriate treatment strategies, and new therapeutic paradigms.
Our group is the first to have developed a new in vivo mouse model of P-cell
specific overexpression of PPARa in obesity-induced P-cell lipotoxicity. Utilizing
dsAAV8 as our tool of gene delivery we have avoided potential complications of
utilizing transgenic mouse models (outlined in chapter 2). Furthermore, our study has
provided insight into the direct in vivo effects of PPARa overexpression in the pancreatic
p-cells and its impact in whole-animal carbohydrate metabolism. In addition, our lab has
developed a model to study lipotoxic changes in the metabolism directly in the pancreatic
P-cells. Having shown improved glucose tolerance and maintained 1SI phase insulin
secretion, there is the possibility of using dsAAV8 delivered PPARa as a preventable
therapeutic for preserving P-cell function in obesity-induced T2D. Moreover, it is likely
to utilize PPARa treated isolated islets as a preventable therapeutic for islet
transplantation; further protecting the islets from lipid accumulation and increasing the
longevity of transplanted islets.
Taken together, our findings have provided new insights and advancements for future
studies involving in vivo PPARa overexpression in P-cell lipotoxicity. We have

139

developed an in vivo mouse model that can be utilized to elucidate the protective role of
PPARa in p-cell dysfunction and lipotoxicity, as well as applying these findings to future
treatment and therapeutics in obesity-induced T2D.

140

5.2 FUTURE DIRECTIONS
As the work in this thesis demonstrates, our lab has developed an in vivo model of
P-cell specific overexpression of PPARa in the context of obesity-induced T2D to
examine the effects of P-cell lipotoxicity. It should be noted that this study has allowed
or group to characterize the physiological consequences of p-cell specific overexpression
of PPARa in vivo; thus we can now move forward with molecular analyses to uncover
the mechanisms and specific changes in glucose metabolism in our model of P-cell
lipotoxicity. In vitro, PPARa overexpression in MIN6 and INS-IE cells has been
extensively studied by numerous groups (Ravnskjaer et al. 2005; Hellemans et al. 2007;
Frigerio et al. 2010); therefore the following in vivo studies will be considered.
There are several avenues that could be explored to further characterize the in
vivo effects of PPARa overexpression on the pancreatic P-cells in a diet-induced obese
mouse model. First and foremost immunofluorescent staining of PPARa in the
pancreatic sections needs to be shown, similar to what is observed in mice overexpressing
eGFP. This would allow us to correlate the improvements observed in glucose tolerance
and maintenance of 1st phase insulin secretion with pancreatic PPARa overexpression on
HFD. To do this, antibodies against PPARa must first be optimized utilizing tissue
sections that would show positive PPARa staining, such as sections from fasted liver. In
addition to optimizing antibodies, the immunohistochemical protocols must also be
optimized for heat-induced epitope retrieval and protein blocking. Once optimized, the
PPARa antibodies would then be used to stain for PPARa in the p-PPARa-HFD pancreas
sections; these sections would be compared against no antibody control pancreas sections
stained only with the secondary antibody to determine levels of positive staining over and

141

above background staining. In addition, dual staining for PPARa + insulin, and PPARa
+ glucagon would be completed to show that PPARa is being expressed solely in the Pcells and not the a-cells of the pancreas. If PPARa is being overexpressed in the
pancreatic p-cells and immunofluorescent staining is not able to detect PPARa above and
beyond background fluorescence, colormetric staining of PPARa could be an alternative
solution. Colormetric staining could be advantageous for our sections, as it eliminates the
autofluorescing from red blood cells that may be present in non-perfused tissue sections.
Once we are able to show PPARa staining in the pancreatic sections, we could
then carry out additional studies that would further characterize p-cell specific PPARa
overexpression in vivo. As work completed in MIN6 cells has been utilized to support
our in vivo work thus far, utilizing isolated islets from PPARa overexpressing mice
would be our next option. A second cohort of mice (ideally n=10 mice per group) would
be infected and subjected to HFD as carried out previously by our group. Having a larger
cohort of mice would allow our group to collect whole pancreas (n= 1 or 2 per group)
with the remainder being sacrificed for isolated islets. The whole pancreases would be
sectioned and stained for PPARa to confirm overexpression. The isolated islets would
then be utilized for gene expression studies, allowing our group to determine which
PPARa target genes involved in P-oxidation are upregulated in our model. From our in
vitro work, we would identify if acyl-CoA oxidase (AOX), carnitine palmitoyl
transferase-1 (CPT1), long chain acyl-coA dehydrogenase (LCAD), and uncoupling
protein-2 (UCP2) were upregulated in the pancreatic p-cell. Thus allowing us to correlate
improvements in glucose tolerance with increased p-oxidation. These studies would
allow us to further elucidate the mechanisms involved in preventing P-cell lipotoxicity.

142

In addition to gene expression studies, lipidomic profiling in isolated islets will be
performed in collaboration with Matej Oresic from the Technical Research Center of
Finland, using liquid chromatography-mass spectrometry (LC-MS) lipid profiling
(Nygren et al. 2011). This study would allow our group to determine the lipid profiles
and lipid levels in P-PPARa-HFD islets compared to islets from P-eGFP-HFD controls.
If lipidomic profiling is not a feasible option, our group could also consider isolating
islets and determining the levels of triglycerides (TGs) utilizing a standard TG
determination kit (Sigma Aldrich, Oakville ON, Canada). This is a crude measure of
total TG content, allowing us to determine the levels of lipid accumulation in the p-cells
of P-PPARa-HFD and P-eGFP-HFD mice; these results could be correlated with levels of
upregulation of p-oxidative genes or other lipid metabolic pathways observed utilizing
qRT-PCR. This method would not allow us to determine which lipid species is being
accumulated by the P-cells, nor will it allow us to distinguish which lipid species is being
utilized as an activating ligand for PPARa in vivo as no definitive activating ligand has
been identified outside of the liver (Chakravarthy et al. 2009). An alternative option
would be to quantify lipid accumulation within pancreatic sections using lipophillic
histological staining (either Oil Red O staining or BODIPY 493/503 staining); each of
these methods is cost effective and is considered to be a good method for crude
quantification of lipids. BODIPY 493/503 is a fluorescent label for lipid droplets (Ohsaki
et al. 2010). Spangenburg and colleagues (2011) have demonstrated exceptional staining
of lipid droplets using BODIPY 493/503 in skeletal muscle (Spangenburg et al. 2011).
Combined immunofluorescent staining for PPARa and BODIPY staining of lipid would
allow us to visually quantify lipid accumulation within PPARa overexpressing P-cells.

143

If feasible, to further understand the mechanisms involved in preserving p-cell
function during lipotoxicity, repeating this study with another cohort of mice for taking
whole pancreas and isolated islets at various time points would be advantageous. This
type of study would allow us to determine levels of PPARa overexpression over time, as
well determine the rate at which PPARa overexpressing p-cells are being recycled (Wang
et al. 2004). Studying the rate of P-cell recycling could potentially explain why
improving trends and improvements in glucose tolerance were only observed at a single
time point and significance between P-PPARa-HFD and p-eGFP-HFD mice decreased
over time.
In addition to the studies listed above, the use of targeted PPARa delivery using
dsAAV8 could potentially severe as a preventative therapeutic. One possibility is to
transfect isolated islets for transplantation with PPARa to protect against lipid
accumulation and P-cell dysfunction. Isolated islets would be treated with dsAAV8-RIPPPARa prior to transplanting in either the kidney capsule or hepatic portal vein of
streptozotocin (STZ) induced diabetic mice. Mice would be placed on HFD for 20 weeks
and monitored as previously described. The PPARa-treated transplanted islets (from
kidney capsule or hepatic portal vien) of STZ-treated mice would be isolated and
assessed for lipid accumulation. This study would allow us to test the therapeutic
possibilities of PPARa as a preventative treatment protecting transplanted islets against
lipotoxic dysfunction.

144

5.3 SIGNIFICANCE
Characterizing the effect of in vivo pancreatic P-cell specific overexpression of
PPARa in a model of obesity-induced T2D has provided novel insights on obesityinduced p-cell lipotoxicity. More importantly, through the duration of my thesis project,
we have developed the first in vivo model of P-cell specific overexpression of PPARa in
a model of diet-induced P-cell lipotoxicity using the dsAAV8 as our tool for gene
delivery. The data collected in this study presents significant information and provides a
model of protecting P-cell function in diet-induced obesity. My results are summarized
below:

1. We have shown using AAV plasmid, in vitro, that PPARa overexpression in
MIN6 cells occurs at physiological levels when compared to levels observed in
fasted liver. Additionally, PPARa overexpression upregulates the P-oxidative
target gene CPT1 in the presence of palmitate. Moreover, MIN6 cells
overexpressing PPARa maintains glucose-stimulated insulin secretion when
treated with palmitate. Taken together, these results provide in vitro support that
our construct can be used to overexpress PPARa in a P-cell cell line. Thus
allowing us to assess the expected expression levels of PPARa target genes that
may be involved in P-oxidation in PPARa overexpressing islets in vivo.

2. In vivo we have shown that dsAAV8 can be delivered through a non-invasive
intraperitoneal injection to overexpress proteins of interest in the P-cells of the
pancreas when used with RIP. In addition our group has shown that under the

145

direction of RIP, eGFP does not cross the BBB and is not expressed in the
hypothalamus of infected mice. Thus dsAAV8 is a successful tool for targeting
gene delivery to the pancreatic P-cells without expression in peripheral tissues.

3. Overexpression of eGFP under the direction of RIP does not affect body weight
or carbohydrate metabolism, therefore can serve as appropriate control vector for
in vivo studies.

4. Utilizing p-cell specific overexpression of PPARa during diet-induced obesity
protects against glucose intolerance. We speculate that these observations may be
due to decreasing lipid accumulation in the P-cell, preserving P-cell function. Our
group has demonstrated that overexpressing PPARa in pancreatic P-cells
maintains 1st phase insulin secretion impaired by obesity without changes in p-cell
mass. In addition, PPARa overexpression in vivo does not affect body weight
gain on HFD or insulin sensitivity when compared to obese controls.

In addition the significance of this study can be addressed as follows:

1. By manipulating the overexpression of PPARa in the P-cell, which makes up
approximately 1% of the total weight of the pancreas, we have demonstrated that
PPARa agonsim can impact whole-animal glucose homeostasis independently of
systemic effects of liver and muscle lipid metabolism. Moreover, we have shown

146

the physiological phenotype of the first in vivo model of p-cell specific PPARa
overexpression.

2. We have demonstrated that targeted overexpression PPARa specifically in
pancreatic P-cells in vivo preserves p-cell function and protects against glucose
intolerance in diet-induced obesity. Thus providing an in vivo model to elucidate
the mechanisms of P-cell lipotoxicity in obesity-induced T2D.

147

5.4 REFERENCES
Chakravarthy, M. V., I. J. Lodhi, L. Yin, R. R. Malapaka, H. E. Xu, J. Turk and C. F.
Semenkovich (2009). "Identification of a physiologically relevant endogenous
ligand for PPARalpha in liver." Cell 138(3): 476-488.
Dixon, J. B. (2010). "The effect of obesity on health outcomes." Mol Cell Endocrinol
316(2): 104-108.
Frigerio, F., T. Brun, C. Bartley, A. Usardi, D. Bosco, K. Ravnskjaer, S. Mandrup and P.
Maechler (2010). "Peroxisome proliferator-activated receptor alpha (PPARalpha)
protects against oleate-induced INS-IE beta cell dysfunction by preserving
carbohydrate metabolism." Diabetologia 53(2): 331-340.
Hellemans, K., K. Kerckhofs, J. C. Hannaert, G. Martens, P. Van Veldhoven and D.
Pipeleers (2007). "Peroxisome proliferator-activated receptor alpha-retinoid X
receptor agonists induce beta-cell protection against palmitate toxicity." FEBS J
274(23): 6094-6105.
Kasuga, M. (2006). "Insulin resistance and pancreatic beta cell failure." J Clin Invest
116(7): 1756-1760.
Nygren, H., T. Seppanen-Laakso, S. Castillo, T. Hyotylainen and M. Oresic (2011).
"Liquid chromatography-mass spectrometry (LC-MS)-based lipidomics for
studies of body fluids and tissues." Methods Mol Biol 708: 247-257.
Ohsaki, Y., Y. Shinohara, M. Suzuki and T. Fujimoto (2010). "A pitfall in using
BODIPY dyes to label lipid droplets for fluorescence microscopy." Histochem
Cell Biol 133(4): 477-480.
Poitout, V. and R. P. Robertson (2008). "Glucolipotoxicity: fuel excess and beta-cell
dysfunction." Endocr Rev 29(3): 351-366.
Prentki, M. and C. J. Nolan (2006). "Islet beta cell failure in type 2 diabetes." J Clin
Invest 116(7): 1802-1812.
Ravnskjaer, K., M. Boergesen, B. Rubi, J. K. Larsen, T. Nielsen, J. Fridriksson, P.
Maechler and S. Mandrup (2005). "Peroxisome proliferator-activated receptor
alpha (PPARalpha) potentiates, whereas PPARgamma attenuates, glucosestimulated insulin secretion in pancreatic beta-cells." Endocrinology 146(8):
3266-3276.
Spangenburg, E. E., S. J. Pratt, L. M. Wohlers and R. M. Lovering (2011). "Use of
BODIPY (493/503) to visualize intramuscular lipid droplets in skeletal muscle." J
Biomed Biotechnol 2011: 598358.

148

Wang, A. Y., P. D. Peng, A. Ehrhardt, T. A. Storm and M. A. Kay (2004). "Comparison
of adenoviral and adeno-associated viral vectors for pancreatic gene delivery in
vivo." Hum Gene Ther 15(4): 405-413.

149

A.

PKOCRA&TNATKJNI
If MO&OPY M9JPS

JTDOSSNT
REALLY MATTER

ymmwkj\ou*mjv£K - MIND

Q Mvrrtro
_
tAKTTKR -

Hi WD
TROCRASTtNATtON

-? \f MlND-0
0
= <£>
/. KWTER TODCKfcSTif&TiON
ftW
!1

WWW.PHPCOMICS.COM

Figure SI - (A) The mathematical breakdown on how normal levels of procrastination
can lead to the development of (B) the Master's thesis. Permission for use of comics
granted by PHDcomics.com.

150