INVESTIGATING BRITISH COLUMBIA WILD MUSHROOMS FOR
GROWTH-INHIBITORY ACTIVITY
by
Aaron W. T. Smith
BSc. University of Northern British Columbia 2012

THESIS SUBMITTED IN PARTIAL FULFILLMENT OF
THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE
IN
BIOCHEMISTRY

UNIVERSITY OF NORTHERN BRITISH COLUMBIA
July 2017
©Aaron W. T. Smith, 2017

Abstract
This thesis documents that crude extracts from B.C. wild mushrooms possess potent
growth-inhibitory properties. In addition, this work shows, for the first time, that ethanol
extracts from Piptoporus betulinus and Ganoderma applanatum have a strong growthinhibitory activity and that methanol extracts of Echinodontium tinctorium, a previously
untested fungus, exhibits growth-inhibitory activity as well. In addition to human cervical
cancer HeLa cells, E. tinctorium extracts also exhibited a growth-inhibitory effect on human
breast, ovarian, liver, lung, and colon cancer cell lines. Upon purification using Sephadex
LH-20 gel filtration chromatography, two distinct growth-inhibitory compounds were
documented: a higher molecular weight growth-inhibitory compound(s), likely to contain
carbohydrate and a lower molecular weight growth-inhibitory compound(s), likely to be a
small molecule. This thesis provides the foundation work to allow further purification and
characterization of these potentially novel growth-inhibitory compound(s) from E.
tinctorium, an essential step towards future therapeutic use.

II

Table of Contents
Abstract ................................................................................................................................... II
List of Tables ........................................................................................................................... V
List of Figures ........................................................................................................................ VI
List of Appendices ................................................................................................................. IX
Acknowledgements ................................................................................................................. X
Chapter 1 – Introduction ........................................................................................................1
1.1 History of Medicinal Mushrooms ................................................................................................. 1
1.2 Anti-Cancer Compounds Isolated from Mushrooms .................................................................... 5
1.3 Project Goals................................................................................................................................. 8

Chapter 2 – Collection, Identification, Extraction, Optimization, and Assessment of
Anti-Proliferative Activity in B.C Wild Mushrooms ..........................................................10
2.1 Methodology .............................................................................................................................. 10
2.1.1 Sample Collection and DNA / Morphological Identification ............................................... 10
2.1.2 Chemical Extraction ............................................................................................................. 16
2.1.3 Extraction Techniques ......................................................................................................... 18
2.1.4 Cell Culture and Mushroom Extract Preparation ................................................................ 22
2.1.5 MTT Assay............................................................................................................................ 24
2.2 Results ........................................................................................................................................ 34
2.2.1 Species Identification .......................................................................................................... 34
2.2.2 Dose and Time Dependent MTT Assays .............................................................................. 44
2.3 Discussion ................................................................................................................................... 71
2.3.1 Morphological and DNA investigation ................................................................................ 71
2.3.2 Growth-inhibitory Effect on HeLa Human Cervical Cancer Cells – Mushrooms Tested ..... 71

Chapter 3 - Investigating the Growth-Inhibitory Activity of the Methanol Extract of
Echinodontium tinctorium .....................................................................................................76
3.1 Introduction ................................................................................................................................ 76
3.2 Methodology .............................................................................................................................. 76
3.2.1 Sephadex LH-20 Size Exclusion Purification ........................................................................ 76
3.2.2 Total Carbohydrate Colorimetric Assay Kit (#K645-100)..................................................... 77
3.2.3 Pierce Glycoprotein Carbohydrate Estimation Kit (#23260) ............................................... 78
3.2.4 Pierce BCA Protein Assay Kit (#23225) ................................................................................ 79
3.2.5 Phenol Chloroform Extraction (P.C.I) .................................................................................. 80
III

3.3 Results ........................................................................................................................................ 80
3.3.1 Large Scale Manual Extraction vs. Speed Extractor ............................................................ 80
3.3.2 Size Exclusion Chromatography and BCA Assay .................................................................. 82
3.3.3 Total Carbohydrate Assay (Hot H2SO4) ................................................................................ 94
3.3.4 Glycoprotein Carbohydrate Estimation Kit ......................................................................... 95
3.3.5 C16/70 LH-20 Column (100 mL) .......................................................................................... 97
3.3.6 Assessment of the Post-Sephadex LH-20 Fractions for Growth-Inhibitory Activity using
Different Cancer Cell Lines. ........................................................................................................ 101
3.4 Discussion ................................................................................................................................. 103

Chapter 4 - General Discussion ..........................................................................................105
4.1 Screening BC wild mushrooms for growth-inhibitory activity.................................................. 105
4.2 An attempt to purify the growth-inhibitory compound from Echinodontium tinctorium ....... 106
4.3 Future Directions and Conclusions ........................................................................................... 108

References .............................................................................................................................109
Appendix ...............................................................................................................................116
Sequences Derived from DNA Analysis .......................................................................................... 116
Piptoporus betulinus................................................................................................................... 116
Ganoderma applanatum ............................................................................................................ 116
Fomes fomentarius ..................................................................................................................... 117
Echinodontium tinctorium .......................................................................................................... 118

IV

List of Tables
Table 1. Krestin (Polysaccharide K), isolated from Trametes versicolor has been shown to
have anti-metastatic properties in a variety of different cell lines34 ..........................................4
Table 2. A list of important HWM β-glucans that have been isolated from various mushroom
species. The most famous compounds, Lentinan, Schizophyllan and PSK all belong to this
group47........................................................................................................................................7
Table 3. Thermocycler protocol used for Fungal DNA amplification.....................................14
Table 4. BC Mushrooms: An Inventory List and Extraction Solvent Used ............................27
Table 5. MTT Assay (Extracts from Fomitopsis pinicola) – Visual Observations after 24
hours of treatment ....................................................................................................................46
Table 6. MTT Assay (Extracts from Fomitopsis pinicola) – Visual Observations after 48
hours of treatment ....................................................................................................................47

V

List of Figures
Figure 1. High and low molecular weight compounds isolated from medicinal mushrooms
which have been shown to have anti-cancer properties40. .........................................................6
Figure 2. DNA Extraction flow chart provided from a PowerSoil DNA Isolation kit,
purchased from MO BIO Laboratories.55 ................................................................................13
Figure 3. Confirmation of fungal DNA after DNA extraction. Samples were run on a 1%
agarose gel, containing ethidium bromide, for approximately 1 hour. Sample A5 was a
duplicate of G. applanatum. An NEB 1 kb DNA ladder was used. Values shown on the right
are in kb....................................................................................................................................14
Figure 4. One percent agarose gel containing ethidium bromide in which 4 fungal DNA
samples were run after PCR was performed. A band can be seen at 500 base pairs for each
sample. Sample A5 was a duplicate of G. applanatum. An NEB 100 bp ladder was used for
visualization. Values shown on the right are in bp ..................................................................15
Figure 5. An example of a dried and powdered mushroom sample (Chaga). .........................16
Figure 6. A generalized flow/overview of Mizuno’s mushroom extraction techniques59. The
first step, with ethanol, is meant to separate out the low molecular weight compounds from
the high molecular weight compounds. ...................................................................................17
Figure 7. An example of the final product of an MTT assay...................................................24
Figure 8. Modified extraction technique to reflect the change in temperature and the addition
of a 50% methanol extract. ......................................................................................................29
Figure 9. The final extraction scheme adopted. This is the modified extraction technique to
reflect the removal of the ammonium oxalate extract entirely ................................................32
Figure 10. The results of a 72 hour MTT assay using four extracts obtained from the
extraction of F. pinicola. ..........................................................................................................48
Figure 11. The results of a time dependent assay using two concentrations of extract 2, which
was extracted in 99% ethanol and then dissolved in 80% ethanol ..........................................49
Figure 12. The results of a time dependent assay using two concentrations of extract 2, which
was extracted in 99% ethanol and then dissolved in 80% ethanol. .........................................50
Figure 13. Seventy-two hour dose dependent MTT assay using extract 2 (99% ethanol)
extracted from F. pinicola........................................................................................................51
Figure 14. Forty Eight Hour Dose dependent using Cis Platinum and Human HeLa cells. ....51
Figure 15. MTT (48 hour) assay of Lentinula edodes .............................................................53
Figure 16. Dose dependent MTT assay using four extracts from P. betulinus. .......................54
Figure 17. Seven day time dependent assay using E1 (80% ethanol) and E3 (water), extracted
from P. betulinus ......................................................................................................................55
Figure 18. Dose dependent MTT assay using extracts from F. fomentarius ...........................56
VI

Figure 19. Seven Day MTT assay using extracts 1 (80% ethanol), extract 2 (50% methanol)
and extract 3 (Water). ..............................................................................................................57
Figure 20. Dose dependent MTT assay using extracts extracted from G. applanatum ...........58
Figure 21. Seven day time dependent MTT assay using extract 3 (water) extracted from G.
applanatum ..............................................................................................................................59
Figure 22. Dose dependent MTT assay using extracts from E. tinctorium .............................60
Figure 23. Seven day time dependent MTT assay using extract 2 (50% methanol) at two
concentrations, 0.5 and 1 mg / mL. ..........................................................................................61
Figure 24. Dose dependent MTT assay (72 hours) using extract 2 (80% ethanol) from E.
tinctorium. ................................................................................................................................62
Figure 25. Dose dependent MTT assay using extracts from I. obliquus. ................................63
Figure 26. Seven day time dependent MTT assay using extracts obtained from I. obliquus. .64
Figure 27. Dose dependent MTT assay using extracts from L. connata .................................65
Figure 28. Seven day dose dependent MTT assay of extracts from L. connata. .....................66
Figure 29. Dose dependent MTT assay using extracts from L. sulphureus. ............................67
Figure 30. Seven day dose dependent MTT assay of extracts from L. sulphureus .................68
Figure 31. Dose dependent MTT assay of extracts from P. nigricans. ...................................69
Figure 32. Seven day time dependent MTT assay of extract 1 (80% ethanol), and extract 3
(water), obtained from P. nigricans. ........................................................................................70
Figure 33. Chemical structure of a furfural compound............................................................77
Figure 34. Growth-inhibitory effect of methanol extracts from E. tinctorium. .......................81
Figure 35. Trial 1 - Assessing growth-inhibitory activity of fractions collected from
Sephadex LH-20. .....................................................................................................................83
Figure 36. Trial 2 - Assessing fractions collected from Sephadex LH20 for growth-inhibitory
activity......................................................................................................................................84
Figure 37. Trial 3 - Assessing fractions collected from Sephadex LH20 for growth-inhibitory
activity......................................................................................................................................85
Figure 38. Trial 4 - Assessing fractions collected from Sephadex LH20 for growth-inhibitory
activity......................................................................................................................................86
Figure 39. BCA assay using fractions collected from a 2 mL LH-20 column. .......................87
Figure 40. BCA assay and MTT assay using the same eluted fractions from a 2 mL LH-20
column......................................................................................................................................88
Figure 41. Assessing fractions collected from Sephadex LH-20 for growth-inhibitory
activity......................................................................................................................................89
Figure 42. Assessing the post-Sephadex LH-20 fractions for growth-inhibitory activity .......90
VII

Figure 43. Assessing the post-Sephadex LH-20 fractions for growth-inhibitory activity. ......91
Figure 44. BCA assay using fractions collected from an 18 mL LH-20 column. ...................92
Figure 45. BCA assay and MTT assay using eluted fractions from an 18 mL LH-20
column......................................................................................................................................93
Figure 46. Linear trend line calculated from glucose standards created from Total
Carbohydrate Kit. .....................................................................................................................94
Figure 47. Growth-inhibitory activity and carbohydrate content of fractions collected from an
18 mL Sephadex LH-20 column. .............................................................................................95
Figure 48. Linear trend line calculated from glycoprotein standards created from a
glycoprotein estimation kit. .....................................................................................................96
Figure 49. Growth-inhibitory activity and glycoprotein content of fractions collected from
Sephadex LH-20 column. ........................................................................................................97
Figure 50. 100 mL LH-20 column purifying crude E2 extract from E. tinctorium. The column
is being run with water. ............................................................................................................98
Figure 51. Assessing the post-Sephadex LH-20 fractions for growth-inhibitory activity. ......99
Figure 52. Assessing the post-Sephadex LH-20 fractions for growth-inhibitory activity. ....100
Figure 53. Assessing the post-Sephadex LH-20 Fraction 10 for growth-inhibitory activity,
using various cancer cell lines, in a 48 h MTT assay. ...........................................................101
Figure 54. Assessing the post-Sephadex LH-20 Fraction 10 for growth-inhibitory activity,
using various cancer cell lines, in a 48 h MTT assay. ...........................................................102

VIII

List of Appendices
Appendix 1. Sequences Derived from DNA
Analysis………………………………………….116

IX

Acknowledgements

Firstly I would like to thank Dr. Chow Lee for not only giving me the opportunity to
pursue this Master’s project, but to also work in his lab for back to back 499 and 460
undergraduate research projects. I would also like to thank my other co-supervisor, Dr. Kerry
Reimer, whose assistance throughout but particularly at the beginning of this project, with
respect to the physical mechanics of handling mushroom species and procuring equipment,
was critical and instrumental. A huge thank you to my two other committee members, Dr.
Hugues Massicotte and Dr. Keith Egger; this project would not have been possible without
your bountiful fungi knowledge. I am also grateful to Dr. Maggie Li for lending me her
technical expertise whenever it was required. Finally, I am grateful to Miss Vicky Myhre for
giving me the final push of motivation to complete this project.

X

Chapter 1 – Introduction
1.1 History of Medicinal Mushrooms
Since the beginning of civilization, mankind has been fascinated with mushrooms and
the mysticism surrounding them. Ancient Egyptian hieroglyphs, dating back more than 4500
years, illustrate that mushrooms were considered to be a plant of immortality and gifts from
the gods. Only those closest to the deities were allowed to consume them, and no commoner
could touch them1,2. This idea of mushrooms being of divine origin was also adopted by the
Romans, who served them only during festivals, and later the ancient Greeks, who believed
that mushrooms gave their warriors strength in battle3. Meso-Americans used mushrooms for
their ancient religious ceremonies. They did not use mushrooms to give them strength but
believed that the powerful psychotropic effects and hallucinations obtained by certain
mushroom species allowed them to be closer to god4. Mushroom carvings left behind by the
Mayans serve as evidence that mushrooms were used for the purposes as far back as 3000
BC. As more has become known about mushrooms, they have become prized for their
antioxidant, anti-cancer, antiviral, and immune boosting properties5.
Perhaps the first known use of mushrooms for medicinal purposes was by the ancient
Chinese, who used mushrooms as a medical intervention for nearly two millennia6.
Mushrooms such as Ganoderma lucidum, commonly referred to as Ling Zhi or Ling Chu by
the Chinese, have been recorded in the oldest books on medicinal materials in China. “Shen
Noug’s Herbel” contains references to many medicinal mushrooms, including G. lucidum,
and is believed to have been written between 100 and 200 AD7. Ganoderma lucidum was
prescribed to treat a wide variety of ailments ranging from arthritis and insomnia to
1

bronchitis and cancer8,9. Traditionally, Ganoderma compounds were ingested as hot water
extracts due to their bitter taste. More recently, G. lucidum has been found to have many
pharmacologically-active compounds including those involved in anti-viral defense10, antiinflammatory11, and anti-cancer mechanisms12.
Various extracts have been shown to have great potential in the treatment of a variety
of cancers, such as: the induction of apoptosis in lung cancer cells in mice13, antiproliferative activity in human colorectal cancer cells14, and anti-invasiveness in breast
cancer models15. Ganoderma lucidum polysaccharide (GLPS) fraction, commonly known as
Ganopoly®, was found to enhance the immune response in patients with advance-stage
cancer through enhanced natural killer cell activity and phytohemagglutinin responses.
Following 12 weeks of orally administered treatment, interleukin-2 (IL-2), IL-6, and
interferon-γ (INF-γ) concentrations were increased in blood plasma, while tumor necrosis
factor-α (TNF-α) and IL-1 concentrations were decreased16.
The abundant use of medicinal mushrooms in ancient Asian medicine was not limited
only to the Chinese. Mushrooms have long been used by the Japanese and Koreans to treat a
plethora of illnesses. Species such as Favolus alveolarius, Pluteus cervinus, and Ramaria
formosa have been under serious scientific investigation in Korea for the last 30 years. Their
protein-bound polysaccharides have been shown to possess potent anti-cancer and
immunomodulatory properties in sarcoma 180 cell lines17–19.
Lentinula edodes (Berk.) Pegler, commonly referred to as Shiitake, has been used by
the Japanese for hundreds of years to treat ailments such as the common cold and headaches,
and was also used as a powerful aphrodisiac as well as for the beautification of the skin20.
2

Several biologically active compounds have been isolated from Shiitake mushrooms,
including those capable of inducing apoptosis in human cancer cells21. Lentinan, a betaglucan isolated from Shiitake, has been available as an anti-cancer agent in Japan since
198522. Administered at 0.5 – 1.0 mg / day, Lentinan has been used as an adjuvant in tumor
therapy, and has been shown to help increase quality of life, increase survival time and help
restore the functionality of the immune system, when coupled with other anti-cancer
treatments such as radiotherapy and chemotherapy23,24.
In addition to having anti-cancer properties, compounds isolated from Shiitake
mushrooms have also been shown to have antibacterial25 and antiviral26 attributes.
Furthermore, L. edodes has also been explored as an alternative to prevent tooth decay in
countries where common dentistry is often not affordable to the general population27.
Trametes versicolor is one of the more famous examples of mushrooms containing
anti-cancer compounds. Polysaccharide K/PSK/Krestin, isolated from T. versicolor, has been
available as an adjuvant to chemotherapy in Japan and other parts of Asia for over 40 years28.
PSK is an orally active compound29 and has been shown to have anti-cancer/anti-metastatic
properties with a variety of different cell lines (Table 1). Although the exact mechanism of its
anti-cancer properties is still unknown, it is believed to be a biological response modifier,
which functions by increasing a host’s ability to respond to an invasive tumor28. Its
mechanism may involve Toll-Like receptor 4 and the activation of TNF-α, which helps
mediate an immune response30. Immuno-modulation seems to be a common property among
beta-glucan compounds isolated from medicinal mushrooms.

3

Inonotus obliquus, commonly known as Chaga, is another prime example of a
mushroom that has been used as a treatment for a plethora of ailments dating back nearly half
a century. Commonly found in northern climates such as those found in Russia, and northern
British Columbia, Chaga can be found abundantly growing on birch (Betula spp.) trees. The
bark from birch contains a chemical called betulin, which is not readily absorbed by humans.
Chaga converts betulin to betulinic acid, a triterpene, which is water soluble, and is orally
bioactive31. Both betulin and betulinic acid are being investigated for their anticancer,
antiviral and anti-inflammatory properties32,33.

Table 1. Krestin (Polysaccharide K), isolated from Trametes versicolor has been shown to
have anti-metastatic properties in a variety of different cell lines34
Result of
Organ in which cancer
PSK
is developed
Cancer cell type/line
application
Lung

autochthonous tumor

Lung

human prostate cancer (DU-145M, PC-3M)

Lung

mouse melanoma (B16-BL6)

Lung

rat lung cancer

Liver

human lung cancer (AOI)

Lymph nodes

mouse leukemia (P388)

Lymph nodes

mouse liver cancer (MH134)

Liver

rat liver cancer (AH60C)

Liver

mouse leukemia

Liver

mouse colon cancer

4

Increased
survival time
Increased
survival time
Increased
survival time
Increased
survival time
Suppressed
lesion growth
Increased
survival time
Suppressed
lesion growth
Suppressed
lesion growth
Suppressed
lesion growth
Suppressed
lesion growth

It is believed that, of the 140,000 estimated species of mushrooms on the planet, only
10% have been characterized34,35. Over 2000 mushroom species are non-toxic; there are over
700 from which anti-cancer compounds have been isolated. Many of those compounds have
anti-proliferative, immuno-modulatory or pro-apoptotic properties36–38. British Columbia is
estimated to be home to more than ~4600 mushroom species; of that number, only an
estimated 1600 have been categorized39. Many Asiatic fungal species, which have
established anti-cancer properties, along with many relatives belonging to the same genus,
also exist in British Columbia and its surrounding area. This wealth of readily available
specimens provides a huge sample source from which new anti-cancer compounds can
potentially be discovered, isolated, purified and identified.
1.2 Anti-Cancer Compounds Isolated from Mushrooms
There is little doubt that the number and variety of compounds that can be isolated
from mushrooms rivals the variety and abundance of mushroom species themselves. Of those
known to have anti-cancer properties, there are two main groups: those of low molecular
weight (LMW) and those of high molecular weight (HMW)40. LMW compounds include
compounds such as quinones, isoflavones, amines and triacylglycerols. The high molecular
weight group contains compounds such as polysaccharides, glycoproteins, glycopeptides and
proteins (Figure 1). LMW compounds tend to have properties that allow them to inhibit a
wide variety of enzymes such as DNA polymerase8,41 and DNA topoisomerase13 while HMW
compounds tend to be immune-modulators19,40,42,43.

5

Mushrooms

Low Molecular Weight
Compounds

High Molecular Weight
Compounds

Quinones

Homoglucans

Cerebrosides

Heteroglucans

Isoflavones

Glycans

Catechols

Glycoproteins

Amines

Proteoglycans

Triacylglycerols

Proteins

Sesquiterpenes

Steroids

Figure 1. High and low molecular weight compounds isolated from medicinal mushrooms
which have been shown to have anti-cancer properties40.

6

There are currently many high molecular weight compounds involved in clinical
trials, including PSK, Lentinan, Grifolin and Schizophyllan. PSK is a glycopeptide while the
other three are all (1->3) β-D-glucans with (1->6) β-D branches44–46. As a result, there is
likely a higher probability of discovering high molecular weight compounds such as βglucans, which seem to be commonly biologically active (Table 2). Crude extracts containing
low molecular weight compounds are also of interest in respect to their anti-proliferative and
pro-apoptotic abilities.
Table 2. A list of important HWM β-glucans that have been isolated from various
mushroom species. The most famous compounds, Lentinan, Schizophyllan and PSK all
belong to this group47
Herb
Lentinus edodes

Common Name
Shiitake mushroom

β-glucan structure
β-1,3:1,6-glucan

Type
Lentinan

Schizophyllum commune

Brazilian mushroom

Grifola frondosa

Maitake mushroom

β-1,3:1,6-glucan
β-1,3:1,6-glucan with xylose and
mannose

Schizophyllan
Maitake D
Fraction

Trametes versicolor

Yun Zhi

Protein bound β-1,3:1,6-glucan

Ganoderma lucidum

Lingzhi, Reishi

β-1,3:1,6-glucan

Agaricus blazei

Brazilian sun mushroom

Pleurotus ostreatus

Oyster mushroom

Protein bound β-1,6-glucan
β-1,3-glucan with galactose and
mannose

PSP/PSK
Ganoderma
polysaccharides
Agaricus
polysaccharides

Coprinus comatus

Shaggy ink cap

β-1,3-glucan

Pleuran
Coprinus
polysaccharides

Many bioactive polysaccharides isolated from mushrooms are water-soluble β-Dglucans, with or without heterosaccharide side chains, or β-D-glucan-protein complexes48.
Activity has been linked to the 13 glycosidic chain that makes up the backbone of these
polysaccharides, with differences primarily arising in the branch length and patterns between
species47. Common branch patterns include 13, 14, and 16 linkages49. These βglucans have been found to act on multiple immune receptors, including TLR-2 and 6,
7

Dectin-1, and complement receptor-3 (CR-3)47,50,51. This in turn triggers the activation of
natural killer cells, macrophages, dendritic cells and neutrophils47. While not considered
digestible, β-glucans have been effectively administered orally, where it is assumed that they
are absorbed through fermentation by the gut flora, or by directly binding to receptor sites on
macrophages. One theory suggests that, once internalized, they are fragmented and
transported to the bone marrow, where they are released to be absorbed by other immune
cells, which then elicit an immune response47. β-glucans have been linked to both innate and
adaptive immune responses47.
Schizophyllan, a polysaccharide extracted from Schizophyllum commune Fr., has
been reported to have multiple activities, including antibacterial, anti-parasitic, anti-tumor
and immuno-stimulatory effects. It was first recognized for its antitumor effects against
sarcoma 180. This host-mediated activity was later found to be effective against multiple
other cancers, including bladder, breast, lung, gastric, and leukemia. It is currently produced
commercially by Japanese pharmaceutical companies as an immuno-potentiator, and often
used as an adjuvant to chemotherapy to improve quality of life in patients52.
1.3 Project Goals
This Thesis project project was broken down into two major components. The first being the
design and optimization of extraction protocols and the extraction and screening of 9
different species of mushrooms obtained from the forests across Northern British Columbia.
A tenth mushroom, Shiitake, was used as a proof of concept for a comparative analysis of
extractions performed under different temperature variations. The second major component
of the Thesis consisted of examining a methanol-based extract derived from Echinodontium

8

tinctorium (Ellis & Everh.) Ellis & Everh. in an attempt to purify the compounds(s)
responsible for the growth-inhibitory effect on HeLa human cervical cancer cells.

9

Chapter 2 – Collection, Identification, Extraction, Optimization, and Assessment of
Anti-Proliferative Activity in B.C Wild Mushrooms
Nine species of mushrooms were collected from Northern British Columbia,
specifically from the areas surrounding Prince George, Terrace and McBride. A tenth
sample, Lentinula edodes, was purchased from a grocery store and assayed, due to its known
anti-cancer properties, as demonstrated in previously published papers53,54. Each sample was
identified by either morphological characteristics or DNA analysis, or a combination of both.
Then, each specimen was either pulverized with a hammer mill, frozen in liquid nitrogen and
crushed with a pestle and mortar, or turned into a fine powder by use of a household blender.
Different extraction techniques were explored while using a range of variables such as
solvents, temperatures and time. Finally, extracted fractions from each sample were assessed
for growth-inhibitory effects on HeLa human cervical cancer cells.

2.1 Methodology
2.1.1 Sample Collection and DNA / Morphological Identification

Nine mushroom samples had previously been obtained from Drs. Keith Egger and
Hugues Massicotte. Each mushroom underwent chemical extraction and was tested for
growth-inhibitory effect via MTT assay using the human cervical cancer HeLa cells. The
four samples which showed the greatest growth-inhibitory activity were chosen for additional
identification via DNA analysis.
DNA was extracted using a PowerSoil DNA Isolation Kit (Mo Bio Laboratories,
Carlsbad, USA), following manufacturer protocols55 (Figure 2). Two hundred and fifty
10

milligrams of mushroom sample was added to PowerBead tubes, which were included with
the DNA isolation kit. The tubes were then gently vortexed. Solution C1 (included) was
heated at 60°C to remove any precipitation. Sixty microliters of C1 were then added to the
tubes containing mushroom sample and PowerBeads. The tubes were then briefly vortexed.
The PowerBead tubes were then centrifuged at 10,000 x g for 30 seconds at room
temperature, after which the supernatant was transferred to a clean 2 mL collection tube. Two
hundred and fifty microliters of Solution C2 was then added and the combined mixture was
then vortexed for 5 seconds and incubated for 5 minutes at 4 °C. The 2 mL collection tubes
were then centrifuged for 1 minute at 10,000 x g. A maximum of 600 μL supernatant was
then transferred to a new 2 mL collection tube followed by the addition of 200 μL of Solution
C3 and a brief vortexed. The mixture was then incubated at 4 °C for 5 minutes and
centrifuged for 1 minute at 10,000 x g. A maximum of 750 μL of supernatant was then
transferred to a clean 2 mL collection tube. Solution C4 was shaken to mix, after which 1.2
mL was added to the supernatant, which was then vortexed for 5 seconds. Six hundred and
seventy five microliters was then loaded onto a spin filter and centrifuged at 10,000 x g for 1
minute at room temperature. The flow through was discarded and an additional 675 μL of
supernatant was added to the spin filter, which was then centrifuged at 10,000 x g for 1
minute at room temperature. Five hundred microliters of Solution C5 was then added and
centrifuged at 10,000 x g for 30 seconds, at room temperature. The flow through was
discarded and the mixture was centrifuged again at 10,000 x g for 1 minute, at room
temperature. The spin filter was then carefully placed into a clean 2 mL collection tube as to
avoid splashing any C5 solution onto the spin filter. One hundred microliters of Solution C6
was then added to the center of the white filter membrane after which the solution was

11

centrifuged at 10,000 x g for 30 seconds at room temperature. The spin filter was then
discarded and the DNA was prepared for further analysis.
In order to confirm the presence of DNA, 5 μL of extracted sample was mixed with 2
μL of loading dye. The combined mixture from each sample was loaded onto a 1% agarose
gel containing ethidium bromide. The gel was run for approximately 1 hour and then
photographed under UV light (Figure 3). A PCR reaction was performed using 1 μL of
template DNA and mastermix, containing 10x reaction buffer, 50 mM MgCl2, 2 mM
dNTP’s, fungal DNA primers (ITS3 and NLB4) and Taq polymerase. The thermocycler was
programmed to perform 29 cycles of the PCR reaction using the protocol shown in Table 3.
Next, amplified samples were loaded onto an agarose gel in order to determine the success of
the PCR process by identifying an expected PCR product of about 500 base pair band,
relative to the DNA ladder (Figure 4).

12

Add Soil Sample to Bead
Tube

Prepare
Sample

Centrifuge

Add Solution C1

Vortex
Cell Lysis

Centrifuge

Add C2
Incubate 4C

Inhibitor
Technology

Centrifuge

Add C3
Incubate 4C

Bind DNA

Centrifuge

Add C4

Load into Spin Filter

Wash

Centrifuge

Wash with C5

Elute with Solution C6

Elute

Centrifuge

Figure 2. DNA Extraction flow chart provided from a PowerSoil DNA Isolation kit,
purchased from MO BIO Laboratories.55

13

Figure 3. Confirmation of fungal DNA after DNA extraction. Samples were run on a 1%
agarose gel, containing ethidium bromide, for approximately 1 hour. Sample A5 was a
duplicate of G. applanatum. An NEB 1 kb DNA ladder was used. Values shown on the right
are in kb.

Table 3. Thermocycler protocol used for Fungal DNA amplification
Step

Temperature (°C )

Time (Minutes)

1

95

5

2

95

1

3

52

1

4

72

1

Steps 1-4 Repeated 29 Times
5

72

5

6

4

Until Analysis

14

Figure 4. One percent agarose gel containing ethidium bromide in which 4 fungal DNA
samples were run after PCR was performed. A band can be seen at 500 base pairs for each
sample. Sample A5 was a duplicate of G. applanatum. An NEB 100 bp ladder was used for
visualization. Values shown on the right are in bp.

Samples that were successfully extracted and amplified were cleaned via ethanol
precipitation and centrifugation. After drying, samples were re-suspended in ddH20 and were
sent for sequencing at the DNA sequencing facility at UNBC. Finally the resulting
chromatographs were edited using Chromas Lite56 and were then queried against existing
sequences for known fungal specimens in BLAST57. The closest match was then determined
by evaluating Max Score and Percent Identification values.

15

2.1.2 Chemical Extraction
Mushroom species were either air or oven dried at low heat (50 °C) and were then
powdered (Figure 5) using either a hammer mill, in the case of F. pinicola, or a regular
household blender. Samples that were not extremely hard, such as Shiitake (L. edodes), were
frozen in liquid nitrogen and were then crushed using a pestle and mortar. Initially, dried
samples were extracted by closely following protocols outlined by Mizuno59 (Figure 6), with
the addition of an ammonium oxalate fraction. Protocols were later modified to remove the
ammonium oxalate fraction and to change the extraction temperature.

Figure 5. An example of a dried and powdered mushroom sample (Chaga).

16

Powdered Mushroom

Residue

Residue
80 % EtOH
(3 hours)

Extract 1

2 % (NH₄)₂C₂O₄
100 °C
(6 hours)

Water (3 hours)

Filtrate

Residue

Filtrate

5% NaOH 100
°C
(6 hours)

Filtrate

Filtrate

Extract 3

Extract 2

Extract 4

Figure 6. A generalized flow/overview of Mizuno’s mushroom extraction techniques59. The
first step, with ethanol, is meant to separate out the low molecular weight compounds from
the high molecular weight compounds.

17

2.1.3 Extraction Techniques
Fomitopsis pinicola
A 250 gram conk was ground into fiber using a 240 v hammer mill. Thirty five grams
was then combined with 750 mL 80% ethanol and refluxed for 3 hours in a round bottom
flask with a condenser. The resulting solution was filtered using a Buchner funnel and
Whatman #3 paper. The filtrate was then condensed using a rotary-evaporator at 60 °C until
approximately 50 mL remained. The remaining filtrate was flash frozen in liquid nitrogen
and lyophilized at 0.02 Torr and -80 °C, for 3 days, until only a fine powder remained. The
resulting powder was then dissolved in 100% ethanol and filtered using Whatman #3 paper.
The residue was lyophilized and was labelled as fraction 1. The filtrate was evaporated to
dryness and labelled as extract 2. This was a special method that was used during the very
first mushroom extraction. Subsequent extractions followed protocols outlined in Figure 6 or
Figure 8.
The residue from the first filtration was combined with 750 mL MilliQ and subjected
to reflux for 6 hours, after which it was filtered, evaporated and lyophilized as per the above
techniques. The resulting powder was labelled as extract 3. The process was then repeated
using 750 mL 5% Sodium Hydroxide. All solutions were neutralized (pH 7) using either 1.25
M NaOH or 12 M HCl prior to lyophilisation.
Lentinula edodes
Four hundred grams of pre-packaged Shiitake mushrooms were purchased from
Shoppers Wholesale Foods in Prince George, British Columbia. The sample was flash frozen
in liquid nitrogen and then lyophilized at 0.02 Torr and -52 °C, for 2 days, until they were

18

completely dry. The dried sample was then crushed into a fine powder using a pestle and
mortar.
Fifty grams of powdered Shiitake mushroom were combined with 1 L of 80% ethanol
and was then refluxed for 3 hours in a round bottom flask with a condenser. The resulting
solution was filtered using a Buchner funnel and Whatman #3 paper. The filtrate was then
condensed using a rotary-evaporator at 60 °C until approximately 100 mL remained. The
remaining filtrate was flash frozen in liquid nitrogen and lyophilized at 0.02 Torr and -52 °C,
for 3 days, until only a fine powder remained, and was labelled as extract 1. The remaining
residue was combined with 1 L of 50% methanol and was heated to reflux for 3 hours, while
being stirred in a 2 L round bottom flask with a condenser. The resulting solution was filtered
using a Buchner funnel and Whatman #3 paper. The filtrate was then condensed using a
rotary-evaporator at 65 °C until approximately 100 mL remained. The remaining filtrate was
flash frozen in liquid nitrogen and lyophilized at 0.02 Torr and -52 °C, for 3 days, until only
a fine powder remained, and was labelled as extract 2. The remaining residue was combined
with 1 L of distilled water and was then heated to reflux for 6 hours, while being stirred in a
2 L Erlenmeyer flask. The resulting solution was filtered using a Buchner funnel and
Whatman #3 paper. The filtrate was then condensed using a rotary-evaporator at 65 C until
approximately 100 mL remained. The remaining filtrate was flash frozen in liquid nitrogen
and lyophilized at 0.02 Torr and -52 °C, for 3 days, until only a fine powder remained, and
was labelled as extract 3. The remaining residue was combined with 1 L of 1% ammonium
oxalate and was then heated to reflux for 6 hours, while being stirred in a round bottom flask
with a condenser. The resulting solution was filtered using a Buchner funnel and Whatman
#3 paper. The filtrate was then condensed using a rotary-evaporator at 65 C until
19

approximately 100 mL remained. The remaining filtrate was flash frozen in liquid nitrogen
and lyophilized at 0.02 Torr and -52 °C, for 3 days, until only a fine powder remained, and
was labelled as extract 4. The remaining residue was combined with 1 L of 5% Sodium
Hydroxide and was then heated to reflux for 6 hours, while being stirred in a round bottom
flask with a condenser. The resulting solution was filtered using a Buchner funnel and
Whatman #3 paper. The filtrate was then condensed using a rotary-evaporator at 65 °C until
approximately 100 mL remained. The remaining filtrate was flash frozen in liquid nitrogen
and lyophilized at 0.02 Torr and -52 °C, for 3 days, until only a fine powder remained, and
was labelled as extract 5. All extracts were neutralized (pH 7) using either 1.25 M Sodium
Hydroxide or 12 M Hydrochloric acid prior to lyophilisation.
The above extraction techniques were also used for Piptoporus betulinus, Fomes
fomentarius and Ganoderma applanatum. The remaining four samples, Inonotus obliquus,
Leucocybe connata, Laetiporus sulphureus and Phellinus nigricans all followed the same
extraction procedure as outlined below with Chaga.

20

Echinodontium tinctorium

The manual extraction techniques were the same as those listed above. A separate
extraction was also performed using a Buchi Speed Extractor using the following parameters;
Samples cells could hold approximately 40 mL total volume. Approximately 20 mL of
powdered E. tinctorium was loaded onto 0.7 mm of quartz sand. The sample was then
extracted using 80% ethanol, at 65 °C for 1.5 hours followed by flushing for 15 minutes. This
sequence was repeated for 3 iterations. Next, the sample was extracted using 50% methanol
for 1.5 hours following by a flushing cycle for 15 minutes. Again, this cycle was repeated for
3 iterations.

Inonotus obliquus
Two hundred grams of Inonotus obliquus was ground in a blender at high speed. One
hundred and fifty grams of raw material was then combined with 1.5 L of 80% ethanol and
heated to 65 °C for 3 hours, while being stirred in a 2 L Erlenmeyer flask. The resulting
solution was filtered using a Buchner funnel and Whatman #3 paper. The filtrate was then
condensed using a rotary-evaporator at 65 °C until approximately 150 mL remained. The
remaining filtrate was flash frozen in liquid nitrogen and lyophilized at 0.02 Torr and -52 °C,
for 3 days, until only a fine powder remained, and was labelled as extract 1. The remaining
residue was combined with 1.5 L of 50% methanol and was heated to 65 °C for 3 hours,
while being stirred in a 2 L Erlenmeyer flask. The resulting solution was filtered using a
Buchner funnel and Whatman #3 paper. The filtrate was then condensed using a rotaryevaporator at 65 °C until approximately 150 mL remained. The remaining filtrate was flash
21

frozen in liquid nitrogen and lyophilized at 0.02 Torr and -52 °C, for 3 days, until only a fine
powder remained, and was labelled as extract 2. The remaining residue was combined with
1.5 L of distilled water and was then heated to 65 °C for 6 hours, while being stirred in a 2L
Erlenmeyer flask. The resulting solution was filtered using a Buchner funnel and cheese
cloth. The filtrate was then condensed using a rotary-evaporator at 65 °C until approximately
150 mL remained. The remaining filtrate was flash frozen in liquid nitrogen and lyophilized
at 0.02 Torr and -52 °C, for 3 days, until only a fine powder remained, and was labelled as
extract 3. The remaining residue was combined with 1.5 L of 5% Sodium Hydroxide and was
then heated to 65 °C for 6 hours, while being stirred in a 2 L Erlenmeyer flask. The resulting
solution was filtered using a Buchner funnel and cheese cloth. The filtrate was then
condensed using a rotary-evaporator at 65 °C until approximately 150 mL remained. The
remaining filtrate was flash frozen in liquid nitrogen and lyophilized at 0.02 Torr and -52 °C,
for 3 days, until only a fine powder remained, and was labelled as extract 4. All extracts were
neutralized (pH 7) using either 1.25 M Sodium Hydroxide or 12 M Hydrochloric acid prior to
lyophilisation.
2.1.4 Cell Culture and Mushroom Extract Preparation
Human cervical cancer HeLa cells were grown to confluency using Thermo Fisher
Scientific T25 Flasks. Once confluent, the supernatant was poured off and the adherent cells
were then washed with 3 mL of Phosphate-buffered saline. Any remaining supernatant was
removed prior to trypsinization. One mL of Trypsin, containing ethylenediamine tetra-acetic
acid (EDTA), was then added to the T25 flask and slowly rocked in order to completely
cover the bottom surface of the flask. The cells were then incubated at 37 °C, with 5%
Carbon Dioxide, for a maximum of 5 minutes, after which 9 mL of Eagle’s minimal essential
22

medium (containing 10% Fetal Bovine Serum) was added to suspend the cells. The solution
was then gently mixed to ensure that the solution contained an even amount of cells per
volume and was then transferred to a sterile 50 mL Falcon tube.
Cells counts were performed using a hemocytometer. Fifty microliters of stock cell
solution was mixed with 50 µL of Trypan Blue dye. A cover slip was placed over the
hemocytometer and a small drop of solution was added to the v-shaped groove. Cell counts
were taken from 3-4 quadrants and a dilution calculation was performed. Blue cells were not
included in the counts as they are dead.
Dried and powdered mushroom extracts were dissolved into appropriate solvents,
using water whenever possible, ideally at a concentration of 40 mg / mL. Concentrated stock
treatment solutions were then filter sterilized using a 0.2 µm filter. Working under sterile
conditions, treatment solutions were prepared by diluting sterile stock solutions in
EMEM+FBS to achieve desired concentrations, ranging from 0.01 mg / mL to 2 mg / mL,
depending on the sample being assayed. The perimeter of a sterile, 96 well, flat bottomed
plate, was filled with 200 µL of sterile water, leaving 60 wells for use with controls and
various mushroom extract concentrations, coupled with applicable controls. In general, 4-5
different concentrations of mushroom extracts were used coupled with 4-5 controls, each
using a set of 6 technical replicates.
Extracts of interest were also assayed in a time dependent manner. Samples were
prepared using the same methods mentioned above, except that seven of the 96 well plates
were used – 1 for each day. The wells in each plate were treated in the exact same manner
and plates were scanned at 570 nm, daily. Results of each plate were then compared to the
results of the plate from day 7.
23

2.1.5 MTT Assay

The MTT ((3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay is a
widely adopted method of testing for growth-inhibitory and cytotoxic activity in mammalian
cells60–62. This method of analysis relies on the metabolism of living cells to produce a
colorimetric change which can then be quantified via a plate reader at 570 nm63. This colour
change occurs due to the reduction of the yellow tetrazolium MTT by mitochondrial
dehydrogenase enzymes, among others, resulting in an intracellular soluble formazan, which
is purple64 (Figure 7). Mushroom extracts were assessed for possible growth-inhibitory effect
on HeLa human cervical cancer cells. HeLa cells are commonly used to test anti-proliferative
activity from substances derived from mushroom extract65,66.

Figure 7. An example of the final product of an MTT assay67. More intense purple
colouration is indicative of more living cells. If our mushroom extracts have antiproliferative activity, we would expect to see a decrease in purple colour as the concentration
of compound, and time increased.

24

HeLa cells, combined with mushroom extract, were incubated at 37 °C, with 5% CO2,
for a period of 48-72 hours. Next, stock MTT solution was diluted to 1/5th concentration, and
50 µL was added to each of the wells containing controls and mushroom extracts. The plate
was then incubated for an additional 3-4 hours after which the supernatant was completely
aspirated, leaving only the adherent HeLa cells. One hundred and fifty microliters of DMSO
was then added to each well. The plate was then gently shaken for 5-10 minutes and then
read at 570 nm on a Titertek Multiskan photometer, or a Synergy2 plate reader.
2.1.5.1 Fomitopsis pinicola
As this was the first sample extracted and assayed, it was necessary to attempt a
variety of different concentrations of mushroom extract (in MTT assay), in order to ascertain
potential concentrations to use in the future. This mushroom was extracted twice and 3 MTT
assays were performed. In each of the assays, the addition of ammonium oxalate extract to
cells in 96-well plates resulted in precipitation (further confirmed under a microscope). It is
highly suspected that ammonium oxalate extract reacted with chemicals in the medium to
generate the precipitate. Therefore, the ammonium oxalate extraction step was later removed.
Since the different extracts were all dissolved in different solvents (Table 4), it was
necessary to also test the effect of the solvent itself in an MTT assay, in order to rule out false
positive growth inhibitory effects. A basic MTT experiment was set up with all of the
extracts except for ammonium oxalate and visual observations were taken under a
microscope after 24 and 48 hours. The following concentrations were used: extract 1 (80%
ethanol dissolved in water) at 0.5 mg / mL and 1 mg / mL. Extract 2 (99 % ethanol dissolved
in 100% ethanol) at 0.1, 0.2, 0.4 and 1 mg / mL. Extract 3 (Water, dissolved in DMSO) at
0.01, 0.05, 0.2, and 0.5 mg / mL. Extract 4 (5% Sodium Hydroxide, dissolved in water) at 0.5
25

and 1 mg / mL. Additionally, Cis-Platinum, a known chemotherapeutic agent, was used as a
positive control. The results of the visual assessments can be seen in Table 5 and 6.
After the initial MTT assay was completed, another dose dependent experiment was
setup using the following concentrations: E1 (0.01, 0.05 and 0.1 mg / mL), E2 (0.02, 0.04,
0.1, 0.2, 0.4 mg / mL), E3 (0.01, 0.02, 0.05, 0.1, 0.2 mg / mL), E4 (0.005, 0.01, 0.05, 0.1, 0.5,
0.1 mg / mL). Extract E4 (5% Sodium Hydroxide extraction dissolved in water) was reassayed an additional 3 times. A final dose dependent assay (72 hours) was setup using
extract 2 at 0.02, 0.04, 0.1, 0.2 and 0.4 mg / mL. Two concentrations of interest were then
chosen and a 7 day time dependent MTT assay performed using two different seed cell
concentrations, 1500 and 3000 cells per well.

26

Table 4. BC Mushrooms: An Inventory List and Extraction Solvent Used
Mushroom

Processed Raw Weight Used (g) Extract #

Fomitopsis pinicola

33

33

Lentinula edodes

50

50

Piptoporus betulinus

128.5

35

Fomes fomentarius

126.45

40

Ganoderma carnosum

89.31

30

Echinodontium tinctorium

273.15

40

Inonotus obliquus

315

150

Leucocybe connata

80

80

Laetiporus sulphureus

77

77

Phellinus nigricans

135.89

100

27

Extraction Solvent

1
2
3
4
5
1
2
3
4
1
2
3
4
5

80% Ethanol
99% Ethanol
Water
2 % Ammonium Oxalate
5% Sodium Hydroxide
80% Ethanol
Water
2 % Ammonium Oxalate
5% Sodium Hydroxide
80% Ethanol
50% Methanol
Water
2 % Ammonium Oxalate
5% Sodium Hydroxide

1
2
3
4
5
1
2
3
4
5
1
2
3
4
5
1
2
3
4
1
2
3
4
1
2
3
4
1
2
3
4

80% Ethanol
50% Methanol
Water
2 % Ammonium Oxalate
5% Sodium Hydroxide
80% Ethanol
50% Methanol
Water
1 % Ammonium Oxalate
5% Sodium Hydroxide
80% Ethanol
50% Methanol
Water
1 % Ammonium Oxalate
5% Sodium Hydroxide
80% Ethanol
50% Methanol
Water
5% Sodium Hydroxide
80% Ethanol
50% Methanol
Water
5% Sodium Hydroxide
80% Ethanol
50% Methanol
Water
5% Sodium Hydroxide
80% Ethanol
50% Methanol
Water
5% Sodium Hydroxide

2.1.5.2 Lentinula edodes
Shiitake mushrooms have been ingested for their medicinal properties in countries
such as Japan for nearly a century. They have also been shown to have cytotoxic properties
when tested with HeLa cells using MTT assays68. In many cases, a hot water extract is
performed and the extracted material is ingested as a tea. Because of this, it was decided to
setup two side by side extractions, using two different temperatures. The first extraction was
performed at reflux temperatures whereas the second was performed at 50 °C. Extracted
compounds were dissolved in water at a concentration of 40 mg/mL. The following
concentrations were used: E1 – 80% ethanol (0.1, 0.5, 1 mg / mL), E2 - Water (0.1, 0.5, 1 mg
/ mL), E3 – ammonium oxalate (0.1, 0.5, 1 mg / mL) and E4 – 5% Sodium Hydroxide (0.1,
0.5 and 1 mg / mL). A water control was used in equivalence for each extract. A second
MTT assay was later performed using compounds from both the 50 °C and reflux
extractions. This time the following concentrations were used 0.01, 0.05, 0.1, 0.5 and 1 mg /
mL for extracts E1, E2 and E4. The ammonium oxalate extract was not tested again with this
mushroom. Because of these results, it was determined that refluxed reactions were no longer
required and the extraction protocols were modified as per Figure 8. It was also decided that
a 50% methanol extract be included as per a suggestion from Dr. Karl Tsim from the Hong
Kong University of Science and Technology. The addition of the methanol extract is
proposed because methanol is more polar than ethanol, as such it may help to remove
phenolic compounds. It was also decided to use 65 °C as this is between 50 °C and reflux
temperature, as many mushrooms were extracted at reflux.

28

Powdered Mushroom

Residue
80% EtOH 65 °C
(3 Hours)

Residue
50% MeOH 65 °C
(3 Hours)

Residue

Residue
Water 65 °C
(6 hours)

2 % Ammonium Oxalate
65 °C
(6 hours)

5% NaOH 65 °C
(6 hours)

Filtrate

Filtrate

Filtrate

Filtrate
Filtrate

Extract 1

Extract 2

Low Molecular
Weight
Compounds

Water Soluble
Polysaccharides

Extract 4

Extract 5

Evaporate &
Lyophilize

Evaporate &
Lyophilize

Evaporate &
Lyophilize

Evaporate &
Lyophilize

Evaporate &
Lyophilize

Low Molecular
Weight
Compounds

Extract 3

Water insoluble
Polysaccharides
Water insoluble
Polysaccharides

Figure 8. Modified extraction technique to reflect the change in temperature and the addition
of a 50% methanol extract.
2.1.5.3 Piptoporus betulinus
This sample was extracted by following the procedures outlined in Figure 8. An MTT
assay was setup using all 5 extracts. Extract 1 (80% ethanol) was dissolved in ethanol, while
all other extracts were dissolved in water, at 20 mg / mL. The following concentrations were
used for each of the 5 extracts: 0.01, 0.05, 0.1, 0.5 and 1 mg / mL. Even though an
ammonium oxalate extract was extracted, it was decided to not use that particular extract in

29

further MTT assays for this mushroom sample. A 48 hour MTT assay was performed after
which a time dependent assay was performed using E1 (80% ethanol) and E3 (Water).
2.1.5.4 Fomes fomentarius
This sample was also extracted using the procedures outlined in Figure 8. Extracts 1
and extract 2 (80% ethanol and 50% methanol, respectively) were dissolved in DMSO.
Extracts 3 (Water) and 5 (5% NaOH) were dissolved in water. The following concentrations
were used: 0.1, 0.05, 0.1, 0.5 and 1 mg / mL. The ammonium oxalate extract was omitted
from MTT assay in this sample as well. Three extracts were selected for further investigation
and a time dependent MTT assay was setup using extracts 1, 2 and 3.
2.1.5.5 Ganoderma applanatum
This sample was extracted using the procedures outlined in Figure 8. However, the
2% ammonium oxalate extract was modified to be 1%. Extracts 1 (80% ethanol) and extract
2 (50% methanol) were dissolved in DMSO. Extracts 3 (Water), 4 (1% ammonium oxalate)
and extract 5 (5% NaOH) were all dissolved in water. Extract 4 was again omitted due to
precipitation being seen under a microscope. An initial MTT assay was performed using E1,
E2, E3 and F5, after which a seven day time dependent MTT was performed using only the
water extract (extract 3). The following concentrations were used for the 48 hour MTT assay:
0.01, 0.05, 0.1, 0.5 and 1 mg / mL. The time dependent assay was run at 1 mg / ml.
2.1.5.6 Echinodontium tinctorium
This sample was extracted in parallel with G. applanatum and because of this, an
ammonium oxalate extract was still extracted, but was omitted from assay. All 4 extracts
were easily dissolved in water at a concentration of 40 mg / mL. Each extract was first tested
30

using a dose dependent 48 hour MTT assay at the following concentrations: 0.01, 0.05, 0.1,
0.5 and 1 mg / mL. The second extract (50% methanol) was selected for further investigating
in a seven day time dependent MTT assay.
2.1.5.7 Inonotus obliquus
After the previous extractions, it was decided to omit the ammonium oxalate extract
altogether, and move to extraction procedures as outlined in Figure 9. All samples were
easily dissolved in water at a concentration of 40 mg / mL. An initial 48 hour MTT assay was
set up in order to screen all 4 extractions for cell growth inhibition. The following
concentrations were used for each extract: 0.01, 0.05, 0.1, 0.5 and 1 mg / mL. With the
exception of extract 1 (80% ethanol), all extracts were then tested using a seven day time
dependent MTT assay at a concentration of 0.5 mg / mL.

31

Powdered Mushroom

Residue

80% EtOH 65 °C
(3 Hours)

Filtrate

Extract 1

Evaporate &
Lyophilize

Low Molecular Weight
Compounds

Residue

Residue
Residue

Residue

50% MeOH 65 °C
(3 Hours)

Water 65 °C
(3 Hours)

Filtrate

Extract 2

Filtrate

Extract 3

Evaporate &
Lyophilize

Evaporate &
Lyophilize

Water Soluble
Polysaccharides

Low Molecular Weight
Compounds

5% NaOH 65 °C
(3 Hours)

Filtrate

Extract 4
Evaporate &
Lyophilize

Water Soluble
Polysaccharides

Figure 9. The final extraction scheme adopted. This is the modified extraction technique to
reflect the removal of the ammonium oxalate extract entirely. A reduction from 2% to 1% of
ammonium oxalate still caused visible precipitation when combined with HeLa cell /
minimal essential medium (mem) solution.

32

2.1.5.8 Leucocybe connata, Laetiporus sulphureus and Phellinus nigricans
All three of these samples were extracted using the steps outlined in Figure 9. All
extracts were easily dissolved in water at a concentration of 40 mg / mL. All extracts were
assayed using the following concentrations: 0.01, 0.05, 0.1, 0.5 and 1 mg / mL. After an
initial 48 hour MTT assay, time dependent assays were run using the following extracts and
concentrations. Leucocybe connata was run using extract 1 (80% ethanol) and extract 4 (5%
Sodium Hydroxide). Laetiporus sulphureus was run using extract 3 (water) at a concentration
of 0.5 mg / mL. Phellinus nigricans was assayed using both extract 1 (80% ethanol) and E3
(water) at a concentration of 0.5 mg / mL.

33

2.2 Results
2.2.1 Species Identification

The initial DNA extraction was fairly successful. Strong high molecular weight bands
could be seen for samples A1, A3 and A5. A faint band could be seen for sample A2 and
there was no band for sample A4 (Figure 3). All 5 samples were PCR amplified regardless of
the results of the first DNA gel. The PCR reaction also appeared to be successful, with bands
showing for all five samples. Samples A1 and A5 had the strongest bands, indicating that
they underwent the most successful amplification. The majority of my samples had been
previously identified via DNA analysis by Ms. Marta Zmudzinski.
2.2.1.1 Sample A1 – Piptoporus betulinus (Bull.) P. Karst.

Piptoporus (Polyporus) betulinus sporocarps, found on paper birch in a mixed-wood forest in
Ste-Geneviève of Batiscan, Quebec (Chow Lee collection # 137, photo credit H. Massicotte)

34

This sample was obtained from Dr. Egger in the winter semester of 2013. The sample
was ground to a fine powder and was stored at -4 °C. This sample was previously identified
via DNA analysis as being Piptoporus betulinus by Ms. Zmudzinski. The sequences obtained
using the ITS primer was edited to 498 bases, while the sequences obtained using the NLB
primer was edited to 492 bases. A comparison of these two sequences to known fungal
samples via BLAST yielded the sample result for both primers: Piptoporus betulinus. The
ITS sequence had a max score of 890 and a 99% identification, while the NLB sequence had
a max score of 915 and a 99% identification. Both sequences had P. betulinus as the first and
second hit.
2.2.1.2 Sample A2 - Ganoderma applanatum (Pers.) Pat.

Ganoderma applanatum – sample harvested from Smithers, British Columbia, growing on a
tree stump. (Photo credit V. Myhre)

35

This sample was obtained from Dr. Egger in the winter semester of 2013. The sample
was ground to a fine powder and was stored at -4 °C. This sample was previously identified
by Ms. Zmudzinski as being Ganoderma carnosum. The sequences obtained using the ITS
primer was edited to 487 bases while the sequences obtained using the NLB primer was
edited to 417 bases. Each sequence had multiple result possibilities; however, both had
Ganoderma applanatum as the first hit and hence the most likely candidate. The ITS
sequences yielded a max score of 927 and a % identification of 99% whereas the NLB
derived sequences yielded a max score of 797 and a % identification of 99%. The next
highest max score was 818 (G. tsugae) and 743 (G. lipsiense), for the ITS and NLB derived
sequences.
2.1.1.3 Sample A3 - Fomes fomentarius (L.) Fr.

Image obtained from
https://upload.wikimedia.org/wikipedia/commons/7/7b/Fomes_fomentarius_2010_G2.jpg
(Accessed May 9, 2017)
This sample was obtained from Dr. Egger in the winter semester of 2013. The sample
was ground to a fine powder and was stored at -4 °C. This sample was previously identified
36

by Ms. Zmudzinski as being Fomes fomentarius. The ITS sequences were edited to be 508
bases and the NLB sequences were edited to 374 bases. Both the ITS and NLB derived
sequences showed that Fomes fomentarius was the most likely candidate. The sequence
obtained from the ITS primer yielded a max score of 823 and a percent identification of 99%
while the sequence obtained from the NLB primer had a max score of 658 and a percent
identification of 98%. The next highest hit for both sequences was Polyporales sp. but the
max score was far lower as was the percent identification (6% less in both cases).
2.2.1.4 Sample A4 – Echinodontium tinctorium

Echinodontium tinctorium, harvested from West Twins, near McBride, British Columbia.
The specimen is easily identified by its tooth like spikes protruding from its top.

This sample was harvested from an old growth cedar-hemlock forest, West of
McBride, and was found in a fairly shaded area, laying on moss. The outside of the specimen
was dark on the outside and orange / red where the surface was cracked. Teeth could be seen
on the lower surface of the specimen. This sample was previously identified to be
Echinodontium tinctorium by using both MatchMaker (www.matchmakermushrooms.com/)

37

and David Arora’s Mushrooms Demystified58. The sample was stored at -4 °C for
approximately one month prior to performing DNA extraction / PCR. However, this sample
also showed high levels of co-amplification or contamination for both the ITS3 and NLB4
derived sequences. The ITS derived sequence was edited to 498 bases and the NLB derived
sequence was edited to 360 bases. The highest max score for the ITS sequence was 195 and
had a hit for E. tinctorium. The highest max score value for the NLB sequences was 94.5,
showing that the first hit was E. tinctorium.
2.2.1.5 Lentinula edodes

Lentinula edodes seen in quick freeze flasks, after being flash frozen in liquid nitrogen.

This sample was purchased from Shoppers Wholesale in Prince George, British
Columbia (Avina Gourmet Shiitake Mushrooms 100 g packages). No morphological or DNA
analysis was performed on this sample as it was purchased prepackaged and labelled.

38

2.2.1.6 Fomitopsis pinicola (Sw.) P.Karst.

Fomitopsis pinicola, found growing on a fallen log, in Twin Falls Provincial Park, near
Smithers, B.C. (Photo credit V. Myhre)
This sample of red belted conk was obtained from the area surrounding Terrace
during the summer of 2012. The vivid colour makes this species fairly easy to identify. The
actual identity was first confirmed by Dr. Keith Egger and Dr. Hugues Massicotte and was
later confirmed by Mushroom’s Demystified and Match Maker software. When this project
was initially being pioneered, I was enrolled in a Mycology course which had a DNA
analysis section. As such, only a handful of samples were tested as there was limited access.
Also, at that time, DNA analysis was not deemed critical as my samples had been
morphologically identified by Drs. Keith Egger and Hugues Massicotte. Because of this, only

39

P. betulinus, G. applanatum, F. fomentarius and E. tinctorium were identified via DNA
analysis.
2.2.1.7 Inonotus obliquus (Ach. ex Pers.) Pilát

Inonotus obliquus growing on a birch tree, collected from Forest for the World, an area
surrounding UNBC. The second picture is the harvested sample.

This specimen was growing high up on paper birch and was collected during the
spring of 2013, from the area surrounding UNBC. In fact, once the first one was located, it
was easy to see many more far up on other birch trees. The sample weighed over 8 lbs and
had a dry weight of about 5 lbs. The Chaga appears to burst out of the tree, almost in a
tumor-like fashion, as can be seen in the picture above. It was extremely black, cracked, and
dense and was nearly 25 cm across. Identification began with the Polypores section in
MatchMaker and concluded that it was Inonotus obliquus – unmistakable from the pictures
included with the software. The identity was also keyed out as per David Arora’s Mushrooms
40

Demystified, beginning with the Polypore section. The spore bearing surface was not made
of tubes and the pore surface was exposed and was growing on Birch but not ‘curblike’.
Additionally, the surface was not waxy and the flesh was red to orange, rusty-brown or dark
brown when exposed to Potassium Hydroxide. This lead to the next section: Phaeolus,
Inonotus, Coltricia and Allies. Because the fruiting body was a brown / dark black in colour
and the surface was cracked and irregularly shaped, and also found on birch, it was
determined that this specimen was Inonotus obliquus.

2.2.1.8 Leucocybe connata (Schumach.) Vizzini, P. Alvarado, G. Moreno & Consiglio

Sample of Leucocybe connata after being frozen in liquid nitrogen and lyophilized for 48
hours.
This sample was collected from the area surrounding Prince George by former
students in Dr. Egger and Dr. Massicotte’s Mycology course. The sample was provided and
identified by Dr. Massicotte. Because this species is so moist, we had to go back and collect
additional material in order to perform an adequate extraction.

41

2.2.1.9 Laetiporus sulphureus (Bull.) Murrill

Image obtained from
https://upload.wikimedia.org/wikipedia/commons/e/ec/Laetiporus_sulphureus_big.jpg
(Accessed May 9, 2017)
This sample was obtained from Northern British Columbia in the area surrounding
UNBC, in the spring of 2013 and was identified by Dr. Egger and Dr. Massicotte. Since this
species is so readily available (commonly referred to as Chicken of the Woods) and easily
identified, no DNA analysis was performed on this sample.

42

2.2.1.10 Phellinus nigricans (Fr.) P. Karst

Oven dried sample of Phellinus nigricans obtained from the Greenway trail behind UNBC.
This specimen was collected behind UNBC in September 2013 and was located on a
fallen birch towards the underside in a fairly shaded, undisturbed area. It is brown in colour
and has a velvety underside. The shape was somewhat hoofed but it appears to have
molded/formed around the tree. The top portion was fairly cracked. The tissue blackened
when exposed to 10% Potassium Hydroxide solution. The measurements were 10 cm x 4 cm.
Using MatchMaker, I got an 87% match to Phellinus nigricans (which happened to be the
only match). The specimen was identified using David Arora’s Mushrooms Demystified
using the following criteria. The spore bearing surface was composed of tubes and the
43

fruiting body was hoof-life. Additionally, the pore surface was exposed and the fruiting body
had a cap, was hard and a stalk was absent. The only match to this was Phellinus nigricans.
2.2.2 Dose and Time Dependent MTT Assays
2.2.2.1 Fomitopsis pinicola
Since this was the first mushroom that was processed, extracted and assayed, it was
tested many times. Initially, only 2-3 concentrations were used and visual observations were
taken after 24-48 hours (Tables 5-6) in order to assess the viability of the chosen
concentrations. It was also necessary to examine whether or not the solvents, used to dissolve
the dried mushroom samples, were able to cause cell growth inhibition in HeLa cells. After
24 hours, the cells treated with DMSO at 0.1% looked healthy while the cells treated with 5%
DMSO were starting to round up and die. The cells treated with ethanol, both 0.25% and
2.5%, were all healthy. Cells treated with 25 µM and 50 µM of Cis-Platinum all appeared to
be rounding up and slowly dying. The media in the wells treated with E1 (80% ethanol),
appeared to yellow which is usually indicative of acidity. The cells were also completely
dead. All wells treated with extract 2 (99% ethanol) appeared to be rounding up and dying at
all concentrations, with the exception for at 1 mg / mL, where the cells were completely
dead. The medium was not yellow in any of the wells treated with E2. Extract 3 also caused
complete cell death at its highest concentration (1 mg / mL), but the medium also appeared to
be yellowed. The cells in wells treated with E4 (5% NaOH) appeared to be healthy. Visual
observations were also taken after 48 hours. The wells treated with E1 looked the same as
they did after 24 hours, completely dead and yellow. Cells treated with E2 and E3 looked the
same as they did after 24 hours. However, the wells treated with E4 now appeared to be

44

stimulatory. Further assays were performed using E4 and no stimulatory effect was observed,
either visually, or after an MTT assay.
The results of a 72 hour MTT assay can be seen in Figure 10. Some growth inhibition
can be seen in cells treated with E1, when compared to their respective controls. Cell growth
inhibition, in cells treated with E2, was dramatic. All three concentrations were able to
reduce HeLa cell growth to 20% or less. Extracts 3 and 4 had little effect.
Both time dependent assays had nearly the same result, at both 1500 and 3000 cells
per well (Figures 11 and 12). Final concentrations as low as 0.1 mg / mL were able to
completely obliterate cell growth. After this assay, it was determined that a cell density of
1500 cells per well would be sufficient for further 7 day time dependent assays.

45

Table 5. MTT Assay (Extracts from Fomitopsis pinicola) – Visual Observations after 24
hours of treatment
Treatment
Concentration
Medium
Cells look
Cells look
Complete
looks
normal
round
death/toxic
yellow
and
up/slowly
(acidic)
healthy
dying
DMSO
5%
x
0.1%
x
Ethanol
2.5%
x
0.25%
x
Cis-platinum 50 µM
x
25 µM
x
Extract 1
1 mg/ml
x
x
0.5 mg/ml
x
x
Extract 2
0.1 mg/ml
x
(0.25% ethanol)
0.2 mg/ml
x
0.4 mg/ml
x
1 mg/ml
x
x
(2.5% ethanol)
Extract 3
0.01 mg/ml
x
(0.1% DMSO)
0.05 mg/ml
x
0.2 mg/ml
x
0.5 mg/ml
x
x
(5% DMSO)
Extract 4
1 mg/ml
x
0.5 mg/ml
x

46

Table 6. MTT Assay (Extracts from Fomitopsis pinicola) – Visual Observations after 48
hours of treatment
Treatment
Concentration
Medium
Cells look
Cells look
Complete
looks
normal and
round
death/toxic
yellow
healthy
up/slowly
(acidic)
dying
DMSO
5%
x
0.1%
x
Ethanol
2.5%
x
0.25%
x
Cis-platinum 50 µM
x
25 µM
x
Extract 1
1 mg/ml
x
x
0.5 mg/ml
x
x
Extract 2
0.1 mg/ml
x
(0.25% ethanol)
0.2 mg/ml
x
0.4 mg/ml
x
1 mg/ml
x
x
(2.5% ethanol)
Extract 3
0.01 mg/ml
x
(0.1% DMSO)
0.05 mg/ml
x
0.2 mg/ml
X (medium
becoming
yellow)
0.5 mg/ml
x
x
(5% DMSO)
Extract 4
1 mg/ml
X (appeared
stimulatory
0.5 mg/ml
X (appeared
stimulatory)

47

Figure 10. The results of a 72 hour MTT assay using four extracts obtained from the
extraction of F. pinicola. The extracts were extracted in the following solvents. E1 (80%
ethanol), E2 (99% ethanol), E3 (Water), E4 (5% Sodium Hydroxide). An ammonium oxalate
extract was not tested. One biological replicate and six technical replicates were used for
each extract and concentration. *P < 0.05 versus control; Student’s t-test (one-tailed). Error
bars are standard error of the mean (S.E.M).

48

Figure 11. The results of a time dependent assay using two concentrations of extract 2, which
was extracted in 99% ethanol and then dissolved in 80% ethanol. Two concentrations were
used, 0.1 and 0.2 mg / mL. A cell density of 1500 cells were well was used. One biological
replicate and six technical replicates were used for each extract and concentration. Error bars
are S.E.M.

49

Figure 12. The results of a time dependent assay using two concentrations of extract 2, which
was extracted in 99% ethanol and then dissolved in 80% ethanol. Two concentrations were
used, 0.1 and 0.2 mg / mL. A cell density of 3000 cells were well was used. One biological
replicate and six technical replicates were used for each extract and concentration. Error bars
are S.E.M.

Extract 2 appeared to be extremely promising, and the results of another MTT assay
can be seen in Figure 13. Cell inhibition can be observed in a dose dependent manner,
starting at 0.1 mg / mL. Cell death levels off at around 20% cell viability with all of the
remaining concentrations. Cis-Platinum has a similar graph curvature to that of E2, and was
shown to have potent cell kill capability even at concentrations of 10 uM (Figure 14).

50

Figure 13. Seventy-two hour dose dependent MTT assay using extract 2 (99% ethanol)
extracted from F. pinicola. One biological replicate and six technical replicates were used for
each extract and concentration.

Figure 14. Forty Eight Hour Dose dependent using Cis Platinum and Human HeLa cells. Cell
growth inhibition begins with concentrations of 5 uM. One biological replicate and six
technical replicates were used for each extract and concentration.

51

2.2.2.2 Lentinula edodes
Because this mushroom has been so well characterized and investigated, we used a
store bought sample as a test of our extraction protocols and MTT assay. There were some
large differences (Figure 15). For example, E4 (5% NaOH) appeared to have little to no
effect when extracted at reflux whereas cell viability was reduced to 50-60% when extracted
at 50 °C. In both cases, E3 (water) had nearly the same result, around 60% cell viability when
compared to their respective controls. Since this sample was strictly used as a test of
protocol, a time dependent MTT assay was not performed.

52

Figure 15. MTT (48 hour) assay of Lentinula edodes. Two separate extractions were
performed. One at reflux and one at 50 °C. In both assays, the water extract E2, has similar
growth inhibitory effect – around 60% of the control. One biological replicate and six
technical replicates were used for each extract and concentration. Error bars are S.E.M.

53

2.2.2.3 Piptoporus betulinus
With the exception of extract 5 (5% NaOH), all of the extracts had a growth
inhibitory effect as seen in a 48 hour MTT assay (Figure 16). The Water extract, E3, held
steady at about 50% cell viability when used at the three highest concentrations. Extract 1
(80% ethanol) had the most dramatic effect and dipped below 20% cell viability (% control).
Not surprisingly, extract 1 had potent cell kill capability as seen in a time- dependent assay
(Figure 17). Although extract 3 reduced cell viability by over 40% in the dose dependent
assay, this was not reflected in the time dependent assay, where cell viability was at 80% of
the control.

Figure 16. Dose dependent MTT assay using four extracts from P. betulinus. The ammonium
oxalate extract was omitted. One biological replicate and six technical replicates were used
for each extract and concentration. Error bars are S.E.M.

54

Figure 17. Seven day time dependent assay using E1 (80% ethanol) and E3 (water), extracted
from P. betulinus. The water extract had little effect as compared to the control whereas the
80% ethanol extract appeared to have potent growth inhibitory effect on HeLa cells. One
biological replicate and six technical replicates were used for each extract and concentration.
Error bars are S.E.M.

2.2.2.4 Fomes fomentarius
Extract 5 had little to no effect on cell growth, as seen in a 48 hour dose dependent
assay (Figure 18). Extracts 1 and extracts 2 (80% ethanol and 50% methanol), had extremely
similar levels in the reduction of cell viability, as compared to their controls, and had their
greatest effect at 0.5 mg / mL. The third extract (water) demonstrated a near linear curve in
the reduction of cell viability as the concentration of extract increased. At 1 mg / mL, E3
55

reduced cell viability by nearly 80%. Extract 3 was also the most potent when used in a time
dependent MTT assay (Figure 19), further reinforcing the data collected during the dose
dependent assay. Extract 1 decreased cell viability by 20% by the 7th day, while extract 2
ended up with nearly no visible inhibitory effect; by the 7th day cell viability was close to that
of its control.

Figure 18. Dose dependent MTT assay using extracts from F. fomentarius. Extract 4
(ammonium oxalate) was omitted from this assay. One biological replicate and six technical
replicates were used for each extract and concentration. Error bars are S.E.M.

56

Figure 19. Seven Day MTT assay using extracts 1 (80% ethanol), extract 2 (50% methanol)
and extract 3 (Water). The water extract produced the largest growth inhibitory effect. One
biological replicate and six technical replicates were used for each extract and concentration.
Error bars are S.E.M.

2.2.2.5 Ganoderma applanatum
Extract 2 (50% methanol) and extract 5 (NaOH) had little to no effect with respect to
cell viability (Figure 20). Extract 1 (80% ethanol) had greatly decreased cell viability at 0.5
mg / mL. However, at a higher dose (1 mg / mL), cell viability increased by 40%. Extract 3
(Water) decreased cell viability in a dose dependent manner and decreased cell growth by
55% at its highest concentration – 1 mg / mL. Extract 3 was selected for further investigation

57

in a seven day time dependent MTT assay (Figure 21). When compared to a water control,
extract 3 drastically reduced cell viability. After 7 days, cell viability was deceased by 50%.

Figure 20. Dose dependent MTT assay using extracts extracted from G. applanatum. Extract
4 (ammonium oxalate) was omitted from this assay. One biological replicate and six
technical replicates were used for each extract and concentration. Error bars are S.E.M.

58

Figure 21. Seven day time dependent MTT assay using extract 3 (water) extracted from G.
applanatum. Extract 3 potently reduced cell viability during each day and reduced cell
viability by 55% on day seven, when compared to its control. One biological replicate and
six technical replicates were used for each extract and concentration. Error bars are S.E.M.

2.2.2.6 Echinodontium tinctorium
Extract 1 (80% ethanol) and extract 5 (5% NaOH) had little to no effect inhibiting
cell growth in HeLa cells (Figure 22). Extract 3 (Water) decreased cell viability by 30% at its
highest dose of 1 mg / mL. Extract 2 (50% methanol) decreased cell viability in a dose
dependent manner, in a near linear fashion. At 0.5 mg / mL, growth was inhibited by 50%. At
1 mg / mL, growth was inhibited by over 80%. Because of this, extract 2 was selected for
further investigation in a time dependent MTT assay (Figure 23). While a dose of 0.5 mg /
mL did not have a dramatic effect on cell viability, a dose of 1 mg / mL wiped out nearly all
59

the cells, and decreased cell viability to well under 10%, as compared to its respective
control.

Figure 22. Dose dependent MTT assay using extracts from E. tinctorium. Extract 4
(ammonium oxalate) was omitted from this assay. Extract 2 (50% methanol) reduced cell
viability in a dose dependent manner. One biological replicate and six technical replicates
were used for each extract and concentration. Error bars are S.E.M.

60

Figure 23. Seven day time dependent MTT assay using extract 2 (50% methanol) at two
concentrations, 0.5 and 1 mg / mL. While 0.5 mg / mL had little effect over a 7 day period,
0.1 mg / mL dramatically reduced cell viability over the entire range of the assay. One
biological replicate and six technical replicates were used for each extract and concentration.
Error bars are S.E.M.

The results of two separate extraction methods can be seen in Figure 24. Both the
manual/traditional and speed extracted samples had very similar effect on cell viability of
HeLa cells. However, the speed extracted sample decreased cell viability by an additional
10% over that of the manually extracted sample. Both methods extracted approximately the
same ratio of E2 from the sample, 1%.

61

Figure 24. Dose dependent MTT assay (72 hours) using extract 2 (80% ethanol) from E.
tinctorium. Two separate extractions were performed. The first using traditional extraction
methods as outlined in Figure 8, and the second using a Buchi Speed Extractor. Both
methods yielded similar results. However, the speed extractor reduced cell viability by 10%
more than tradition methods. One biological replicate and six technical replicates were used
for each extract and concentration. Error bars are S.E.M.

2.2.2.7 Inonotus obliquus
All extracts decreased cell viability by over 70%. Extract 1 (80% ethanol) and extract
4 (5% NaOH) both decreased cell viability by 80%. The three highest doses of extract 3
(Water) decreased cell viability in a linear manner, and inhibited HeLa cell growth by 3540% (Figure 25). Extracts 2, 3 and 4 were selected for further investigation in a timedependent assay (Figure 26). All three extracts had very similar curves and decreased cell

62

viability in a similar fashion. However, extract 3 (Water) inhibited HeLa cell growth by the
largest amount after 7 days, 65%.

Figure 25. Dose dependent MTT assay using extracts from I. obliquus. All extracts
demonstrated a major reduction in cell viability, in a dose dependent manner. One biological
replicate and six replicates were used for each extract and concentration. Error bars are
S.E.M.

63

Figure 26. Seven day time dependent MTT assay using extracts obtained from I. obliquus.
All three extracts had a very similar cell growth inhibitory effect. One biological replicate
and six technical replicates were used for each extract and concentration. Error bars are
S.E.M.

2.2.2.8 Leucocybe connate
Extracts 1-3 all decreased cell viability by virtually the same amount, 40%, at the
highest dose (1 mg / mL). Extract 4 (5% NaOH) decreased cell viability by 70% at 1 mg /
mL (Figure 27). Extract 1 and extract 4 were further investigated in a time dependent MTT
assay (Figure 28). At 0.5 mg / mL, both extracts inhibited cell growth with similar strength,
decreasing cell viability by 15-20%, after seven days.

64

Figure 27. Dose dependent MTT assay using extracts from L. connata. Extracts 1-3 had a
very similar effect while Extract 4 reduced cell viability to 35%. One biological replicate and
six technical replicates were used for each extract and concentration. Error bars are S.E.M.

65

Figure 28. Seven day dose dependent MTT assay of extracts from L. connata. Extract 1 (80%
ethanol) and extract 4 (5% NaOH) reduced cell growth by very similar amounts. The NaOH
extract reduced cell viability by more than 20% when assayed in day 7 whereas E1 reduced
cell viability by 25%. One biological replicate and six technical replicates were used for each
extract and concentration. Error bars are S.E.M.
2.2.2.9 Laetiporus sulphureus
In a 48-hour dose dependent MTT assay (Figure 29), extract 1 appeared to be
stimulatory while extract 4 appeared to have no effect. The methanol extract (E2) reduced
cell viability by 20%. Extract 3 (water) had the largest growth inhibitory effect and reduced
cell viability by 30%. When subjected to a time dependent assay, extract 3 reduced cell
viability by 40% after the week-long treatment (Figure 30).

66

Figure 29. Dose dependent MTT assay using extracts from L. sulphureus. Extract 1 appeared
to be stimulatory while extract 4 appeared to have no effect. The methanol extract (E2)
reduced cell viability by 20%. Extract 3 (water) had the largest growth inhibitory effect and
reduced cell viability by 30%. One biological replicate and six technical replicates were used
for each extract and concentration. Error bars are S.E.M.

67

Figure 30. Seven day dose dependent MTT assay of extracts from L. sulphureus. After seven
days, extract 3 (water) reduced cell viability by 40 %, when compared to controls. One
biological replicate and six technical replicates were used for each extract and concentration.
Error bars are S.E.M.

2.2.2.10 Phellinus nigricans
At a dose of 0.5 mg / mL, extract 4 (5% NaOH) appeared to be stimulatory but
decreased cell viability at 1.0 mg / mL. At a very low dose, 0.1 mg / mL, extract 2 (50%
methanol) decreased cell viability by 20% but that was reduced to 10% at a dose of 0.5 mg /
mL. Both extract 1 and extract 2 decreased cell viability by 50% at 1 mg / mL (Figure 31).
Because of this, both E1 and E2 were selected for use in a time dependent MTT assay
(Figure 32). Extract 1 had little effect on growth inhibition while extract 3 decreased cell
viability (% control) by more than 40% after the seventh day of incubation with HeLa cells.

68

Figure 31. Dose dependent MTT assay of extracts from P. nigricans. Extract 4 appeared to
be stimulatory at 0.5 mg / mL but reduced cell viability at a higher dose. Extract 1 and extract
3 both reduced cell viability by 50%. One biological replicate and six technical replicates
were used for each extract and concentration. Error bars are S.E.M.

69

Figure 32. Seven day time dependent MTT assay of extract 1 (80% ethanol), and extract 3
(water), obtained from P. nigricans. Extract 1 had little to no effect by the seventh day
whereas extract 3 reduced cell viability by 50%. One biological replicate and six technical
replicates were used for each extract and concentration. Error bars are S.E.M.

70

2.3 Discussion
2.3.1 Morphological and DNA investigation

Each sample, with the exception of A4, was positively identified using DNA analysis.
Sample A2 may have been misidentified by Marta Zmudzinski as it was previously identified
as being Ganoderma carnosum, which is not found in B.C, according to MatchMaker.
Ganoderma applanatum is however found in the province. Also, when comparing my sample
to pictures of G. applanatum, the two are found to be highly similar in appearance. Samples
A1 and A3, which were identified as being Piptoporus betulinus and Fomes fomentarius,
agreed with Ms. Zmudzinski’s previous DNA analysis. Sample A4 had high levels of
contamination and as such the sequences had to be highly edited. However, based on
previous identification using MatchMaker and Mushroom’s Demystified, it is fairly certain
that this sample is Echinodontium tinctorium. Overall, the DNA analysis yielded expected
results. However, DNA analysis coupled with morphological identification may provide for
the highest degree of certainty when positively identifying fungal species.

2.3.2 Growth-inhibitory Effect on HeLa Human Cervical Cancer Cells – Mushrooms
Tested

Fomitopsis pinicola is widely used as a medicinal mushroom in Asia69, due to its
strong antimicrobial70, antioxidant and antitumor activitites71. Previous research has shown
that ethanol extracted polysaccharides from F. pinicola have a large inhibitory effect on
vascular endothelial growth factor (VEGF) mediated tubule formation in endothelial cells72.
VEGF plays a key role in the mediation of angiogenesis73. It is really no surprise that the
71

ethanolic-based extraction (extract 2) performed here on F. pinicola had a very strong
inhibitory effect on the growth of HeLa cells, in both dose and time dependent MTT assays.
Lentinula edodes (Shiitake) is another mushroom species that is commonly used for
its medicinal properties in Asiatic countries – especially in Japan. Previous research has
shown that ethyl acetate extracts can induce apoptosis in breast cancer cell line MCF-721. L.
edodes has also been shown to have antioxidant and antimicrobial properties74, as well as
antiviral activity75. Lentinula edodes is often ingested as a tea (hot water extract) for the
treatment of a plethora of illnesses, including cancer76. Since the polysaccharides extracted
from Shiitake are water soluble, this made it an ideal candidate to test my initial extraction
protocols. The data collected from both the reflux and 50 degree extraction correlated well
with previous research in that the water extract (E3) had a high growth inhibitory effect on
HeLa cells.
Piptoporus betulinus is a birch polypore that was used extensively as a medicinal
treatment for a plethora of ailments, in ancient Europe. It has been shown to possess antiinflammatory properties77 which are caused by lanostane-type triterpene acids, which were
measured by inhibition on a 3α-hydroxysteroid dehydrogenase enzyme77. Furthermore,
researcher in Poland have shown that a carboxymethylated α-(13)-D-glucan, extracted
using an alkali solution, was able to inhibit growth of HeLa cells by 50% in an MTT assay78.
To our knowledge, this is the first time that ethanol based extractions (E1) have been shown
to possess potent growth-inhibitory effects, and are capable of reducing cell viability to
approximately 30%, at doses as low as 0.1 mg / mL (Figures 16-17). Sodium Hydroxide
extracts (5%) had no growth-inhibitory effect (Figure 16). This data correlates well with the
above research into Alpha-D-Glucans isolated from P. betulinus in Poland78.
72

Fomes fomentarius, the tinder polypore and a pathogenic saprotroph, has been shown
to have anti-tumour79 and anti-inflammatory activities80. An ergostane-type sterol obtained
from the ethanol extract of F. fomentarius, from northwestern China was documented to have
moderate cytotoxic effects on a plethora of human cancer cell lines, with an IC50 from 24 to
30 uM79. Results here show that F. fomentarius has strong growth inhibitory effect in every
extract, with the exception of extract 5 (Figures 18-19).
Abundantly found growing throughout Northern British Columbia, Ganoderma
applanatum, or artist’s conk, has been found to possess anti-tumor81,82, immuno-modulatory
and anti-inflammatory properties81. Water extracts from mycelial cultures of G. applanatum
from Korea81 and China82, were found to reduce solid tumor growth in mice. It is thought that
the observed anti-tumor effect is caused by immuno-modulation since water extracts also
significantly activated natural killer cells (NK) in mice81. A water based extraction (E3) was
able to greatly reduce HeLa cell viability in both dose dependent and time dependent MTT
assays (Figure 20-21), which is consistent with previous research. Additionally, cell growth
inhibition by an ethanol based extraction was demonstrated for the first time (Figure 20).
Commonly referred to as Indian paint fungus, Echinodontium tinctorium can be found
growing in many locations in Northern B.C. To my knowledge, this is the first time that E.
tinctorium has ever been investigated for any type of growth inhibitory properties with
respect to cancer cells. We show for the first time, that ethanol extractions from E. tinctorium
possess potent growth inhibitory properties in HeLa cells, in a dose dependent manner
(Figure 22). This data is further demonstrated in a time dependent MTT assay (Figure 23).
The strong cell growth inhibitory effect and the lack of research and publication, make E.
tinctorium a novel candidate for further investigation as described in Chapter 3.

73

Despite its abundant usage as a folk remedy, little research has been performed on
Chaga (Inonotus obliquus) of Canadian origin. Inonotus obliquus has traditionally be used as
a treatment for a number of illnesses, including cancer, in Russia and several Baltic
countries83. Compounds such as triterpenoids and ergosterol peroxide, extracted using
ethanol, from Russian samples of I. obliquus, have been shown to have anti-tumor effects in
mice and growth inhibitory effects in cancer cell lines84,85. Additionally, large molecules such
as lignin and polysaccharides, extracted with water from I. obliquus, have been shown to
have anti-tumor activity in mice86. Growth inhibitory effect and anti-invasion activity have
also been shown in cancer cell lines87. Anti-tumor effect of polysaccharides, observed in
mice, are thought to be immuno-modulatory since they concomitantly active lymphocyte and
splenocyte proliferation86. In this project, I have shown that all four extracts, from I.
obliquus, have strong growth inhibitory effects (Figure 25). This data is further strengthened
by a dose dependent MTT assay (Figure 26), in which the water extract has the most potent
effect on cell viability. This research is consistent with papers published from Russia and
China84,85,87.
Leucocybe connata is a white capped mushroom found growing in clusters on
disturbed ground, and can be commonly harvested from areas surrounding UNBC. Very little
research / investigation have been performed on L. connata, especially with respect to growth
inhibition of cancer cells. E4 (5% NaOH) was shown to have potent growth inhibitory
reduction of 65% (Figure 27). Extracts 1-3 all reduced cell viability by approximately 40%.
This may be the first time any type of growth inhibitory effect has been demonstrated from
extractions obtained from L. connata.

74

Laetiporus sulphureus, or chicken of the woods, is commonly found throughout
North America. Previous research has shown L. sulphureus to possess antimicrobial and antioxidant properties88. Furthermore, methanol and dichloromethane extracts, obtained from L.
sulphureus, have been shown to inhibit HIV-1 reverse transcriptase89. Laetiporus sulphureus
has also been show to possess anti-parasitic and anti-tumor properties, on T4 leukemic cancer
cells90 as well as inducing apoptosis on HL-60 human myeloid leukemia cells91. The
mechanism of activation is thought to be intrinsic as the release of cytochrome c was
detected91. In this project, it was shown that extract 1 appeared to be stimulatory (Figure 29),
while extract 4 appeared to have little to no effect. Extract 3 had potent cell growth inhibition
and reduced cell viability by 30%.
The last species examined in this study was Phellinus nigricans. Due to difficulties
arising from cultivation in Asia, there has been little research with respect to anti-tumor
properties. However, polysaccharides, isolated using water extractions in China, have been
found to have anti-tumor activity against mice inoculated with Sarcoma 180 cells92.
Additionally, water extracted polysaccharides from P. nigricans have been found to have
antioxidant and immunological activity93. In this project, it was shown that the water extract
(extract 3) has potent grown inhibitory properties at 1 mg / mL (Figure 31).
To my knowledge, this may be the first research project to investigate B.C wild
mushrooms for anti-cancer properties. A few species have never been examined in this
manner, such as L. connata and E. tinctorium. The potent growth inhibitory properties of
ethanol extracts obtained from E. tinctorium are novel and lay a foundation for further
investigation.

75

Chapter 3 - Investigating the Growth-Inhibitory Activity of the Methanol Extract of
Echinodontium tinctorium
3.1 Introduction
Due to the potent growth-inhibitory effect demonstrated by the methanol extract of E.
tinctorium in Chapter 2, and the fact that there had been virtually no research or publications
on E. tinctorium, it was deemed that further analysis was warranted. Extract 2 (50%
methanol) was first tested using a variety of different cancer cells lines in MTT assays.
Afterwards, purification was attempted using Sephadex LH-20 (size exclusion
chromatography). Purified samples were then assessed for the presence of protein using a
BCA kit, and total carbohydrate content was determined using a hot sulphuric acid assay and
glycoprotein content using a total glycoprotein estimation kit.
3.2 Methodology
3.2.1 Sephadex LH-20 Size Exclusion Purification
Sephadex LH-20 is a cross-linked, beaded dextran commonly used to separate
compounds and molecules based on size. The dextran is cross linked and is pH stable from
2-13 and has a standard operating temperature of 4 °C to 40 °C94. A variety of solvents can
be used with LH-20, making it ideal for use in purifying crude mushroom extracts. For this
study, LH-20 was swollen over night with water and excess liquid was carefully decanted the
next day. Swollen LH-20 was then poured into an appropriate sized column in one
continuous motion. In later assays, a C16/70 column was packed using an Akta-Prime Plus
system at 2 mL/min, with a final bed volume of 100 mL. Two mL of sample was then loaded
using a 5 mL loop and sample was eluted using 50% methanol at a rate of 1 mL/min.

76

Fractions were collected at a volume of 10 mL. Once the column run was complete, the
column was flushed with 3 bed volumes of 50% methanol.
3.2.2 Total Carbohydrate Colorimetric Assay Kit (#K645-100)

A total carbohydrate estimation colorimetric assay kit was purchased from BioVision
(U.S.A). In this type of phenol-sulfuric acid assay, polysaccharides and their derivatives are
hydrolyzed to monomers in the presence of sulfuric acid and are converted to furfural or
hydroxyfurfural, which then reacts with the included developer to form a chromogen, which
can then be quantified by measuring the absorbance on a plate reader at 490 nm. This kit can
detect most carbohydrates, both simple and complex saccharides, glycans, glycoproteins and
glycolipids.
Developer

Concentrated H2SO4
Saccharide

Furfural

Detect 490 nm

Figure 33. Chemical structure of a furfural compound.
Firstly, 0, 2, 4, 6, 8 and 10 μL of provided glucose standard are added into a series of
wells of a 96-well flat bottom plate. These are used to generate standards at the following
concentrations: 0, 4, 8, 12, 16 and 20 μg. Volumes are then adjusted to 30 μL with dH2O.
Samples are prepared by adding a maximum of 30 μL per well, in triplicate, and volumes are

77

adjusted with dH2O. In this study, 30 μL of LH-20 purified fraction was used. Next, 150 μL
of technical grade Sulphuric Acid is added to each standard and sample well and the plate is
then gently shaken by hand to mix. The plate is then incubated for 15 min at 90 °C, after
which 30 μL of Developer is added, which is provided with the kit. Samples and standards
are then gently mixed by hand for 3-5 min at room temperature. Finally, the optical density is
read on a Synergy2 Plate Reader at 490 nm. A standard curve is then plotted based on OD
readings of the standards and their known concentration of glucose. Sample concentrations
can then be extrapolated from the equation of the curve95.

3.2.3 Pierce Glycoprotein Carbohydrate Estimation Kit (#23260)
A Pierce glycoprotein carbohydrate estimation kit (purchased from Thermo Scientific
in the U.S.A) was used to measure the total amount of protein glycosylation as a percent of
the total protein mass. Glycoproteins are oxidized using sodium meta-periodate to form
aldehydes, which then react with the included glycoprotein reaction agent. The resulting
reaction causes a purple colour, quantified at 550 nm.
The kit includes the following materials: 500 mg sodium meta-periodate, 500 mg of
glycoprotein detection reagent and 250 mL glycoprotein assay buffer (containing 1% sodium
azide). The kit also includes 2 negative controls: 2.5 mg lysozyme and 2.5 mg bovine serum
albumin, and 4 positive controls: 2.5 mg ovalbumin, 2.5 mg apotransferrin, 0.25 mg fetuin
and 0.25 mg α1-acid glycoprotein.
Materials are prepared in the following manner: a 10 mM solution of meta-periodate
is made by dissolving 21.4 mg using 10 mL of glycoprotein assay buffer. Next, 50 mg of

78

glycoprotein detection buffer is dissolved in 10 mL of 1M Sodium Hydroxide. Samples are
dissolved in glycoprotein assay buffer at 0.25 and 2.5 mg/mL.
Using a sterile 96-well, flat-bottomed plate, 50 μL of each sample and standard were
added to each well, in triplicate. A blank containing 50 μL of glycoprotein assay buffer was
also added. Next, 25 μL of sodium meta-periodate was added to each of the sample and
standard wells. The plate was then mixed for 30 sec by hand, after which it was incubated at
room temperature for 10 min. One hundred and fifty microliters of glycoprotein detection
reagent was then added to each well and the plate was mixed for an additional 30 sec by
hand. Lastly, the plate was covered and incubated at room temperature for 1 h. Absorbance
was then measured at 550 nm using a Synergy2 plate reader and a standard curve was
plotted. Because both Fetuin and α1-acid glycoprotein have carbohydrate content greater than
10 %, the 2.5 mg/mL standard values must be calculated by multiplying the absorbance
values obtained from their respected 0.25 mg/mL by a factor of 10. Glycoprotein
concentration is then extrapolated from the standard curve96.
3.2.4 Pierce BCA Protein Assay Kit (#23225)
This kit was purchased from Thermo Scientific (U.S.A) and was used to measure the
total protein content of LH-20 purified samples, obtained from the ethanol extraction of E.
tinctorium. Proteins reduce Cu+2 to Cu+1, in alkaline solutions, resulting in a purple colour,
which can then be quantified on a plate reader at 562 nm. The colouration is caused by the
chelation of one molecule of BCA with 2 molecules of Cu+1.
Standards are prepared by diluting stock BSA with ddH2O to nine different
concentrations. In this case the following concentrations were used: 0, 0.02, 0.05, 0.1, 0.2,
0.5, 1, 1.5 and 2 mg/mL. Next, 50 parts BCA reagent A are combined with 1 part BCA
79

reagent B, to form a working reagent. Ten microliters of each standard and sample are then
added to the wells of a 96-well flat-bottomed plate, in triplicate. Next, 200 μL of working
reagent is added to each well and the plate is mixed by hand for 30 seconds, after which the
plate is covered and incubated at 37 °C for 30 min. The plate is then cooled to room
temperature and quantified on a plate reader at 562 nm. Finally, a standard curve is plotted,
after subtracting the 562 nm absorbance reading from the blank wells. The linear trend line is
then used to calculate protein concentration in each sample. In this study, standards of 0,
0.02, 0.05, 0.1, 0.2, 0.5, 1, 1.5 and 2 mg/mL were used and 10 μL of LH-20 purified fractions
were assayed. The values of the standards were then used to create a standard curve.

3.2.5 Phenol Chloroform Extraction (P.C.I)
A phenol chloroform extraction was attempted in order to remove protein from then
50% methanol extracted sample from E. tinctorium. Two hundred microliters of phenol was
combined with 200 μL of Chloroform:isoamyl alcohol and was then added to 400 μL of
crude E2 fraction, in a 1.5 mL microcentrifuge tube. The tube was then inverted to mix and
spun at 12,000 rpm for 5 min. The aqueous phase was then collected and used in a 48 h MTT
assay.
3.3 Results
3.3.1 Large Scale Manual Extraction vs. Speed Extractor
In order to proceed with further investigation into the potent growth inhibitory effect
shown by E2 (50% methanol) in Chapter 2, it was first necessary to perform a large-scale
extraction of the crude material. Seven hundred and fifty grams of powdered E. tinctorium
80

was extracted manually, as per the protocols in Table 9 – Chapter 2. A second extraction was
also performed using a BÜCHI Speed Extractor® E916 and the protocols are laid out in
Chapter 2. An MTT assay was then setup using E2 from both the large-scale manual
extraction, as well as E2 obtained from the speed extractor. The results can be seen in Figure
35. Both methods showed that E2, extracted using both methods, possess potent growth
inhibitory effect in human HeLa cells. Because the speed extractor has very limited capacity,
it is ideal for initial mushroom screening. However, when a large amount of material is
required, a manual extraction is necessary and was used here.

Figure 34. Growth-inhibitory effect of methanol extracts from E. tinctorium. Powdered E.
tinctorium was extracted using the manual and speed extraction methods in methanol. Both
methods had relatively similar effect on cell growth inhibition at 1 mg/mL. Errors bars are
S.E.M.

81

3.3.2 Size Exclusion Chromatography and BCA Assay
Sephadex LH-20 was mixed with ddH2O and left to swell overnight. It was then
poured into a 2 mL column, packed using gravity for several hours. Fraction 2 (50%
methanol) was dissolved in water at a concentration of 40 mg/mL. Forty microliters of
solution was added to the column. The column was eluted using ddH2O and 10 fractions
were collected at 600 μL each. Fractions were sterilized using 0.2 μm filters. A 48 h MTT
was setup in which 100 μL of each collection fraction was added to 100 μL of HeLa cells, at
a density of 1500 cells per well. Fractions 2 and 3 had extremely potent growth-inhibitory
effect on HeLa cells (Figure 35). The remaining fractions were still able to reduce cell
viability by 20% as compared to their controls.

82

Figure 35. Trial 1 - Assessing growth-inhibitory activity of fractions collected from
Sephadex LH-20. Methanol extracts from E. tinctorium were dissolved in water at 40 mg/ml
and run on a 2 ml gravity Sephadex LH-20 column. Fractions collected were assessed for
growth-inhibitory activity using the MTT assay. *P < 0.05, **P < 0.01 versus control. Error
bars are S.E.M.
A second experiment was performed in order to verify the results shown in Figure 35.
Forty microliters of crude extract were loaded onto the LH-20 column and fractions were
collected at 600 μL. However, in this MTT experiment, 0.5 and 1.0 mg/mL of 50% methanol
(crude) extracted material was also assayed, in order to compare the growth inhibitor effect
of LH-20 purified sample versus crude extract. The results can be seen in Figure 36. While
the second fraction still maintained a very high ability to inhibit HeLa cell growth, it was
nowhere near as powerful as an effect as seen from the initial purification. Unpurified
material had a much greater effect on cell growth (Figure 36).
83

Figure 36. Trial 2 - Assessing fractions collected from Sephadex LH20 for growth-inhibitory
activity. Methanol extracts from E, tinctorium was loaded onto Sephadex LH20 column.
Samples were collected at 600 μL volumes and were then subjected to a 48 h MTT assay.
Crude extract, E2, was also assayed in order to compare the effectiveness of the purification
process. P < 0.05, **P < 0.01 versus control. Error bars are S.E.M.

Since the results of the two experiments were quite different, with respect to the
potency of the E2 fraction, a third LH-20 column was run. Crude extract was added to the
column at a 3% load (60 μL). A 48 h MTT assay was run using all 10 collected fractions
(Figure 37). The results were very similar to those of Figure 36, with F2 reducing cell
viability approximately 40-45 % in both assays.

84

Figure 37. Trial 3 - Assessing fractions collected from Sephadex LH20 for growth-inhibitory
activity. Methanol extracts from E. tinctorium was loaded onto Sephadex LH20 column and
fractions collected at 600 μL volumes were subjected to a 48 h MTT assay. P < 0.05, **P <
0.01 versus control. Error bars are S.E.M.

A fourth and final 2 mL LH-20 column was run, again using a 3% load (60 μL). Ten
fractions were collected, filter sterilized and analyzed with a 48 h MTT assay (Figure 38).
Fraction 2 had very similar results to those shown in Figure 36 and in Figure 37. In all three
cases, Fraction 2 was able to reduce HeLa cell viability by approximately 40% in MTT
assays. In all 2 mL LH-20 purifications, Fraction 3 also had significant (Student t test)
growth inhibitory effects, except for in Figure 36.

85

Figure 38. Trial 4 - Assessing fractions collected from Sephadex LH20 for growth-inhibitory
activity. Methanol extracts from E. tinctorium was loaded onto Sephadex LH20 column and
fractions collected at 600 μL volumes were subjected to a 48 h MTT assay. P < 0.05, **P <
0.01 versus control. Error bars are S.E.M.

A BCA assay was then performed using the fractions collected in Figure 38 as per the
protocols outlined in section 3.2.4. A standard curve was then constructed using the values
from the BCA assay (Figure 39). Extrapolated data was then graphed alongside the MTT
data from Figure 38 (Figure 40) below. A strong regression value of 0.9966 was obtained.
Fraction 2 had the highest growth inhibitory effect but did not have the highest protein
content.

86

2.5

y = 0.9603x + 0.1577
R² = 0.9966

Absorbance at 562 nm

2

Linear (Standard
Concentrations)

1.5

1

0.5

0

0

0.5
1
1.5
2
BSA Concentrations (mg/mL)

2.5

Figure 39. BCA assay using fractions collected from a 2 mL LH-20 column. Standards and
samples were run in triplicate. A strong regression value of 0.9966 was obtained.

87

0.16
0.14

100

0.12
0.1

80

0.08

60

0.06
0.04

40

0.02
0

20
0

-0.02
F1

F2

F3

F4

F5

F6

F7

F8

-0.04

Protein Concentration (mg / ml)

Cell Viability (% Control)

120

Cell Viability (%
Control)
Protein
Concentration
(mg / ml)

Fraction number

Echinodontium tinctorium fractions purified via
2 mL LH-20 size exclusion column.

Figure 40. BCA assay and MTT assay using the same eluted fractions from a 2 mL LH-20
column. Fraction 2 had the highest cell growth inhibition activity while fraction 3 had the
highest protein content.

Next, a 25 mL serological pipette was cut down, packed with cotton, and used to
fashion a 10 mL LH-20 column. Two hundred microliters of crude E2 (50% methanol)
fraction were added to the column and fractions were eluted at a volume of 1 mL. Fractions
were then assayed for growth inhibitory properties using a 48 h MTT assay. Additionally, a
P.C.I. extraction was also performed in an attempt to remove protein from crude fraction of

88

E2. Unfortunately, there were small amounts of phenol remaining in the aqueous layer and it
caused toxicity, killing all of the cells in both the phenol extraction and the phenol control.
Crude E2 methanol extract was also assayed and retained its potent cell growth inhibitory
effect. In this assay, F4-F6 collected from the Sephadex LH-20 column have a significant
reduction in cell viability. Fractions 9-11 also showed a significant reduction in cell viability
(Figure 41).

Figure 41. Assessing fractions collected from Sephadex LH-20 for growth-inhibitory activity.
Methanol extracts from E. tinctorium were loaded onto a 10 mL Sephadex LH-20 column.
Fractions collected at 1 mL volumes were subjected to a 48 h MTT assay. One biological
replicate and 6 technical replicates were used. A 2% load was added to the LH-20 column. A
phenol extraction was also performed to remove protein. P < 0.05, **P < 0.01 versus control.
Error bars are S.E.M.

89

After suspected bimodal activity was seen using a 10 mL column, another 25 mL
serological pipette was cut down, packed with cotton, and used to fashion a 18 mL LH-20
column. Three hundred and sixty microliters of crude fraction 2 was loaded onto the column
and fractions were collected at a volume of 1.5 mL. Fractions were then analyzed using a 48h
MTT assay, in which 100 μL of LH-20 purified fraction was added to 100 μL of cells.
Fractions 5-6 had very potent cell growth inhibitory effects as did F11. To assess the possible
role of proteins, the crude E2 methanol fraction (0.5 mg/mL) was heated to 95 °C for 1 h in
an attempt to denature protein. As shown in Figure 42, both the heated and unheated samples
had a very similar effect on cell viability.

Figure 42. Assessing the post-Sephadex LH-20 fractions for growth-inhibitory activity.
Methanol extracts from E. tinctorium was loaded at 2% onto an 18 mL Sephadex LH-20
column. Fractions collected at 1.5 mL volumes were subjected to a 48 h MTT assay. One
biological replicate and 6 technical replicates were used. Crude extract was heated at 95 °C
for 1 h and tested alongside a non-heated sample. P < 0.05, **P < 0.01 versus control. Error
bars are S.E.M.
90

A second 18 mL LH-20 column was run, again using 360 μL of crude fraction 2 (50%
methanol). Fractions were collected at 1.5 mL and then assayed using a 48 h MTT. This time,
F5 did not have near the same effect on cell growth (Figure 43). However, fraction 11
retained very similar activity as that seen in the previous MTT assay.

Figure 43. Assessing the post-Sephadex LH-20 fractions for growth-inhibitory activity.
Methanol extracts from E. tinctorium was loaded at 2% onto an 18 mL Sephadex LH-20
column. Fractions collected at 1.5 mL volumes were subjected to a 48 h MTT assay. One
biological replicate and 6 technical replicates were used. P < 0.05, **P < 0.01 versus control.
Error bars are S.E.M.

Next, another BCA assay was performed using fractions collected from the MTT
assay shown in Figure 42. The standard curve can be seen in Figure 44. A strong regression
value of 0.9952 was obtained. Extrapolated data was then graphed against the MTT data
from Figure 42. The highest protein content was seen in fractions 7 and 10 whereas the
highest cell growth inhibitory effect was seen in fractions 5, 6 and 11 (Figure 45).

91

2.5

Absorbance 562 nm

2
y = 1.0481x + 0.1497
R² = 0.9954

1.5

1

0.5

0

0

0.5

1

1.5

2

2.5

Protein Concentration mg / ml
Figure 44. BCA assay using fractions collected from an 18 mL LH-20 column. Standards and
samples were run in triplicate. A strong regression value of 0.9954 was obtained.

92

Cell Viability (% Control)

120

Protein Concentration mg/mL 1.2

1

100

0.8

80

0.6

60

0.4

40

0.2

20
0

0
F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12 F13 F14 F15

-0.2

Protein Concentration (mg / ml)

Cell Viability (% Control)

Post LH-20 Fractions MTT data and BCA Assay

Figure 45. BCA assay and MTT assay using eluted fractions from an 18 mL LH-20 column.
Fractions 5, 6 and 11 had the highest cell growth inhibition activity while fractions 7 and 10
had the highest protein content. This assay was run twice.

93

3.3.3 Total Carbohydrate Assay (Hot H2SO4)
A total carbohydrate assay was run using fractions collected from an 18 mL LH-20
column, shown in Figure 42. This assay had to be run twice as initially the carbohydrate
content in the stock LH-20 fractions was far too high to be read on the Synergy2 plate reader.
Samples were diluted by 50% (15 μL of LH-20 purified fraction) and the assay was run
again. The trend line can be seen in Figure 46.

2.5

y = 0.0918x + 0.0952
R² = 0.9961

OD 490 nm

2

OD 490 nm
Linear (OD 490 nm)

1.5
1
0.5
0

0

5

10

15

20

25

Glucose Concentration MicroGrams

Figure 46. Linear trend line calculated from glucose standards created from Total
Carbohydrate Kit. A strong regression value of 0.9961 was achieved.

The total carbohydate results were then graphed alongside the MTT data from Figure
42 (18 mL LH-20 Column). Fraction 5 had the highest total carbohydrate content and
fraction 11 had next to no carbohydrate content – even though it had strong cell growth
inhibitory effects as shown in an MTT assay (Figure 47). These results were consistent with

94

the first total carbohydrate assay performed, other than the first peak, over fraction 5, was out
of bounds.

Total Carbohydrate Content

120

800
700

100

600
80

500

60

400
300

40

200
20
0

Total Carbohydrate Content (μg)

Cell Viability (% Control)

Cell Viability (% Control)

100

F3

F4

F5

F6

F7

F8

F9

F10

F11

F12

F13

0

Post LH-20 Fractions MTT data and CHO Assay

Figure 47. Growth-inhibitory activity and carbohydrate content of fractions collected from an
18 mL Sephadex LH-20 column. Fractions were analyzed using MTT assay and were also
assayed with a total carbohydrate kit. Fraction 5 had the highest carbohydrate content while
fraction 11 had next to none. The carbohydrate kit was run twice and samples / standards
were run in triplicate. MTT samples were run with one biological replicate and 6 technical
replicates.

3.3.4 Glycoprotein Carbohydrate Estimation Kit
This kit was originally run using the maximum volume of LH-20 purified fraction, 50
μL. This turned out to be far too much as many of the fractions had a greater glycoprotein
concentration than the Synergy2 plate reader could read. The assay was run a second time,
95

with a 4x sample dilution (12.5 μL per fraction) and the trend line can be seen in Figure 48.
Samples and standards were run in triplicate.

7

OD 550 nm

6
5

y = 0.1395x + 0.3453
R² = 0.9523

4
3
2
1
0

0

5

10

15

20

25

30

35

40

45

50

Glycoprotein Concentration mg/mL

Figure 48. Linear trend line calculated from glycoprotein standards created from a
glycoprotein estimation kit. A regression value of 0.9523 was achieved.

Data extrapolated from the trend line was used to calculate glycoprotein content in
mg/mL and was then graphed alongside the MTT data from Figure 42 – an 18 mL LH-20
column. Fractions 5 and 8 had the highest glycoprotein content, while fraction 11 had only
4.2 mg/mL. Fractions 5 and 11 had the highest growth inhibitory effect in the corresponding
MTT assay (Figure 49).

96

Glycoprotein Content

14

100

12

80

10

60

8
6

40

4

20
0

16

2
0

Glycoprotein Content (mg/mL)

MTT Assay

F1
F2
F3
F4
F5
F6
F7
F8
F9
F10
F11
F12
F13
F14
F15
F16
F17

Cell Viability (% Control)

120

Post LH-20 Fractions. MTT and Total Glycoprotein Content

Figure 49. Growth-inhibitory activity and glycoprotein content of fractions collected from
Sephadex LH-20 column. Fractions were analyzed using MTT assay and were also assayed
with a glycoprotein estimation kit. Fraction 5 and fraction 8 had the highest glycoprotein
content while fraction 11 had very little. The glycoprotein assay was run twice and samples /
standards were run in triplicate. MTT samples were run with one biological replicate and 6
technical replicates.

3.3.5 C16/70 LH-20 Column (100 mL)
In order to collect enough materials for further investigation, possibly by an
undergraduate research student, Mr Faran Rashid, a larger column was required. A C16/70
column was therefore packed to a bed volume of 100 mL, at 2 m /minute. Crude fraction 2,
obtained from E. tinctorium, was dissolved in water at a concentration of 50 mg/mL. Two
milliliters of sample was then loaded onto the column and eluted at 1 mL per minute and
collected in 10 mL fractions. After some time, two bands could be seen moving down the
column (Figure 50).

97

Figure 50. 100 mL LH-20 column purifying crude E2 extract from E. tinctorium. The column
is being run with water. Two bands can be seen in the 4th picture (see arrows).

The C16/70 column was used to purify crude Fraction 2 for two runs, at 2 mL each
(Figure 51). The first attempt had high cell growth inhibitory effect on fractions 4, 5 and
fraction 10. As indicated earlier, the second run was performed in order to provide more
sample to an undergraduate research student to further analyze fraction 10 (Figure 52).

98

Figure 51. Assessing the post-Sephadex LH-20 fractions for growth-inhibitory activity.
Methanol extracts from E. tinctorium was loaded at 2% onto a 100 mL Sephadex LH-20
column. Fractions collected at 10 mL volumes were subjected to a 48 h MTT assay. One
biological replicate and 4 technical replicates were used. P < 0.05, **P < 0.01 versus control.
Error bars are S.E.M.

99

Figure 52. Assessing the post-Sephadex LH-20 fractions for growth-inhibitory activity.
Methanol extracts from E. tinctorium was loaded at 2% onto a 100 mL Sephadex LH-20
column. Fractions collected at 10 mL volumes were subjected to a 48 h MTT assay. One
biological replicate and 4 technical replicates were used. P < 0.05, **P < 0.01 versus control.
Error bars are S.E.M.

100

3.3.6 Assessment of the Post-Sephadex LH-20 Fractions for Growth-Inhibitory Activity
using Different Cancer Cell Lines.

Post-Sephadex LH-20 fraction 10, purified from crude methanol extract from E.
tinctorium, was assessed for growth inhibitory effect using variety of cancer cell lines. The
following cell lines were used in a 48 hour MTT assay: HCT116 – Human Colon Cancer,
H441 – Human Lung Cancer, HeLa – Human Cervical Cancer, HepG2 – Human Liver
Cancer, MCF-7 – Human Breast Cancer and SKOV3 – Human Ovarian Cancer. The results
can be seen in Figures 53 and 54.

Figure 53. Assessing the post-Sephadex LH-20 Fraction 10 for growth-inhibitory activity,
using various cancer cell lines, in a 48 h MTT assay. Fraction 10 had the most potent effect
on HeLa and HCT116. Fraction 10 reduced cell viability of H441 by over 60%. One
biological replicate and 3 technical replicates were used.

101

Figure 54. Assessing the post-Sephadex LH-20 Fraction 10 for growth-inhibitory activity,
using various cancer cell lines, in a 48 h MTT assay. Fraction 10 had the post potent effect on
MCF-7. However, fraction 10 reduced cell viability of both SKOV3 and MCF-7 by
approximately 70%. One biological replicate and 3 technical replicates were used.

Fraction 10, purified using a C16/70 Column, had an extremely potent effect on all of
the cell lines assayed. The most potent cell inhibitory effect can be seen with HeLa cells,
however, in all cases, cell viability is reduced by a minimum of 60% to a maximum of 90%
with Hela cells. All cell lines assayed in Figure 54 had very similar dose dependent graph
line.

102

3.4 Discussion
With every size exclusion column run, the first active compound had a very high
growth inhibitory effect during the first run of a freshly packed column, then the next run
would have a highly reduced effect on cell viability (Figures 35-38). It appeared as though
something was clogging up the column. After the initial run, the column was flushed with
50% methanol, which cleared out the pigmentation. However, that had little effect on
clearing out the column. Once the purification process was moved to a larger column, 10 mL
and higher, it was found that there appeared to be two active compounds. The first activity
eluted in the void volume, which would put it larger than 4-5 kDa, and another activity being
eluted in fractions 10 or 11. The second activity had potent cell growth inhibitory effect on
HeLa cells and had no issues being eluted on a column after the first run (Figures 41-43).
This was also the case when we moved to a larger C16/70 column, with a 100 mL Sephadex
LH-20 bed volume (Figure 51-52). For this reason, it was decided to pursue the compound(s)
in fraction 10 as they were less difficult to purify using size exclusion chromatography.
Protein concentration did not necessarily correlate with the largest growth inhibitory
effect. For example, fraction 2 had the highest effect on cell viability but fraction 7 had the
highest protein content (Figure 40). A BCA assay run using fractions eluted from a larger
column (18 mL) showed a similar trend. Fraction 5 had the highest growth inhibitory effect
while fraction 7 had the largest protein content. Additionally, when the crude methanol
fraction was heated at 95 °C for 1 h, it had little effect on growth inhibitory effects (Figure
41). Heating the sample at that temperature for that amount of time should have denatured
most proteins, and as such, it is unlikely that the active compound(s) contain protein
component.
103

Assessment of the total carbohydrate content revealed interesting insights. Fractions
5, 6 and 11 had the highest growth inhibitory effect while fraction 5 had the highest
carbohydrate content, suggesting that the growth-inhibitory activity in fraction 5 may contain
carbohydrate component. Fraction 11 had next to no carbohydrate content but had a potent
effect on cell viability as shown in an MTT assay (Figure 47), suggesting that the growthinhibitory compound(s) in fraction 11 does not contain carbohydrate. The results in
estimating the glycoprotein content of post-Sephadex LH-20 fractions supported the above
findings: that is, fractions 5 and 7 had the highest glycoprotein content, while fraction 5 and
10 had the highest cell inhibitory effect on HeLa cells. This provided further support that the
growth-inhibitory compound(s) in fraction 5, but not fraction 10, contains carbohydrate
component.
Although this study has not led to the complete purification and identification of the
growth-inhibitory compound(s), I have shown for the first time that Echinodontium
tinctorium has potent growth-inhibitory compounds. I have also shown for the first time that
Sephadex LH-20 purified fraction 10 has a potent growth inhibitory effect on other cell lines,
such as H441, HCT116, HepG2, MCF-7 and SKOV3. The larger molecular weight growthinhibitory compound(s) collected in fraction 5 mostly likely contains carbohydrate. In
contrast, the smaller molecular weight growth-inhibitory compound(s) collected in fraction
10 is likely a small molecule because it does not contain protein or carbohydrate. Given these
exciting findings, it is clear that there remains much work and investigation to be completed
for this particular project but we hope that these insights but provide momentum for the next
group of investigators.

104

Chapter 4 - General Discussion
At the outset of this research, it was hypothesized that wild mushrooms in Northern
British Columbia contain compounds with potent bio-activities. The results from this study
showed for the first time that indeed Northern BC is home to a large variety of mushrooms
containing potent growth inhibitory compounds97. The extraction methods developed and
adapted (using both the manual and speed extractor) during this study have laid the critical
foundation for future mushroom research studies at UNBC and elsewhere. As the pioneer
graduate student of this project, I had the opportunity to explore mushrooms and optimize the
processing (from collection to powder) and extraction techniques, ranging from small scale
soxhlet extractions using a few grams of material, to large scale extractions using close to 1
kilogram of starting materials. Furthermore, specifications for the growth-inhibitory MTT
assays using different concentration mushroom extracts and the incubation time, for both
dose- and time dependent experiments, have also been essential for the progression of this
project. The crude fractions extracted from 9 samples of B.C wild mushrooms will also
continue to be further investigated for immuno-stimulatory and anti-inflammatory properties
by other research students at UNBC97.

4.1 Screening BC wild mushrooms for growth-inhibitory activity

Fomitopsis pinicola, perhaps the most potent mushroom investigated, can be found
growing abundantly throughout area surrounding UNBC. Because of the extensive research
previously conducted on this specimen, it was not investigated further. However, its potent

105

growth inhibitory effect on HeLa cell viability, was used as a positive control in optimizing
MTT assay and hence in further advancing this project.
Due to its copious use in herbal medicine, it was not surprising that compound(s)
extracted from Lentinula edodes (Shiitake) had potent growth-inhibitory effect on HeLa
cells. Since extractions conducted at both reflux and 50 °C temperatures had a similar effect
on HeLa cell viability, it was decided to use 65 °C for future extractions. The temperature of
65°C was chosen because: (i) it is between 50°C and reflux temperature, (ii) many
mushrooms were extracted at reflux temperature , and (iii) it is a convenient and manageable
temperature for use during manual extraction and with the speed extractor.
Some mushrooms species, such as Piptoporus betulinus, were shown to have activity
for the first time. In the case of P. betulinus, E1 (ethanol) extract was demonstrated to have
potent cell growth inhibitory properties at doses as little as 0.1 mg/mL. Similarly, compounds
extracted using ethanol from Ganoderma applanatum, were shown for the first time to have
cell growth inhibitory effects; additionally, water extracted compounds were also shown to
have an effect on cell viability. This is corroborated by previous research.
4.2 An attempt to purify the growth-inhibitory compound from Echinodontium tinctorium
Undoudtedly, the most exciting species investigated was Echinodontium tinctorium.
We were able to show for the first time, that ethanol extractions from E. tinctorium possess
potent growth inhibitory properties in HeLa cells, in a dose dependent and time dependent
manner. Furthermore, since virtually no previous research has been conducted on this
species, it was determined to be a novel species for further investigation.

106

Size exclusion chromatography by use of Sephadex LH-20 initially indicated that one
fraction contained the majority of the growth inhibitory compounds. After a column was used
once, it seemed to clog up, and the growth inhibitory effect of fractions collected from the
second run was greatly reduced. Methanol was used to rinse the column, which cleared the
staining caused by crude E2 (50% methanol) fraction, but this had no consequence on
capturing the same level of growth inhibitory effect as seen on compounds obtained from a
‘first run’ on a fresh column.
Once the column size was increased from 2 mL to 10 mL, growth-inhibitory activity
could clearly be seen in two different fractions (bimodal graphs); the first presumably eluting
in the void volume and a second eluting in later fractions, with fractions in between having
little to no activity as shown in MTT assays. This was also the case when the column size
was increased to 18 mL and eventually 100 mL – two discrete fractions were shown to
possess potent growth inhibitory compound(s).
Post-Sephadex LH-20 fractions were assayed for protein, total carbohydrate and
glycoprotein contents. Fraction 5 had the highest effect on cell viability and also contained a
large protein component. The growth-inhibitory effect of fraction 5 correlated strongly with
both carbohydrate and glycoprotein content, suggesting that growth-inhibitory compound(s)
in fraction 5 has a carbohydrate component. Fraction 10 also had high cell growth inhibitory
effect. Given that the growth-inhibitory effect of fraction 10 did not correlate with either
protein, carbohydrate or glycoprotein contents, suggest that it is likely to be a small
molecule. Additionally, crude fraction 2 (50% methanol) was heated to high temperatures for
over an hour and still retained potent cell growth inhibitory properties.

107

4.3 Future Directions and Conclusions
Based on the growth-inhibitory screening studies that I have performed on BC wild
mushrooms, one can now proceed in choosing a mushroom fraction which is novel for
further purification and identification of the responsible growth-inhibitory compound(s).
Although I was unable to further purify and identify the small molecule growth-inhibitory
compound(s) from E. tinctorium, I was able to show for the first time that extracts from E.
tinctorium are also capable of drastically reducing cell viability in other human cancer lines
in addition to human cervical cancer HeLa cells. Protocols and assay optimizations solidified
by this project has also laid the foundation for future investigation into the assessment of B.C
wild mushrooms for new and natural anti-cancer compounds.

108

References
1. Halpern G. Healing mushrooms. Effective treatments for today’s illnesses. 2007:192.
2. Dias ES, Abe C, Schwan RF. Truths and myths about the mushroom Agaricus blazei.
Scientia Agricola. 2004;61(5):545–549.
3. Chang ST (Shu-ting), Quimio TH, Regional Workshop on the Cultivation of Edible
Mushrooms in the Tropics (1980 : Manila P. Tropical mushrooms : biological nature and
cultivation methods. Chinese University Press; 1982. 493 p.
4. Wasson G. The Wondrous Mushroom: Mycolatry in Mesoamerica. McGraw-Hill; 1980.
248 p.
5. Akgul NB, Basaran P, Sidhu JS. Mushrooms in the Middle Eastern Diet. In: Hui YH,
editor. Handbook of Fruit and Vegetable Flavors. John Wiley & Sons, Inc.; 2010. p. 889–
908.
6. Mushrooms M. An Exploration of Tradition, Healing and Culture. 7th ed. Botanica Press;
1995. 264 p.
7. Smith J, Rowen N, Sullivan R. Medicinal Mushrooms: Their therapeutic properties and
current medical usage with special emphasis on cancer treatments. Cancer Research UK.
2002;(May):4–33, 47–51.
8. Paterson RRM. Ganoderma - A therapeutic fungal biofactory. Phytochemistry.
2006;67(18):1985–2001.
9. Zhu M, Chang Q, Wong LK, Chong FS, Li RC. Triterpene antioxidants from Ganoderma
lucidum. Phytotherapy Research. 1999;13(6):529–531.
10. Eo S-K, Kim Y-S, Lee C-K, Han S-S. Antiviral activities of various water and methanol
soluble substances isolated from Ganoderma lucidum. Journal of Ethnopharmacology.
1999;68(1–3):129–136.
11. Lakshmi B, Ajith TA, Sheena N, Gunapalan N, Janardhanan KK. Antiperoxidative, antiinflammatory, and antimutagenic activities of ethanol extract of the mycelium of Ganoderma
lucidum occurring in South India. Teratogenesis, Carcinogenesis, and Mutagenesis.
2003;23(S1):85–97.
12. Hong KJ, Dunn DM, Shen CL, Pence BC. Effects of Ganoderma lucidum on apoptotic
and anti-inflammatory function in HT-29 human colonic carcinoma cells. Phytotherapy
Research. 2004;18(9):768–770.
13. Tang W, Liu JW, Zhao WM, Wei DZ, Zhong JJ. Ganoderic acid T from Ganoderma
lucidum mycelia induces mitochondria mediated apoptosis in lung cancer cells. Life
Sciences. 2006;80(3):205–211.
14. Xie JT, Wang CZ, Wicks S, Yin JJ, Kong J, Li J, Li YC, Yuan CS. Ganoderma lucidum
extract inhibits proliferation of SW 480 human colorectal cancer cells. Experimental
Oncology. 2006;28(1):25–29.
109

15. Slivova V, Valachovicova T, Jiang J, Sliva D. Ganoderma lucidum inhibits invasiveness
of breast cancer cell. Journal of Cancer Integrative Medicine. 2004;2:8.
16. Gao Y, Zhou S, Jiang W, Huang M, Dai X. Effects of Ganopoly ® (a Ganoderma
lucidum polysaccharide extract) on the immune functions in advanced-stage cancer patients.
Immunological Investigations. 2003;32(3):201–215.
17. Chang J, Park W, Choi E, Kim B. Studies on constituents of the higher fungi of Korea
(LIV) antitumor components of Favolus alveolarius. Archives of Pharmacal Research. 1988.
18. Chung KS, Choi EC, Kim BK, Kim YS, Park YH. Studies on the constituents and culture
of Korean basidiomycetes - Antitumor polysaccharides from the cultured mycelia of some
basidiomycetes. Archives of Pharmacal Research. 1982;5(1):17–19.
19. Moradali MF, Mostafavi H, Ghods S, Hedjaroude GA. Immunomodulating and
anticancer agents in the realm of macromycetes fungi (macrofungi). International
Immunopharmacology. 2007;7(6):701–724.
20. K. J. Shittake the healing mushroom. 1st ed. Healing Arts Press; 2000. 128 p.
21. Fang N, Li Q, Yu S, Zhang J, He L, Ronis MJJ, Badger TM. Inhibition of growth and
induction of apoptosis in human cancer cell lines by an ethyl acetate fraction from shiitake
mushrooms. The Journal of Alternative and Complementary Medicine. 2006;12(2):125–132.
22. Sia GM, Candlish JK. Effects of shiitake (Lentinus edodes) extract on human neutrophils
and the U937 monocytic cell line. Phytotherapy Research. 1999;13(2):133–137.
23. Avinash J, Vinay S, Jha K, Das D, Goutham B, Kumar G. The unexplored anticaries
potential of shiitake mushroom. Pharmacognosy Reviews. 2016;10(20):100.
24. Ina K, Kataoka T, Ando T. The use of lentinan for treating gastric cancer. Anti-cancer
agents in medicinal chemistry. 2013;13(5):681–8.
25. Hirasawa M, Shouji N, Neta T, Fukushima K, Takada K. Three kinds of antibacterial
substances from Lentinus edodes (Berk.) Sing. (Shiitake, an edible mushroom). International
Journal of Antimicrobial Agents. 1999;11(2):151–157.
26. Bisen P, Baghel R, Sanodiya B, Thakur GS, Prasad GBKS. Lentinus edodes: A
Macrofungus with Pharmacological Activities. Current Medicinal Chemistry.
2010;17(22):2419–2430.
27. Ng J, Yang C. Effect of Mushrooms on Dental Caries. J. Pharm. Sci. & Res.
2013;5(12):284–286.
28. Fisher M, Yang L-X. Anticancer effects and mechanisms of polysaccharide-K (PSK):
implications of cancer immunotherapy. Anticancer research. 2002;22(3):1737–1754.
29. Nio Y, Tsubono M, Tseng C-C, Morimoto H, Kawabata K, Masai Y, Shiraishi T, Imai S,
Ohgaki K, Tobe T. Immunomodulation by orally administered protein-bound polysaccharide
PSK in patients with gastrointestinal cancer. Biotherapy. 1992;4(2):117–128.
30. Price LA, Wenner CA, Sloper DT, Slaton JW, Novack JP. Role for toll-like receptor 4 in
TNF-alpha secretion by murine macrophages in response to polysaccharide Krestin, a
110

Trametes versicolor mushroom extract. Fitoterapia. 2010;81(7):914–919.
31. Hyun KW, Jeong SC, Lee DH, Park JS, Lee JS. Isolation and characterization of a novel
platelet aggregation inhibitory peptide from the medicinal mushroom, Inonotus obliquus.
Peptides. 2006;27(6):1173–1178.
32. Van Q, Nayak BN, Reimer M, Jones PJH, Fulcher RG, Rempel CB. Anti-inflammatory
effect of Inonotus obliquus, Polygala senega L., and Viburnum trilobum in a cell screening
assay. Journal of Ethnopharmacology. 2009;125(3):487–493.
33. Mullauer FB, Kessler JH, Medema JP. Betulinic acid, a natural compound with potent
anticancer effects. Anti-cancer drugs. 2010;21(3):215–227.
34. Reshetnikov S V., Tan K-K. Higher Basidiomycota as a Source of Antitumor and
Immunostimulating Polysaccharides (Review). International Journal of Medicinal
Mushrooms. 2001;3(4):361–394.
35. Wasser S. Medicinal mushrooms as a source of antitumor and immunomodulating
polysaccharides. Applied Microbiology and Biotechnology. 2003;60(3):258–274.
36. Ooi VEC, Liu F. Immunomodulation and Anti-Cancer Activity of PolysaccharideProtein Complexes. Current Medicinal Chemistry. 2000;7:715–729.
37. Ng M-L, Yap A-T. Inhibition of human colon carcinoma development by lentinan from
shiitake mushrooms (Lentinus edodes). Journal of alternative and complementary medicine
(New York, N.Y.). 2002;8(5):581–589.
38. Lavi I, Friesem D, Geresh S, Hadar Y, Schwartz B. An aqueous polysaccharide extract
from the edible mushroom Pleurotus ostreatus induces anti-proliferative and pro-apoptotic
effects on HT-29 colon cancer cells. Cancer Letters. 2006;244(1):61–70.
39. The macrofungi of British Columbia. 2012 [accessed 2012 Jan 1].
http://www.geog.ubc.ca/biodiversity/eflora/fungi.html.
40. Ferreira IC, Vaz J. Compounds from wild mushrooms with antitumor potential. AntiCancer Agents in. 2010:424–36.
41. Zaidman B-Z, Yassin M, Mahajna J, Wasser SP. Medicinal mushroom modulators of
molecular targets as cancer therapeutics. Applied Microbiology and Biotechnology.
2005;67(4):453–468.
42. Patrick Poucheret. Biological and Pharmacological Activity of Higher Fungi: 20-Year
Retrospective Analysis. Cryptogamie, Mycologie,. 2006;27(4):311–333.
43. Lindequist U, Niedermeyer THJ, Jülich WD. The pharmacological potential of
mushrooms. Evidence-based Complementary and Alternative Medicine. 2005;2(3):285–299.
44. Adachi, Yoshiyuki; Okazaki, Mitsuhiro; Ohno, Naohito; Yadomae T. Enhancement of
Cytokine Production by Macrophages Stimulated with (1-3)-B-D-Glucan, Grifolan (GRN),
Isolated from Grifola frondosa. Pharmaceutical Society of Japan. 1994;17(12):1554–1560.
45. Matsuo T, Arika T, Mitani M, Komatsu N. Pharmacological and toxicological studies of
a new antitumor polysaccharide, schizophyllan. Arzneimittel-Forschung. 1982;32(6):647–56.
111

46. Muto S, Kobayashi A, Ohara M, Matsunaga K. Structure and anti-tumor effect of PSK
(krestin): Mechanistic aspects of the anti-tumor activity. International Journal of.
1982;4(4):308.
47. Chan GC-F, Chan WK, Sze DM-Y. The effects of beta-glucan on human immune and
cancer cells. Journal of hematology & oncology. 2009;2(1):25.
48. Smith JE, Rowan NJ, Sullivan R. Medicinal mushrooms: A rapidly developing area of
biotechnology for cancer therapy and other bioactivities. Biotechnology Letters.
2002;24(22):1839–1845.
49. Manzi P, Pizzoferrato L. Beta-glucans in edible mushrooms. Food Chemistry.
2000;68(3):315–318.
50. Brown GD, Gordon S. Immune recognition: A new receptor for β-glucans. Nature.
2001;413(6851):36–37.
51. Brown GD, Taylor PR, Reid DM, Willment JA, Williams DL, Martinez-Pomares L,
Wong SYC, Gordon S. Dectin-1 Is A Major β-Glucan Receptor On Macrophages. The
Journal of Experimental Medicine. 2002;196(3):407–412.
52. Zhang Y, Kong H, Fang Y, Nishinari K, Phillips GO. Schizophyllan: A review on its
structure, properties, bioactivities and recent developments. Bioactive Carbohydrates and
Dietary Fibre. 2013;1(1):53–71.
53. Yang G. Inhibition of growth and induction of apoptosis in human cancer cell lines by tea
polyphenols. Carcinogenesis. 1998;19(4):611–616.
54. Han B, Toyomasu T, Shinozawa T. Induction of apoptosis in cultured cells by extracts
from shiitake (Lentinula edodes) mycelial culture broth. Mycoscience. 2000;41(6):623–631.
55. PowerSoil DNA Isolation Kit. 2017 [accessed 2017 May 9].
https://mobio.com/media/wysiwyg/pdfs/sds/12888-1.pdf
56. Technelysium - DNA Sequencing Software. 2017 [accessed 2017 May 9].
http://technelysium.com.au/wp/
57. Basic Local Alignment Search Tool. 2017 [accessed 2014 Feb 4].
https://blast.ncbi.nlm.nih.gov/Blast.cgi
58. Arora D. Mushrooms demystified : a comprehensive guide to the fleshy fungi. Ten Speed
Press; 1986. 959 p.
59. Mizuno T. The Extraction and Development of Antitumor-Active Polysaccharides from
Medicinal Mushrooms in Japan (Review). International Journal of Medicinal Mushrooms.
1999;1(1):9–29.
60. Lee ML, Tan NH, Fung SY, Tan CS, Ng ST. The antiproliferative activity of sclerotia of
Lignosus rhinocerus (tiger milk mushroom). Evidence-based Complementary and
Alternative Medicine. 2012;2012:1–5.
61. Jedinak A, Dudhgaonkar S, Wu Q-L, Simon J, Sliva D. Anti-inflammatory activity of
edible oyster mushroom is mediated through the inhibition of NF-κB and AP-1 signaling.
112

Nutrition journal. 2011;10(1):52.
62. Phan CW, Wong WL, David P, Naidu M, Sabaratnam V. Pleurotus giganteus (Berk.)
Karunarathna & K.D. Hyde: Nutritional value and in vitro neurite outgrowth activity in rat
pheochromocytoma cells. BMC Complement Altern Med. 2012;12(1):102.
63. Mosmann T. Rapid Colorimetric Assay for Cellular Growth and Survival: Application to
Proliferation and Cytotoxicity Assays. Journal of lmmunological Methods. 1983;65:55–63.
64. Berridge M V., Herst PM, Tan AS. Tetrazolium dyes as tools in cell biology: New
insights into their cellular reduction. Biotechnology Annual Review. 2005;11:127–152.
65. L. Maness L, Sneed N, Hardy B, Yu J, Ahmedna M, Goktepe I. Anti-proliferative effect
of Pleurotus tuberregium against colon and cervical cancer cells. Journal of Medicinal Plants
Research. 2011;5(30):6650–6655.
66. Patel S, Goyal A. Recent developments in mushrooms as anti-cancer therapeutics: a
review. 3 Biotech. 2012;2(1):1–15.
67. MTT Assay. [accessed 2017 May 12]. http://en.wikipedia.org/wiki/File:MTT_Plate.jpg.
68. Finimundy TC, Gambato G, Fontana R, Camassola M, Salvador M, Moura S, Hess J,
Henriques JAP, Dillon AJP, Roesch-Ely M. Aqueous extracts of Lentinula edodes and
Pleurotus sajor-caju exhibit high antioxidant capability and promising in vitro antitumor
activity. Nutrition Research. 2013;33(1):76–84.
69. Kaya M, Akata I, Baran T, Mentes A. Physicochemical Properties of Chitin and Chitosan
Produced from Medicinal Fungus (Fomitopsis pinicola). Food Biophysics. 2014;10(2):162–
168.
70. Keller AC, Maillard MP, Hostettmann K. Antimicrobial steroids from the fungus
Fomitopsis pinicola. Phytochemistry. 1996;41(4):1041–1046.
71. Choi D, Park S-S, Ding J-L, Cha W-S. Effects of Fomitopsis pinicola extracts on
antioxidant and antitumor activities. Biotechnology and Bioprocess Engineering.
2007;12(5):516–524.
72. Cheng J-J, Lin C-Y, Lur H-S, Chen H-P, Lu M-K. Properties and biological functions of
polysaccharides and ethanolic extracts isolated from medicinal fungus, Fomitopsis pinicola.
Process Biochemistry. 2008;43(8):829–834.
73. Carmeliet P. VEGF as a Key Mediator of Angiogenesis in Cancer. Oncology.
2005;69(3):4–10.
74. Kitzberger CSG, Smânia A, Pedrosa RC, Ferreira SRS. Antioxidant and antimicrobial
activities of shiitake (Lentinula edodes) extracts obtained by organic solvents and
supercritical fluids. Journal of Food Engineering. 2007;80(2):631–638.
75. Takehara M, Kuida K, Mori K. Antiviral activity of virus-like particles from Lentinus
edodes (Shiitake). Archives of Virology. 1979;59(3):269–274.
76. Nanba H. Antitumor Mechanisms of Orally Administered Shiitake Fruit Bodies.
Chemical & Pharmaceutical Bulletin. 1987;35(6):2459–2464.
113

77. Wangun HVK, Berg A, Hertel W, Nkengfack AE, Hertweck C. Anti-inflammatory and
anti-hyaluronate lyase activities of lanostanoids from Piptoporus betulinus. The Journal of
antibiotics. 2004;57(11):755–8.
78. Wiater A, Paduch R, Pleszczyńska M, Próchniak K, Choma A, Kandefer-Szerszeń M,
Szczodrak J. α-(1 → 3)-d-Glucans from fruiting bodies of selected macromycetes fungi and
the biological activity of their carboxymethylated products. Biotechnology Letters.
2011;33(4):787–795.
79. Chen W, Zhao Z, Li Y. Simultaneous increase of mycelial biomass and intracellular
polysaccharide from Fomes fomentarius and its biological function of gastric cancer
intervention. Carbohydrate Polymers. 2011;85(2):369–375.
80. Choe J-H, Yi Y-J, Lee M-S, Seo D-W, Yun B-S, Lee S-M. Methyl 9-Oxo-(10E,12E)octadecadienoate isolated from Fomes fomentarius attenuates lipopolysaccharide-induced
inflammatory response by blocking phosphorylation of STAT3 in murine macrophages.
Mycobiology. 2015;43(3):319–326.
81. Jeong YT, Yang BK, Jeong SC, Kim SM, Song CH. Ganoderma applanatum: a
promising mushroom for antitumor and immunomodulating activity. Phytotherapy Research.
2008;22(5):614–619.
82. Sun X, Zhao C, Pan W, Wang J, Wang W. Carboxylate groups play a major role in
antitumor activity of Ganoderma applanatum polysaccharide. Carbohydrate Polymers.
2015;123:283–287.
83. Balandaykin ME, Zmitrovich I V. Review on Chaga Medicinal Mushroom, Inonotus
obliquus (Higher Basidiomycetes): Realm of Medicinal Applications and Approaches on
Estimating its Resource Potential. International Journal of Medicinal Mushrooms.
2015;17(2):95–104.
84. Kang J-H, Jang J-E, Mishra SK, Lee H-J, Nho CW, Shin D, Jin M, Kim MK, Choi C, Oh
SH. Ergosterol peroxide from Chaga mushroom (Inonotus obliquus) exhibits anti-cancer
activity by down-regulation of the β-catenin pathway in colorectal cancer. Journal of
Ethnopharmacology. 2015;173:303–312.
85. Liu C, Zhao C, Pan HH, Kang J, Yu XT, Wang HQ, Li BM, Xie YZ, Chen RY. Chemical
constituents from Inonotus obliquus and their biological activities. Journal of Natural
Products. 2014;77(1):35–41.
86. Fan L, Ding S, Ai L, Deng K. Antitumor and immunomodulatory activity of watersoluble polysaccharide from Inonotus obliquus. Carbohydrate Polymers. 2012;90(2):870–
874.
87. Wang Q, Mu H, Zhang L, Dong D, Zhang W, Duan J. Characterization of two watersoluble lignin metabolites with antiproliferative activities from Inonotus obliquus.
International Journal of Biological Macromolecules. 2015;74:507–514.
88. Turkoglu A, Duru ME, Mercan N, Kivrak I, Gezer K. Antioxidant and antimicrobial
activities of Laetiporus sulphureus (Bull.) Murrill. Food Chemistry. 2006;101(1):267–273.
89. Mlinaric A, Kac J, Pohleven F. Screening of selected wood-damaging fungi for the HIV114

1 reverse transcriptase inhibitors. Acta pharmaceutica (Zagreb, Croatia). 2005;55(1):69–79.
90. Lovy A, Knowles B, Labbe R, Nolan L. Activity of edible mushrooms against the growth
of human T4 leukemic cancer cells, HeLa cervical cancer cells, and Plasmodium falciparum.
Journal of Herbs, Spices and Medicinal Plants. 1999;6(4):49–57.
91. Léon F, Quintana J, Rivera A, Estévez F, Bermejo J. Lanostanoid triterpenes from
Laetiporus sulphureus and apoptosis induction on HL-60 human myeloid leukemia cells.
Journal of Natural Products. 2004;67(12):2008–2011.
92. Li X, Jiao LL, Zhang X, Tian WM, Chen S, Zhang LP. Anti-tumor and
immunomodulating activities of proteoglycans from mycelium of Phellinus nigricans and
culture medium. International Immunopharmacology. 2008;8(6):909–915.
93. Wang Z, Zhou F, Quan Y. Antioxidant and immunological activity in vitro of
polysaccharides from Phellinus nigricans mycelia. International Journal of Biological
Macromolecules. 2014;64:139–143.
94. Sephadex LH-20. [accessed 2017 May 23].
http://www.sigmaaldrich.com/catalog/product/sigma/lh20100?lang=en&region=CA
95. Total Carbohydrate Colorimetric Assay Kit. [accessed 2017 May 23].
http://www.biovision.com/documentation/datasheets/K645.pdf
96. Glycoprotein Estimation Kit. [accessed 2017 May 23].
https://tools.thermofisher.com/content/sfs/manuals/MAN0011353_Glycoprotein_Carb_Est_
UG.pdf
97. Smith A, Javed S, Barad A, Myhre V, Li WM, Reimer K, Massicotte H, Takaberry L,
Payne G, Egger K, et al. Growth-Inhibitory and Immuno-Modulatory Activities of Fungi
from North Central British Columbia. International Journal of Medicinal Mushrooms.
2017;19(6).

115

Appendix
Sequences Derived from DNA Analysis
Piptoporus betulinus
ITS Sequence:
TGCAGATTCAGTGATCATCGATCTTTGACGCACCTTGCGCTCCTTGGTATTCCGA
GGAGCATGCCTGTTTGAGTGTCATGGAATCATCAACTCTATTTACTTTTGTGAAT
AGGGCTTGGACTTGGAGGTTTTGCCGGTACTTGTGATCGGCTCCTCTTGAATGCA
TTAGCTCGAACCTTTGTGGATCAGCTTATCGGTGTGATAATTGTCTACGCCGTTA
CTGTGAAGCATATATTAAAGGGCTCGGCTTCTAATCGTCCTTCACAGGACAATAA
CTTTGACCTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCA
ATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAG
CGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTATGGCCGTCCGAGTTGTAGTC
TGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTC
ATAGAG
NLB Sequence:
CGCGGAAGCACTTCTCCAGACTACAACTCGGACGGCCATAAGACCGCCAGATTT
TAAATTTGAGCTTTTCCCGCTTCACTCGCAGTTACTAGGGGAATCCTTGTTAGTTT
CTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTAATCCTACCTGATTTGA
GGTCAAAGGTCAAAGTTATTGTCCTGTGAAGGACGATTAGAAGCCGAGCCCTTT
AATATATGCTTCACAGTAACGGCGTAGACAATTATCACACCGATAAGCTGATCC
ACAAAGGTTCGAGCTAATGCATTCAAGAGGAGCCGATCACAAGTACCGGCAAAA
CCTCCAAGTCCAAGCCCTATTCACAAAAGTAAATAGAGTTGATGATTCCATGACA
CTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGAT
TCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTCT

Ganoderma applanatum
ITS Sequence:
TCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGASGAG
CATGCCTGTTTGAGTGTCATGAAATCTTCAACCTATAASCTTTTGTGGTTTGTAGG
CTTGGACTTGGAGGCTTGTCGGCCTTGATCGGTCGGCTCCTCTTAAATGYATTAG
CTTGATTCCTTGCGGATCGGCTCTCGGTGTGATAATATCTACGCCGCGACCGTGA
AGCGTTTGGCGAGCTTCTAAYCGTCTCACTTGAGAGACAACTTTATGACCTCTGA
CCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA
AAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCA
AATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTT
CCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGG
116

NLB Sequence:
GACTACAACTCGGACGGCCAAAGACCGCCAGATTTTAAATTTGAGCTTTTCCCGC
TTCACTCGCAGTTACTAGGGGAATCCTTGTTAGTTTCTTTTCCTCCGCTTATTGAT
ATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAGAGGTCATAAAGTT
GTCTCTCAAGTGAACGRTTAGAAGCTCGCCAAACGCTTCACGGTCGCGGCGTAG
ATATTATCACACCGAGAGCCGATCCGCAAGGAATCAAGCTAATRCATTTAAGAG
GAGCCGACCGATCAAGGCCGACAAGCCTCCAAGTCCAAGCCTACAAACCACAAA
AGCTTATAGGTTGAAGATTTCATGACACTCAAACAGGCATGCTCCTCGGAATACC
AAGGAGCGCAAGGTGCGTTCAAAGATTCGATGA
Fomes fomentarius
ITS Sequence:
GTGATTGCAGATTCAGTGATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGT
ATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTATAAACCTTT
GCGGGTTTGTAGCGTTGGATGTTGGAGGCTTTTTGCTGGCCCAGTCAGCTCCTCT
TAAATGCATTAGCTTGGTTCCTTGTGGATCGGCTGTCGGTGTGATAATGTCTACG
CCGCGACCGTGAAGCGTTTGGAGAGCTTCTAATGGTCTCGTCAGAGACAGCTTTT
ATGAACTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAT
AAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCG
GGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGG
AGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATA
GAGGGTGGAGAATCCA

NLB Sequence:
ATTTTAAATTTGAGCTTTTCCCGCTTCACTCGCAGTTACTAGGGGAATCCTTGTTA
GTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGAT
TTGAGGTCAGAGTTCATAAAAGCTGTCTCTGACGAGACCATTAGAAGCTCTCCAA
ACGCTTCACGGTCGCGGCGTAGACATTATCACACCGACAGCCGATCCACAAGGA
ACCAAGCTAATGCATTTAAGAGGAGCTGACTGGGCCAGCAAAAAGCCTCCAACA
TCCAACGCTACAAACCCGCAAAGGTTTATAGGTTGAGAATTTCATGACACTCAA
ACAGGCATGCTCCTCGGAATACCAAGGAGCGGCAAGGTGCGTTCA

117

Echinodontium tinctorium
ITS Sequence:
GATTGCAGATTCAGTGATCATCGAATCTTTGAACGCACMTTGCGCCCCTTGGTAT
TCCGRGGGGCAYGCCTGTTYGAGTGTCRTKWMTTYCYCCACTTCCCKCCYGCCY
TTGGGGTMTSSTGGGACTTGSATGTGTAAGTTTTTGCGGGGGTGCSTCYSCTCCTC
TACMAMTGMATTACTGAAACCCCYGGTGGTGCCTCCTTGGTGGGAWGTGGCTA
CGTCTAGGTTWTGTCCYACTGGGTTCTTCGCTACCAAGCATCCACACCGGATGAT
TYTTCGCATCTTGACCTCCGAACGAGAGGAACTACCCGCTGAATTCCTCCATATC
AGTAAGCGAAGGAAAAAAAACTCACATTGAATCCCCGACTWCCTGCCAATGART
MRTTAAAAGMWCATRTTTCAAGTGTGGCTCCCGTGGACGTCCCATGTAAAATTA
AGACAAACACTTTNCAGAACCCAACCGTGTACAAGTCTCCTGGAACGGAGCGTC
ATAGAGGG
NLB Sequence:
CACTCGACGCCCGMGGATTTCAGATTTGAATTGTTGCTTTTTCCGCTTCCTCACTG
ATGCTATGGGAGTCGGTGTCATTTCCTTTTCCTCCGGTTATGGATATGTTTAAGGT
CAATGGGTACCCGCTCCTGAGCCGAGGTCAAAWTACTATGAGTTGCCGCTTGRG
GACCGTTGGACTCRATCAACCAGGGTATTGTACAAAACCTAGCACGTNAACTATT
ATGGCGCCGAGGCCCACCTTGGGGCTTCACTAATGCATTTGAGAGGAGCGACAC
GCCGCCCGCAGAAGCCTCAAATGACGATYCCCAAGCTCCCCCCCAGGAAGTACG
GAAGTTGACAAAGTCCCKACACWCAAWCAAG

118