AN EXAMINATION OF GENETIC VARIATION AND DISEASE SPREAD IN
INONOTUS TOMENTOSUS IN THE SUB-BOREAL SPRUCE ZONE OF
BRITISH COLUMBIA
by
Susan Gibson
B.Sc. Biology, University of Northern British Columbia, 1999

THESIS SUBMITTED IN PARTIAL FULFILLMENT OF
THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE
in
NATURAL RESOURCES AND ENVIRONMENTAL STUDIES
(BIOLOGY)

THE UNIVERSITY OF NORTHEN BRITISH COLUMBIA
April 2005
© Susan Gibson, 2005

1^1

Library and
Archives Canada

Bibliothèque et
Archives Canada

Published Heritage
Branch

Direction du
Patrimoine de l'édition

395 W ellington Street
Ottawa ON K 1A 0N 4
Canada

395, rue W ellington
Ottawa ON K 1A 0N 4
Canada
Your file Votre référence
ISBN: 0-494-04663-5
Our file Notre référence
ISBN: 0-494-04663-5

NOTICE:
The author has granted a non­
exclusive license allowing Library
and Archives Canada to reproduce,
publish, archive, preserve, conserve,
communicate to the public by
telecommunication or on the Internet,
loan, distribute and sell theses
worldwide, for commercial or non­
commercial purposes, in microform,
paper, electronic and/or any other
formats.

AVIS:
L'auteur a accordé une licence non exclusive
permettant à la Bibliothèque et Archives
Canada de reproduire, publier, archiver,
sauvegarder, conserver, transmettre au public
par télécommunication ou par l'Internet, prêter,
distribuer et vendre des thèses partout dans
le monde, à des fins commerciales ou autres,
sur support microforme, papier, électronique
et/ou autres formats.

The author retains copyright
ownership and moral rights in
this thesis. Neither the thesis
nor substantial extracts from it
may be printed or otherwise
reproduced without the author's
permission.

L'auteur conserve la propriété du droit d'auteur
et des droits moraux qui protège cette thèse.
Ni la thèse ni des extraits substantiels de
celle-ci ne doivent être imprimés ou autrement
reproduits sans son autorisation.

In compliance with the Canadian
Privacy Act some supporting
forms may have been removed
from this thesis.

Conformément à la loi canadienne
sur la protection de la vie privée,
quelques formulaires secondaires
ont été enlevés de cette thèse.

While these forms may be included
in the document page count,
their removal does not represent
any loss of content from the
thesis.

Bien que ces formulaires
aient inclus dans la pagination,
il n'y aura aucun contenu manquant.

Canada

Abstract
Inonotus tomentosus (Fr) Teng. is a fungal pathogen of commercially valuable tree species in
British Columbia and one of the most important biotic disturbance agents in sub-boreal and
boreal forests in Canada. This study investigated the population variation in six spruce stands
infected with Tomentosus Root Rot (TRR) in order to determine whether infection is due to
spread by root contact, by basidiospores, or a combination of the two and if forest
management affects the mode of disease spread. Three marker types were used to test for
variation in populations. These included vegetative compatibility (VC), random amplified
polymorphic DNA (RAPDs) and single strand conformation polymorphisms (SSCP). Genetic
and genotypic variation as well as linkage disequilibrium and random mating were measured.
There is high genotypic variation within all populations in addition to moderate levels of
gene diversity, significant linkage disequilibrium and significant deviation from HardyWeinberg Equilibrium. Analysis of Molecular Variance (AMOVA) indicated that 70% of
genetic variation occurred within populations and 28% occurred between populations. This
indicates that some clonal propagation is occurring in these populations but frequent
recombination (i.e. sexual reproduction) and subsequent spore dispersal (although spatially
limited) is the most likely cause of the high level of genotypic diversity observed in these
sites. There was no apparent difference in the population structure of this pathogen between
unmanaged mixed-species stands and spruce plantations. Given this information, the current
management guidelines for treating sites affected by TRR may be insufficient because many
of them are aimed at interfering with spread by root contacts.

11

Table of Contents
Abstract

ii

Table of Contents

iv

List of Tables

vi

List of Figures

vii

Acknowledgements

viii

Introduction: An Examination of Genetic Variation and Disease Spread in Inonotus
tomentosus in the Sub-Boreal Spruce Zone of British Columbia.

1

1.0 Literature Review
1.1 Inonotus tomentosus
1.2 Disease Impacts
1.3 Disease Spread
1.4 Ecological Significance
1.5 Forest Management
1.6 Genetic Variation
1.6.1 Measurement of Variation
1.6.2 Genetic Variation in Basidiomycetes Causing Forest Disease
1.6.3 Population Analysis Tools

5
5
9
9
11
12
15
15
16
18

2.0 Methods
2.1 Study Sites
2.2 Sample Collection, Isolation and Culturing
2.3 Species Verification
2.4 DNA Extraction and Amplification
2.5 Vegetative Compatibility Analysis
2.6 RAPD Amplification
2.7 SSCP Amplification
2.8 Clone Size
2.9 Statistical Analysis

22
22
23
24
25
26
27
28
29
30

3.0 Results
3.1 Site Characteristics
3.2 Sample Collection and Species Verification
3.3 Vegetative Compatibility Analysis
3.4 Genetic Diversity
3.5 Genetic Differentiation
3.6 Genotypic Diversity and Random Association of RAPD Markers
3.7 Identification of Genets
3.8 Clone Size and Spatial Distribution

34
34
34
35
35
36
37
38
40

111

4.0 Discussion
4.1 Reproductive Mode of Inonotus tomentosus
4.1.1 Sexual Reproduction and Meiotic Recombination
4.1.2 Genotypic and Genetic Variation
4.1.3 Hardy-Weinberg Equilibrium and Random Association of Markers
4.2 Population Structure of Inonotus tomentosus
4.2.1 Genet Size and Distribution
4.2.2 Likelihood and Potential Impact of Spore Dispersal
4.3 Management Implications

41
41
42
45
50
55
55
56
61

5.0 Conclusions and Future Research Directions

68

Literature Cited

71

Appendices

106

IV

List o f Tables
Table 1. Primer sequences for nuclear and mitochondrial markers used in species
identification and SSCP analysis.

83

Table 2. Study site characteristics.

84

Table 3. Species composition by study site.

85

Table 4. Sample sizes and number of unique genets detected.

86

Table 5. Population genetic statistics in 107 isolates of Inonotus tomentosus
detected with RAPD analysis.

87

Table 6. Frequency of alleles for Ms and Ml loci.

88

Table 7. Frequency of alleles for actin locus.

89

Table 8. Tests for deviation from Hardy-Weinberg Equilibrium in the actin marker.

90

Table 9. Analysis of molecular variance (AMOVA) describing genetic variance
at three spatial scales.

91

Table 10. Observed and expected genotypic diversity in all stand types.

92

Table 11. Tests of random association among pairs of markers (linked loci)
calculated with Arlequin v. 2.000 and Index of Association (U) values calculated with
MULTILOCUS V. 1.3b for RAPD data.

93

Table 12. Number of trees infected and distance between host trees
as indicators of clone size.

94

List of Figures
Figure 1. Location of field study sites.

95

Figure 2. Examples of chlamydospore-like structures for identification of I. tomentosus.

96

Figure 3. Examples of RAPD banding on agarose gels.

97

Eigure 4. Infection of spruce by Inonotus tomentosus.

98

Figure 5. Example of vegetative compatibility reactions.

99

Figure 6. UPGMA tree generated with RAPD marker data.

100

Figure 7. Number of genets per 10 m^ of plot area detected using RAPD,
SSCP and VC testing.

101

Figure 8. Number of genets per m^ of spruce basal area in relation to number
of isolates sampled.

102

Figure 9. Frequency of single- and multi-tree genets by study plot based on
pooled count of genets.

103

Figure 10. Proportion of basal area colonized by single and multi-tree genets.

104

Figure 11. Comparison of average DBH of spruce trees infected by
single-tree or multi-tree genets and of uninfected trees.

105

VI

Acknowledgements
With deepest respect and gratitude I acknowledge my supervisor. Dr. Kathy Lewis, for her
mentorship throughout this project and for providing encouragement and support throughout
my time as her student. I also greatly appreciate the assistance provided to me by my
committee. Dr. Brent Murray, Dr. Keith Egger and Mr. Richard Reich. I am grateful to Dr.
Richard Hamelin and Marie Josée Bergeron of the Laurentian Forestry Research Centre for
the development of the protocols and primers from which this project stemmed and for
allowing me to observe and train in their lab.
Immense thanks to the many people that assisted in my field work including K. Lewis, J.
Russell, D. Wagner, B. Bruzzese, K. Fujimura, J. Fckford, B. Milakovic, S. Storch, and C.
Hamil. Special thank you to my lab technician, Jennifer Russell, who spent many hours both
in the field and in the lab to make completion of this project possible. I’d like to thank Dr.
Cecilia Alstrom-Rapaport for advising on the population genetic statistics used in this project.
I would like to thank my loving father for providing me with so much to support and
encourage me throughout my life and my schooling, and my partner in life. Dean Wagner for
his patience, kindness and humor throughout the duration of this project.
I dedicate this thesis to my mother, Sandra Alexis Gibson.

V ll

An Examination of Genetic Variation and Disease Spread in Inonotus tomentosus in the
Sub-Boreal Spruce Zone of British Columbia.
INTRODUCTION
The basidiomycete, Inonotus tomentosus (Fr) Teng., is a fungal pathogen of commercially
valuable tree species in the forests of British Columbia (Whitney and Boyhachuck 1977;
Whitney 1989, 1993; Lewis and Hansen 1991a & b) and one of the most important biotic
disturbance agents in sub-boreal and boreal forests in Canada (Hunt and Unger 1994; Lewis
and Lindgren 2000; Whitney 2000). Indigenous to BC forests (Basham and Morawski 1964;
Davidson and Redmond 1957; Patton and Myren 1968; Lewis and Hansen 1991a), /.
tomentosus is the causal agent of Tomentosus Root Rot (TRR) in a variety of conifers
(Whitney 1962; Merler 1984, Lewis et al. 1992).

Forest management practices have traditionally focused on protection and rapid regeneration
of commercial tree species but overlooked the importance of landscape biodiversity and
natural forest dynamics. For several reasons, this has resulted in reduced productivity in some
BC forests and illustrates the need for a greater understanding of natural processes in forest
ecosystem succession, allowing responsible long-term management decisions to be made
(Lewis and Lindgren 2000). Biotic disturbance agents like Inonotus tomentosus play an
important role in forest succession, but historically this role has been ignored or
misunderstood (Lewis and Lindgren 2000). Intensive forest management practices may lead
to greater establishment of this disease throughout second growth forests (Lewis and Hansen
1991b) and there is an increasing concern as to the potential impact this disease may have on
timber supply in second growth stands. Tomentosus root rot causes a significant decrease in
tree vigour and growth (Lewis 1997), and dependent on stand age and distribution of

inoculum within the stand, is reported to cause up to 30% mortality in infected mature spruce
leading stands (Whitney 1962).

Studies have shown that the fungus can survive in stumps and spread across root contacts to
surrounding trees, and between trees (Lewis and Hansen 1991a; Lewis et al. 1992, Hunt and
Peet 1997), but it is not understood to what extent root contacts are responsible for spread of
the disease. Studies using vegetative compatibility (VC) and protein eleetrophoresis have
provided evidenee that basidiospores may play a more significant role in the spread of this
disease than once thought (Lewis and Hansen 1991b). There is little information concerning
the population genetics of this fungus, nor have studies been performed on this pathogen to
firmly establish the role of basidiospores in disease spread. This information is essential to
effectively manage the disease (Lewis and Hansen 1991a).

Examination of the population genetics of Inonotus tomentosus is necessary to better
understand its ecology and epidemiology. Genetic diversity studies have been carried out on
other tree pathogenic fungi in order to understand and evaluate relationships within and
between species, (eg. Stenlid 1985; Garbeletto et al. 1993, 1999; Hamelin et al. 1995a;
Farnet et al. 1999; Kim et al. 2000). Information derived from these studies, such as clone
size and genetic sequence data has advanced efforts to understand phylogenetic relationships,
ecological roles and gene flow between and among species. Pattern and mode of disease
development may be explained through examination of genetic population structure and
subsequently, inferences can be made concerning how, where, and when initial infection
occurs in host species (Garbelotto et al. 1999). This information is essential for development
of effective management strategies.

An investigation into the variation of genotypes within populations of Inonotus tomentosus
will enable a test of the hypothesis that there is a pattern of colonization common to infection
by root contact or by basidiospores, or a combination of the two. A fungus that spreads
primarily by mycelium across root contacts would lead to a large area populated by few
genotypes, while frequent infections by basidiospores would create small disease centers and
multiple genotypes in a small area (Hamelin et al. 1995a).

In this study, three methods are used to assess genetic variation and population structure
between two different forest types: unmanaged old growth, and plantations. Vegetative
Compatibility (VC) testing examines variation at a number of loci within the genome that are
related to somatic compatibility. Single Strand Conformation Polymorphism (SSCP)
examines fine scale variation within specific targeted genes in nuclear and mitochondrial
DNA, and Random Amplified Polymorphic DNA (RAPDs) provide an overall picture of
variation throughout the entire genome through the use of small primers that randomly
amplify both coding and non-coding DNA. As such, this study also provides a novel
comparison of the power of resolution of each method for the purpose of examining fungal
population genetics. These methods are described in detail in the literature review section of
this thesis.

The objectives of this research are:
1. to study genetic variation and clone size in populations of Inonotus tomentosus;
2. to investigate the relative contributions of sexual reproduction and vegetative
propagation to the population structure of Inonotus tomentosus; and

3. to compare patterns in genetic variation and clone size of I. tomentosus between
unmanaged natural stands and plantations of hybrid spruce (Picea glauca (Moench.)
Voss. X englemannii Parry ex Engelm.) in BC, and make inferences concerning the mode
of disease spread and the impacts, if any, of forest management on this pathogen.

The null hypothesis is that there will be no significant difference in the measures of genetic
variation or in the measures of clone size between natural undisturbed stands and plantations.

1.0 LITERATURE REVIEW

1.1 Inonotus tomentosus
The classification and ensuing phylogenetic relationships of Inonotus tomentosus are
currently under investigation with the aid of molecular data sets that have been collected for
Inonotus sp. (Wagner and Fischer 2002). I. tomentosus, belonging to the family
Hymenochaetaceae, was originally assigned to the genus Polyporus by Fries (1821) and
remained in this taxon until 1964 when it was transferred by Teng (1964) to the genus
Inonotus. Gilbertson (1986) further acknowledged this adjustment in his examination of
“North American Polypores”. I. tomentosus has been a challenge to study taxonomically due
to its variable morphology and the numerous life history traits that are similar to other related
species, such as Inonotus circinatus (FR.) Gilb. and Phellinus pint (Thore.:Fr) A. (Whitney
and Boyhachuck 1977; Gilbertson 1986; Lewis 1990; Wagner and Fischer 2002).

All species of Inonotus live as parasites or saprophytes (Wagner and Fischer (2002) and
attack a range of tree species causing root and butt rot (Whitney 1962). The fungus acts by
extracting the host’s cell wall components (lignin, cellulose and hemicellulose) at equal rates
so that the wood maintains its fibrous nature and loses strength gradually (Alexopoulos et al.
1996). Inonotus tomentosus is a facultative parasite, depending mainly on living hosts, but
can survive up to 40 years on dead organic material (Whitney 2000; Lewis and Hansen
1991a). It cannot grow more than a few centimetres through soil (Whitney 1962) therefore it
requires direct contact between infected and healthy roots, as well as spore dispersal, for
disease spread (Lewis and Hansen 1991b; Merler 1984; Patton and Myren 1968). Stipitate
sporophores are produced in late summer and autumn, generating basidiospores that

germinate into homokaryotic mycelia. The nuclear behaviour of /. tomentosus has not been
described. It is presumed that anastomoses with mycelia carrying a dissimilar mating allele
produce dikaryotic or oligonucleate haploid mycelia that grow vegetatively in the host
(Agrios 1997). Studies with other Inonotus species have shown that the vegetative hyphae are
oligonucleate (Wagner and Fischer 2002). The ability of homokaryotic mycelia to cause
infection and colonize the host is unknown.

Upon contact with a susceptible root, the fungal mycelium creates a lesion in the root bark
and subsequently penetrates the woody tissue, establishing itself within the xylem of the
roots (Lewis et al. 1992). It advances slowly through the heartwood towards the bole of the
tree and into other uninfected roots. Whitney (1962) originally reported an average rate of
spread as 4.6 cm/year, but a later study by Hunt and Peet (1997) reported a rate of
approximately 20 cm/yr. Spread of the fungus was found to be slower in the first one to three
years while the fungus is becoming established in its host and then increases after several
years (Whitney 1962). The growth of the mycelium causes a salmon-coloured stain in the
wood that can reach as far as 5 meters up the stem, followed by advanced white pocket rot.
Advanced above-ground symptoms include reduced leader growth, stunted upper branches,
thin crowns and eventual wind throw or standing mortality. It has been found that 50-60% of
the tree’s root system is infected with advanced decay before aboveground symptoms
become apparent (Lewis 1997; Whitney 2000). Organisms such as root collar weevils or
spruce beetles associated with trees that have reduced vigour, may be present in areas of high
disease incidence (Lewis and Lindgren 2002; Whitney 2000).

In BC, Inonotus tomentosus has been reported on amabilis fir (Abies amabilis (Doug, ex
Loud.) Dougl. ex J. Forbes), and subalpine fir (Abies lasiocarpa (Hook.) Nutt.), Engelmann
spruce (Picea engelmannii Parry ex Engelm.), black spruce (Picea mariana (Mill.) BSP), and
white spruce (Picea glauca (Moeneh.) Voss.), lodgepole pine (Pinus contorta Dougl. ex
Loud. var. latifolia Engelm.), ponderosa pine (Pinus ponderosa Dougl. ex P. & C. Laws.),
and white bark pine (Pinus albicaulis Engelm.), Douglas-fir (Pseudotsuga menzesii (Mirb.)
Franco), western hemlock (Tsuga heterophylla (Rafinesque) Sargent), and western larch
(Larix occidentalis Nutt.). In other parts of North America it has also been found on grand fir
(Abies grandis (Dougl. ex D. Don.) Lindl.), western white pine (Pinus monticola Dougl. ex D.
Don.), Sitka spruce (Picea sitchensis (Bong.) Carrière), and western red cedar (Thuja plicata
Donn ex D. Don.) (Whitney 2000). This pathogen is most abundant in spruce dominated
forests in central and northern British Columbia, and at higher elevations in southern B.C,
with the most severe damage consistently reported in Picea spp. (Whitney 1962; Whitney
1993; Lewis et al. 1992). The Canadian Forest Service (CFS) now reports that Picea and
Larix are the most heavily affected genera. There have been no reports of infection in
hardwood species other than eases of artificial inoculations of white birch (Betula papyrifera
Marsh.) and trembling aspen (Populus tremuloides Michx.) by Whitney (1964).

Bernier and Lewis (1999) examined site conditions that impact the incidence of TRR.
Moisture regime, as influenced by slope position and soil texture was the most influential
variable affecting disease incidence. TRR is known to occur on a variety of site types
(Whitney 2000) but in the study by Bernier and Lewis (1999), it was predominantly found in
stands with high-pH, nutrient-rich, well-drained but moist soil.

Inonotus tomentosus was first detected in Canada 1922 but did not become a concern until
the 1980’s (Whitney 1980; Merler 1984). Whitney (1962, 1963, 1966) was the first
researcher to extensively investigate the occurrence of root rot caused by this fungus,
referring to it as ‘stand-opening disease’ due to the formation of pockets of dead or dying
trees leading to canopy gaps. The biology of I. tomentosus was further examined by Myren
and Patton (1971) and Whitney and others (1976, 1977) in the next decade. At this time, most
workers still commonly referred to the fungus as Polyporus tomentosus. Few publications
directly concerning this disease were produced during the 1980’s aside from Whitney (1980),
although Merler (1984) produced a master’s thesis on root rot caused by I. tomentosus, which
was the first published research that referred to the fungus in its newly assigned genus. In the
late 1980’s Lewis (1990) studied the biology and epidemiology of 7. tomentosus and has
since done extensive work to investigate survival, spread, and impacts of the disease (Lewis
and Hansen 1991a, 1991b; Lewis et al. 1992; Lewis 1997) as well as the ecological
relationships between I. tomentosus and other biotic disturbance agents (Lewis and Lindgren
1998, 2000, 2002). Other researchers began to acknowledge the problem of increased spread
of this disease during this time, including Tkacz and Baker (1991) and Hunt and Unger
(1997). In response to the rapidly developing discipline of molecular pathology (Lundquist
and Klopfenstein 2001), new studies on I. tomentosus that employ the use of molecular
genetics techniques are now emerging. In addition to molecular studies to establish
phylogenetic classification of I. tomentosus by Wagner and Fischer (2002), Germaine and
colleagues (2002) have conducted research to detect inter- and intra-specific polymorphisms
in nuclear and mitochondrial genes to better understand the genetic characteristics of this
fungus. This information may be applied in the identification, detection and monitoring of
this pathogen.

8

1.2 Disease Impacts
Tomentosus Root Rot causes significant decrease in tree vigour and growth (Lewis 1997),
and depending on stand age and distribution of inoculum within the stand, may lead to
considerable losses in mature spruce leading stands (Whitney 1962; Merler 1984).
Merchantable volume is lost through butt cull, or the loss of woody stem material from decay
that has advanced into the bole of the tree. Infected trees also tend to have reduced radial
increment. Lewis (1997) found reductions in net volume of severely infected trees in BC
spruce dominated forests as high as 31.8%. In Ontario natural white spruce stands of 70 years
or older, Whitney (1995) reported that losses in merchantable volume due to this disease in
the form of dead trees, windthrow, butt cull, and growth reduction ranged from 16% to 33%.
Additionally, weakened trees are more prone to secondary infections and windfall, thereby
negatively affecting surrounding healthy trees (Hunt and Unger 1994). In cases of high
disease incidence, there can be an entire shift in species composition to less susceptible
species (Lewis and Lindgren 2000) or open grasslands (Whitney 2000).

1.3 Disease Spread
7. tomentosus can grow ectotrophically, leading to the establishment of multiple points of
infection through the root bark. Lewis and others (1992) extensively studied the path of
infection of I. tomentosus in spruce trees. Two infection routes into the xylem of the tree
were identified; direct penetration of the bark on roots that were less than 4 cm in diameter,
in particular at root junctions where bark was disrupted, and through the bark of small feeder
roots less than 1 cm in diameter. Merler (1984) had similar findings and suggested that the
fungus was not able to penetrate the thicker older bark on larger roots. I. tomentosus is
known to grow no more than 2 or 3 cm outside its host in the soil (Whitney 1962) and

9

ectotrophic growth appears limited to roots smaller than 5 cm in diameter or severely
infected roots where the fungus has colonized the sapwood (Lewis et al. 1992).

Spores of Fames annosus (Fr.) Karst, (now Heterobasidion annosum (Fr.) Bref were shown
to survive in the soil and cause infection (Hendrix and Kuhlman 1964), and Whitney (1966)
proved that basidiospores of I. tomentosus were viable after storage at -18 °C and multiple
cycles of freezing and thawing. This information lead to the supposition of Myren and Paton
(1971), that spores cast in the fall could potentially remain viable after being washed down
into the upper layer of the soil and cause infections in lateral roots. They point out that the
occurrence of multiple new pockets of infection in certain spruce stands and the lack of
apparent woody inoculum suggests a role for basidiospores. This theory is further supported
by anecdotal reports of infections occurring in plantations that were established on old and
presumably uncolonized farmer’s fields (Myren and Patton 1971). The most recent work
using molecular tools was by Lewis and Hansen (1991b), who provided additional evidence
for spore spread by finding an unexpectedly high number of VC groups relative to number of
disease centres in spruce stands. Despite this information, clear evidence and a solid
understanding of the role of basidiospores and how they cause infections of spruce has not
been established.

Certain root pathogenic fungi are known to spread almost entirely by root contacts, leading to
large infection centres that encompass numerous trees, all infected by a single fungal clone.
This is seen in the diseases caused by Armillaria ostoyae (Romagnesi) Herink and Phellinus
weirii (Murrill) R.L. Gilbertson. In contrast to this, researchers demonstrated that in forest
stands infected with Schweinitzii Butt Rot (caused by Phaeolus schweinitzii (Fr:Fr.) Pat.)
10

almost every tree hosts a genetically distinct fungal clone (Barrett and Uscuplic 1971). This
suggests that in this case this disease may be spread almost exclusively by spores.
Heterobasidion annosum appears to be an intermediate of these two extremes (Garbelotto et
al. 1999). H. annosum is the causal agent of Annosus root disease, a source of extensive
damage in a variety of conifers (Hodges 1969; Allen et al. 1996; Woodward et al. 1998). It
creates moderate sized disease centres through vegetative growth, while establishing new
primary infections by the spread of sexually produced spores (Risbeth 1951). As evidence for
spore spread of I. tomentosus increases, complementing the well-established evidence of its
vegetative spread, researchers increasingly suspect that /. tomentosus may be similar to H.
annosum in regards to mode of spread (Lewis and Hansen 1991b). Both are damaging root
decay fungi that have similar ecologies and host ranges (Allen et al. 1996).

1.4 Ecological Significance
Pathogens are acknowledged as major agents of diversity in forested landscapes (van der
Kamp 1991). I. tomentosus may play a subtle yet highly significant role as an agent of smallscale disturbance in forest stands (Lewis and Lindgren 2000). Growing evidence from studies
on disturbances in forest ecosystems is revealing that small-scale disturbances caused by
pathogens and insects are a critical part of the successional processes that occur in natural
forest stands (Lewis and Lindgren 2000; McCarthy 2001; Schnitzer and Carson 2001). These
organisms may therefore determine overall stand structure and composition in certain stand
types (Worrall and Harrington 1988; Lewis and Lindgren 2000). /. tomentosus was found to
have little effect on stand structure at low levels (Newbery 2001), however high levels of the
pathogen can result in a species shift to resistant species or open brush (Lewis and Lindgren

11

2000). Furthermore, research by Lewis and Lindgren (2002) indicates that I. tomentosus
helps to maintain endemic levels of spruce beetle and, as such, may serve as an indicator for
endemic levels of this organism.

1.5 Forest Management
Disturbance events can have profound effects on forest development (Oliver and Larson
1996). Among anthropogenic disturbances, forestry operations are known to upset the
balance between host, pathogen and environment by creating stumps and wounds that the
fungi can colonize and by altering species composition on site (Norris et al. 2003). As is the
case for many plant diseases, the balance between host vigour and inoculum potential is
easily tipped in favour of the pathogen when disturbance causes stress or mortality in
potential hosts (Sturrock 2000).

The Canadian Forest Service ranks TRR as one of the most common and damaging root
diseases in British Columbia along with three other root diseases caused by Armillaria
ostoyae (Armillaria Root Disease), Heterobasidion annosum (Annosus Root Disease) and
Phellinus weirii (Laminated Root Rot). TRR is a difficult disease to manage because of its
slow development and lack of aboveground symptoms in the early stages of infection. In the
field the causal agent, Inonotus tomentosus, may be easily confused with Inonotus circinatus
or Phellinus pini in the advanced stages of decay (Allen et al. 1996). Work has been carried
out to develop a means of predicting which sites may have higher incidence of TRR based on
site characteristics (Lewis and Bernier 1997), but definitive quantification of the disease
remains difficult and expensive due to the need for root sampling.

12

Currently, there are no chemical or biological treatments for TRR. Recommended
management strategies depend on the level of disease incidence and the stand characteristics
(MoF 1995). Recommended treatments include avoidance planting 5 m from infected stumps,
regeneration with less susceptible conifer species, and stumping and push-falling. Hardwood
cropping and leaving the ground conifer-fallow, and planting non-susceptible species are also
options. Management decisions are difficult due to the need for the resulting prescriptions to
be both economically and ecologically sound. Each of the current recommended treatments
may have negative impacts on a site. Without thorough detection, re-planting may allow
inoculum in roots to continue to increase with each successive rotation (Stenlid and Redfern
1998). Although effectively ridding the site of the majority of inoculum, stumping and pushfalling can have both positive and negative impacts on a site due to the need for heavy
mechanical equipment and the loss of organic material from the forest floor leading to
compaction, displacement and erosion, although stumping during freeze up results in less
compaction to the forest floor (MoF 1995). Planting alternative tree species can be
problematic. Some native species may be less suitable for particular site conditions and as
such are more susceptible to pathogens and pests because they lack resistance or have
weakened defenses (Oliver and Larson 1996). This practice can also lead to overuse of a
single species and a lack of species diversity.

Progress towards understanding alternative strategies to deal with stands infected with TRR
is slow. Trials to assess the effectiveness of stumping and push-falling in stands infected by I.
tomentosus were initiated in 1995 (Sturrock 2000; Woods 2003). The study is ongoing while
researchers wait for the test trees planted in the study blocks to be affected by potential
13

inoculum. They are monitoring seedling growth and health and don't anticipate disease
response for several more years. Expected completion date for the study is no earlier than
2010 (Dr. Eric Allen pers. comm. 2004).

Despite the knowledge that forest management strategies can potentially upset the balance of
natural systems, published research that compares disease characteristics between managed
and unmanaged stands is limited. Lumley and others (2001) examined the diversity of wooddecaying micro-fungus communities in white spruce and trembling aspen stands in disturbed
and undisturbed sites to evaluate the impact of log and site variables, including site
disturbance, on these communities. The authors found that there was significantly less
species richness in disturbed as opposed to undisturbed sites, although a clear distinction
between disturbance type (i.e. the effect of fire disturbance vs. harvesting) was not made. In
terms of occurrence alone, the incidence of H. annosum had been found to be higher in
planted stands than in natural forests (Graber 1994; as cited by Gonthier et al. 2001). This
was also reported for Polyporus Schweinitzii Fr. (now Phaeolus Schweinitzii Fr.:Fr.) (Barrett
and Uscuplic 1971).

Plantations established on previously infected sites in B.C. are only now reaching a level of
maturity that will allow meaningful measurement of the impact of Tomentosus Root Rot. In
1991, Lewis and Hansen reported that diseased trees were evident in 25-year-old plantations,
but that the stands were still too young to properly assess the impacts of TRR. Traditionally,
it was believed that I. tomentosus could not kill trees younger than 20 years of age (Whitney
1993). There is evidence to refute this. Unger and Humphreys (1984) reported that 3.1% of
trees in eight 20-year-old plantations were infected or killed due to TRR. Hunt and Unger
14

(1994) discuss in detail the typical symptoms of very young trees (1-4 years) infected or
killed by TRR. In their study of the survival of 7. tomentosus in stumps and subsequent
infection of young stands, Lewis and Hansen (1991a) found that trees in second growth
spruce stands containing colonized stumps from the previous harvest had a 10-25% chance of
infection at 30 years, if the newly planted trees were located within two meters of infected
stumps.

1.6 Genetic Variation

1.6.1 Measurement of Variation
Detection and quantification of variation in the DNA of groups of individuals of a species is
the goal of population genetic research (Hartl 1988). With the use of appropriate molecular
techniques, polymorphic regions in the genome may be targeted and used as markers to
assess variation in a selected group of organisms at the ecological or geographical scale of
interest (Cook 1991).

Fungal population genetics is a challenging field of study for a number of reasons. These
challenges are discussed in detail in a review of fungal population genetics by Anderson and
Kohn (1998). These include below ground thalli that grow indeterminately leading to
difficulty in determining true “individuals”. In addition, fungi have unique methods of
colonization, dispersal and re-growth leading to overlapping generations with irregular,
indeterminate growth patterns and population structures ranging from completely clonal to

15

panmictic. Fungal units can exist in the form of genets' that are broken into spatially distinct
ramets^. Molecular analysis tools are providing the ability to overcome these inherent
problems and allow researehers to develop a clearer picture of the level of variation and
structure in fungal populations.

To develop effective management strategies, the mode and relative time frame of
reproduction by I. tomentosus in natural and managed forest stands must be known. Given
the mieroseopic nature of the fungus, and the below-ground habitat, direct observation is not
possible. Therefore, indirect methods that investigate genetic variation within populations
and population genetic structure are used. Population structure may be defined as the
distribution and relatedness of genotypes in populations (Hartl 1988). An appropriate
definition of a population as it is used for this study is “a group of organisms of the same
species occupying a particular space at a particular time.” (Krebs 1985). As such, each group
of isolates sampled within an individual study site is referred to as a population. In addition
to addressing the question of mode of reproduction, these data will provide information
regarding the fine-scale genetic variation and local population structure of I. tomentosus in
the central interior of BC.

1.6.2 Genetic Variation in Basidiomycetes Causing Forest Disease

Examination of the population genetics of I. tomentosus is necessary to understand its
ecological role and epidemiology. Genetic diversity studies have been carried out on other
tree pathogenic fungi in order to understand and evaluate relationships within and between
' The term “genet” is defined by Anderson and Kohn 1995 as all the mycelium produced by
vegetative means following an initial sexual mating event.
^ “Ramet” is a detached myeelial clone that oecupies a discrete territory and may act
independently of the entire fungal genet (Anderson and Kohn 1995).
16

species. The information derived from these studies, such as clone size and genetic sequence
data has advanced efforts to understand phylogenetic relationships, ecological roles and gene
flow between and among species (e.g. Kim et al. 2000; Stenlid 1985; Hamelin et al. 1995a;
Garbelotto et al. 1993, 1996, 1999; Farnet et al. 1999). The causal agent of Annosus root rot,
Heterobasidion annosum, has been extensively studied to establish population structure and
evolutionary life history. The application of molecular analysis tools confirmed that H.
annosum is composed of multiple complex inter-sterility groups (ISGs) (Korhonen 1978;
Chase 1985; Chase and Uhlrich 1990) and that it spreads both asexually through vegetative
growth and by sexually reproduced spores (Garbelotto et al. 1999). Isoenzyme patterns have
been used to identify multiple infection centers attributable to individual clones but that have
grown together over time to become indistinguishable. Stenlid (1985) used molecular
analysis tools to study fungal disease in forest stands for the purpose of developing disease
control strategies. Five genes and their respective enzyme products associated with
pathogenicity and infertility in H. annosum were identified by Chase and Ullrich (1990).
Researchers have used this information to study the relationship of these genes to particular
mating strategies and host specialization in H. annosum (Otrosina et al. 1992; 1993). Hansen
and colleagues (1993) studied somatic incompatibility in H. annosum to understand nuclear
reassortment. The information in this study is useful for understanding what happens when
individuals meet and compete in roots and stumps and may help to explain the general
virulence of this pathogen as well as its ability to maintain itself in nature (Hansen et al.
1993). Collectively this research ties into forest management by determining historical
disease development and how populations of pathogens maintained themselves before
commercial use and management of forests (Otrosina et al. 1992).

17

Armillaria ostoyae (Romagn.) Herink. is a virulent root pathogen that has historically been
assumed to have a completely clonal reproductive strategy. Dettman and van der Kamp
(2001a) investigated population genetic structure of A. ostoyae. Genetic analysis indicated
that the pathogen does not reproduce via airborne asexual propagules and that random mating
events are responsible for genet origin. This was inferred in part by the existence of infection
centers covering very large areas with infected trees containing the same (i.e. genetically
unique) fungal clone.

Genetic diversity of white pine blister rust (Cronartium ribicola (J.C. Fischer ex Rabenh.))
has been studied in depth (Hamelin et al. 1995a, 1995b, 2000; Hamelin 1996, 1998) using
random amplified polymorphic DNA (RAPD) markers and isoenzyme patterns in C. ribicola.
This pathogen exhibits a high amount of genetic variation within individual populations but
low variation across large geographic distances which has lead to the theory that extensive
gene-flow is occurring across very large distances, or that there is a shared common ancestor
for this pathogen (Hamelin et al. 1995a & b). This research has provided a better
understanding of the spread and distribution of this pathogen, and has contributed to
programs aimed at controlling spread and improving detection methods, as well as for
making decisions regarding breeding programs for susceptible species (Hamelin et al. 1995a).

1.6.3 Population Analysis Tools
There are a variety of molecular techniques available to assess genetic diversity in fungi.
Vegetative compatibility testing (VC), random amplified polymorphic DNA analysis and

18

single strand conformation polymorphism (PCR-SSCP) are three techniques used in this
study. Vegetative compatibility is a self/nonself recognition system in fungi based on
polymorphisms at one or potentially several different loci within the genome, revealing
phenotypic variation between fungal isolates within a population (Todd and Rayner 1980). It
is believed to have evolved in fungi to prevent the exchange of deleterious elements through
fusion of cytoplasm and nuclei (Bos 1996). VC analysis has been successfully applied in
previous studies dealing with I. tomentosus to illustrate variation within populations (Lewis
and Hansen 1991b) and has been described as a useful tool for indicating genetic variation in
fungi (Leslie 1993; Worrall 1994). This method was used to examine population structure in
basidiomycete populations before the widespread application of molecular techniques for this
purpose (Adams and Roth 1967; Barrett and Uscuplic 1971). It is still often used in
conjunction with molecular methods to analyze the population genetic structure of fungal
pathogens (Lewis and Hansen 1991b; Milgroom and Cortesi 1999; Dettman and van der
Kamp 2001a & b; Kauserud and Schumacher 2002). The drawbacks to this method are that it
is time-consuming depending on the number of crosses necessary and some reactions are
difficult to interpret due to ambiguous morphological responses of paired isolates.
Conversely, it is a simple and inexpensive method that requires no specialized equipment
other than what is needed to culture fungal isolates. Despite the fact that the exact molecular
controls involved in somatic incompatibility are unknown, it provides pertinent information
about the population genetics of fungi through indirect indication of genetic disparity (or
similarity) between isolates.

RAPDs are widely used to illustrate intraspecfic variation in fungi (e.g. Bonello et al. 1998;
Caligiome et al. 1999; Hamelin et al. 1995a & b; Garbelotto et al. 1993). This technique

19

utilizes multiple short unspecific primers that have many possible binding sites in the
genome. The resulting amplification products are separated by gel electrophoresis and reveal
banding patterns unique to each isolate. This technique has been used in studies of fungal
plant pathogens and has provided a suitable estimation of intraspecific genetic variation in
fungal populations on a small scale (Hamelin et al. 2000; Hamelin 1998; Gogglioli et al.
1998; Printzen et al. 1999). RAPDs have a number of advantages that make them desirable
for population genetic analysis. The technique is simple, comparatively inexpensive, and
does not require previous knowledge of the genome. In studies comparing RAPDs with
isozyme profiling, it was found to be significantly more precise and sensitive (Garbelotto et
al. 1993). Most importantly, the technique provides a relatively large number of putative loci
when used with care (Viaud et al. 2000). The disadvantages of this technique include
questionable reproducibility, the possibility of co-migration of similar molecular-weight
fragments and the inability to distinguish between homozygous dominant and heterozygous
individuals (Lynch and Milligan 1994). These disadvantages may be overcome through the
use of additional analyses that can corroborate the information drawn from RAPD analysis.

SSCP is a method of genetic analysis that differentiates between closely related individuals
based on sequence differences in the genetic code within the amplified regions (Orita et al.
1989). This has been proven to be a highly effective and reliable means of differentiation
between fungal isolates, without the need for direct sequencing (Hegedus and
Khatchatourians 1996; Kjoiler and Rosendahl 2000). Double stranded DNA is heated in a
formamide solution that denatures the DNA, producing single strands. The strands, in
solution, are loaded into a non-denaturing low-temperature gel. When they are no longer in a
denaturing environment, the strands will form internal hydrogen bonds, creating secondary
20

structures unique to each particular base sequence. The strands will migrate through the gel
and across a gradient at different rates due to these secondary structures.

Each of these three methods examines a different scale of variation within the genome. VC
testing examines variation at a number of loci within the genome that are related to somatic
compatibility, SSCP examines fine scale variation within specific targeted genes of both
nuclear and mitochondrial DNA, and RAPDs provide an overall picture of variation
throughout the entire genome. Each technique has drawbacks, but when used collectively, are
complementary and will provide a means of comparing these methods and their respective
utility in fungal population analysis.

The use of more than one method to examine population genetics is not always possible due
to time and financial constraints but can provide more informative results than one method
alone (Storfer 1996). Combined methods for the analysis of population genetics of root
pathogenic fungi have been successfully applied in several studies. The only population
genetics study of I. tomentosus currently published (Lewis and Hansen 1991b) applied
vegetative compatibility testing and protein electrophoresis to assess the level of variability
of isolates in spruce forests. Several studies concerning Heterobasidion annosum have also
employed multiple molecular analysis techniques. Stenlid (1985) published one of the first
detailed assessments of the population genetic structure of H. annosum through the use of
vegetative compatibility, sexual incompatibility and isoenzyme patterns. Goggioli and others
(1998) used isozyme and RAPD profiles to investigate polymorphisms of H. annosum in
Italy. Gonthier and others (2001) employed the use of TSCP-PCR (taxon-specific
competitive priming) in the mitochondrial large ribosomal sub-unit in combination with
21

RFLP analysis to investigate abundance and dispersal range of H. annosum in pure and
mixed forests. In all of these studies, the researchers reported good agreement between
methods, and benefited from both the amount of additional data resulting from the use of
multiple techniques as well as the added strength of their arguments provided by cosupportive data sets.

2.0 METHODS

2.1 Study Sites
Genetic and genotypic variation was studied and compared among two types of stands:
unmanaged spruce dominated forests and spruce plantations. The oldest spruce plantations in
the northern end of the Bowron Valley in the sub-boreal spruce wet cool subzone (SBSwk)
(Mackinnon et al. 1990) were located using records from the Ministry of Forests (Figure 1).
Candidate sites were examined for evidence of root disease and three sites with high levels of
infection (>10% incidence of infection) were selected. All three sites were located in an
approximately 100 ha area, 75 km east of Prince George, British Columbia. These stands
were composed entirely of spruce with multiple disease centers. Sites 1 and 2 were planted in
1969 while the third site was planted in 1975.

To select the unmanaged stands, “walk through” surveys were conducted in the spring of
2002 in numerous stands that were within 20km of the planted forests to minimize site effects.
Three unmanaged, spruce leading stands with several putative disease centers were selected
(Figure 1). The oldest undisturbed stand (U l) was located approximately 80 km east of

22

Prince George. The other undisturbed stands (U2 &U3) were approximately! km apart and
were located approximately 80 km northeast of Prince George.

2.2 Sample Collection, Isolation and Culturing
Sampling began at a single disease eentre then expanded outwards towards other apparent
disease centres in the stand. All spruce trees greater than 10 cm dbh (>5cm dbh in the
youngest plantation) adjacent to and between disease centres were examined for root disease
by observing above ground eharacteristics of each tree and then elearing soil from one or
more roots to look for signs of colonization. Sampling continued until twenty to thirty
diseased trees from eaeh stand were identified. This is a strategy reeommended for fungi that
tend to propagate through mycelial growth (Wang and Szmidt 2000), and is assoeiated with
surveys in which flexibility is required such as in situations where random sampling would
lead to sampling large areas of low concentration of the object of interest. Dead and
symptomatic trees in the sampling area were recorded, as well as the condition of all live
infeeted and non-infected trees.

Coordinate geometry was used to transfer the stem-map data into x,y eoordinates that were
used to produce stem-maps of eaeh plot. Stem-map data was ground-truthed to ensure correet
location of all trees.

All symptomatic trees were sampled. One to two eolonized roots (live and dead) were
excised using a Pulaski and labelled by tree number. Samples were brought back to the lab
and stored at 4° C. Using a surface sanitized hatchet, eaeh root was partially split open and

23

pulled apart to reveal the infected core of the root. For each root, three small chips of wood
containing mycelia were excised and transferred to one 3% malt extract agar plate using a
sterile technique. Cultures were incubated at room temperature and checked every two to
three days for contamination, and re-plated as necessary. Sub-cultures were subsequently
established for VC analysis and DNA extraction, as well as reference cultures for all isolates.

2.3 Species Verification
Two similar species of Inonotus are found in B.C., I. tomentosus and 7. circinatus. It is
difficult to differentiate between the two in the field without examination of basidiocarps, but
Inonotus circinatus is less commonly found on spruce than I. tomentosus and is generally less
virulent (Allen et al. 1996). The advanced stages of decay caused by 7. tomentosus may also
be confused with that of Phellinus pini but the two are readily differentiated with the use of
laboratory diagnostic techniques. Three methods were used to confirm the successful
isolation of 7. tomentosus. First, mycelia from cultures were examined for the presence of
chlamydospore-like structures^ which are not present in P. pini. This was done by preparing a
squash mount for each isolate and observing the mycelia using a compound microscope at
400 X magnification. Examples of squash mounts are presented in Figure 2 a & b. Second, all
isolates were plated on differential media that inhibits the growth of 7. tomentosus while
allowing the establishment of P. pini (Hunt 1997). Finally, after DNA was extracted for all of
the isolates, DNA was amplified with 7. tomentosus species specific primers; ITS209f (5’
GCTAAATCCACTCTTAACAC) & ITSVOOrc (5’ AGGAGCCGACCACAAAACAT)
(Germain et at. 2002). To confirm their specificity, I used the primers to attempt to amplify
^ Chlamydospore-like structures are small globose hyphal swellings that distinguish 7.
tomentosus, from other fungi that have similar culture morphology (Nobles, 1948)
24

DNA from a variety of reference samples of basidiomycetes and ascomycetes including P.
pini, the fungal species most commonly confused with I. tomentosus in wood and in culture.
Unexpected amplification of some reference samples did occur, but not with P. pini. Germain
and colleagues (2002) showed that the ITS primers do not amplify other closely related
species and genera {Inonotus leporinus, Inonotus cuticulatus (Bull.iFr.) P. Karst, Inonotus
radiatus (Sowerby:Fries) Karsten, Inonotus rheades (Pers.) Bong & Singer, Inonotus.
glomeratus (P.K.) Murr., and Phellinus pini). Isolates that did not pass one or more of the
diagnostic tests were eliminated from the study.

2.4 DNA Extraction and Amplification
Extraction of DNA from hyphal material of 7. tomentosus that had been stored at -20°C was
performed using the methods adapted from Zolan and Pukkila (1986). Very small amounts of
hyphal tissue were cut from cultures and placed in 1.5 ml microcentrifuge tubes. Samples
were suspended in 350 pi of 2x CTAB extraction buffer + 0.7% beta-mercapthenol, crushed
manually using clean micro-pestles and incubated at 60° C for an hour, vortexing every 15
minutes. To emulsify the mixture, chloroform: isoamyl alcohol (24:1) was added to each
sample, followed by centrifugation at 1300 rpm for ten minutes. The upper phase was
transferred to a clean microcentrifuge tube and precipitated with cold isopropanol. DNA was
washed with 70% ethanol and re-suspended in 50 pi of TE-8 buffer. Concentration of DNA
was quantified using a GeneQuant II spectrophotometer (Pharmacia Biotechnologies) and
brought to 5 ng/pl. DNA was amplified using a 16pl volume containing lOx PCR buffer
(Invitrogen), 2.2 mM MgCl], 50 pM of each of dNTP’s, 0.67 pi each of 25 pM primers (see
Table 1), 0.5 units of Platinum Taq polymerase (Invitrogen) and 5 pi of DNA template.

25

DNA amplification was carried out on an MJ Research Programmable Thermocycler under
the following conditions for the ITS primers: 35 cycles of 30 sec. at 92 °C, 30 sec. at 50 °C,
30s at 72 °C, preceded by a 3 minute dénaturation step (94 °C) and completed with a final
extension time of 5 minutes (72 °C). The presence of good PCR produet was verified by
running amplified samples through eleetrophoresis on a 0.7% agarose gel, visualized by
staining the gel with ethidium bromide and illuminated with UV transillumination.

2.5 Vegetative Compatibility analysis
Sub-samples from each original culture obtained from infeeted roots were plated and paired
in dual cultures, where small (8 mm) plugs taken from the colony margin of 2 different
isolates, were placed hyphae-down 1 cm apart on 3% malt extract agar. For stands where the
isolate sample size was less than 20, isolates were plated in all possible combinations. For
stands with more than 20 isolates, all isolates in eaeh putative disease centre were paired in
all possible combinations. Subsequently, one isolate from eaeh VC group within each
identified disease centre was paired with representatives from all other VC groups in the site.
The plates were incubated at room temperature in dark cabinets and examined at 4, 6 and 8
weeks for development of a reaetion line and ehanges in morphology. Lines were rated as 0
(no reaction), 0.5 (no line, no intermingling of hyphae-ambiguous reaetion), 1 (partial line or
gap), 2 (light/raised line - not eompatible), and 3 (definite raised/dark line - not compatible).
Lack of reaction was taken to indicate two isolates were of the same VC group within that
site. Reactions of 1 or greater were taken to indicate individuals of differing VC groups.
Ambiguous reactions were repeated. Images of most dual cultures were captured using a
scanner or digital photography, and cultures were diagrammed and deseribed throughout the

26

incubation process. Reactions were scored in tabular format. Groups of isolates that
illustrated compatible reactions were eounted to obtain an approximate number of genetically
distinct individuals in each study plot based on compatibility at VC loci at each site.

2.6 RAPD AmpliRcation
Thirty-two RAPD primers (Quiagen Operon Technologies) were tested to obtain 3 primers
that produeed repeatable patterns for a sub-set of 12 isolates, two from each site: (5’-> 3’)
opa-3, AGTCAGCCAC; opa-10, GTGATCGCAG; opa-13, CAGCACCCAC. Bands were
selected based on clarity, variability and repeatability. All samples were successfully
amplified at least twice for each of the three primers. Final RAPD-PCR conditions were as
follows; 2.5 pi of lOx buffer, (Invitrogen Life Technologies), 2.0 mM MgClz, 50 pM of each
dNTP, 0.5 units of Taq DNA polymerase, 1 pi of 5 pM RAPD primer, 5 ng DNA and
distilled water to make up to a 26 pi reaction. Amplification involved an initial dénaturation
for 4 minutes at 94 °C , followed by 40 cycles of 95 °C for 5 seconds, 35 °C for 10 seconds
with an increment of 0.3 °C per second until 72 °C was reached (an increase of 37 °C), and
finally, 72 °C for 30 seconds with an increment of 0.2 °C per second until 94° was reached
(an inerease of 22 °C). The reaction was completed with a 4-minute extension step at 72 °C.
A negative control was included in every amplification run. A 100 bp ladder (1 Kb+,
Invitrogen Life Technologies) was used as a size standard. Samples that showed similar
banding patterns across gels were run together to confirm differences or similarities.
Amplified products were eleetrophoresed on a 1.5% agarose gel stained with ethidium
bromide. Gels were run at 80 V for 1 hour and viewed with UV transillumination. Images of
gels were stored digitally and imported into Gene Profiler: Windows ID Gel Analysis

27

Software (Scanalytics Inc.). Using this program bands were scored and measured to produce
a database of banding patterns for all isolates. This information was imported into Excel and
translated into a binary data matrix in which bands were considered separate putative loci, as
present (1) or absent (0). Images of RAPD banding patterns are presented in Figure 3.

2.7 SSCP Amplifîcation
A screen for SSCP markers was performed by H. Germain and M.J. Bergeron at the
Laurentien Forestry center in Quebec with PCR products generated by a series of primers
already available. The first set of PCR primers found suitable for this analysis was ML 5 and
ML 6 (White et al. 1990), coding for the large mitochondrial ribosomal sub-unit. The second
set of primers was MS 1 and MS 2 (White et al. 1990), coding for the small mitochondrial
ribosomal sub-unit. From sequences obtained with primers developed by Hugo Germain, a
new set of primers for the gene coding for actin were: itl 12.31act2501f and
itl 12.31act2700rc developed by Marie-Josée Bergeron. Refer to Table 1 for primer
sequences. The SSCP primers were amplified under the following conditions: 36 cycles of 30
sec. at 92 °C, 45s. at appropriate annealing temperature (Table 1), 1 minute at 72 °C,
precluded by a 3 minute dénaturation step (92 °C) and with a final extension time of 10
minutes (72 °C), with a hot start. SSCP mitochondrial amplification products were separated
on 0.5x MDF (Cambrex) lab-cast gels with a Multiphor II Electrophoresis Unit (Amersham
Biosciences). MDF gel was prepared according to instructions provided by the company.
Actin products were run on pre-cast FxcelGel 48s gels (12.5%T, 29%C) according to the
instructions supplied with the FxcelGel DNA analysis kit (Amersham Biosciences). One
non-denatured product was included in each run. Samples were prepared for loading by
adding 5 pi of PCR product to 10 pi of loading buffer containing 95% formamide, 0.05%

28

xylene cyanol and 0.05% bromophenol blue. Samples were heated at 95% for three minutes,
quenched on ice and loaded. For the lab-cast MDE gels, 15 pi of product 4- dye was loaded,
and for the ExeelGels, 5 pi of product 4- dye was loaded. Mitochondrial PCR products were
eleetrophoresed at 200 V and a maximum of 40 mA for 17 hours at 4° C. Actin products
were eleetrophoresed under the same conditions for 5 hours. SSCP gels were stained using
the Amersham Silver Stain Kit. Gels were preserved by covering with plastic film and
sealing with masking tape. All isolates that amplified successfully were run once on 2-3 gels
for each primer set. Banding patterns for each individual on each gel were visually assessed
and described with an identifier to represent that unique allele on each gel. One
representative from each group on each gel was selected and run a second time on a single
gel to assess similarity and assign definitive groupings.

2.8 Clone Size
When discussing fungal clones the terms “ramet” and “genet” will be used according to the
definitions presented by Anderson and Kohn (1995). A genet is composed of all of the
mycelium produced through vegetative growth following the primary sexual mating event.
Since fungal genets may be fragmented over a landscape, the term ramet is used to denote the
spatially discrete physical units that belong to the same genet. There is no standard method
for measuring clone size for soil-borne fungi. Estimates of clone size in both plants and fungi
have been approximated based on the distance between individuals (Chung and Epperson
1999; Gherbi et al. 1999; Stenlid 1985) or fruiting bodies (Dahlberg 1997; Bonello et al.
1998; Kauserud and Schumacher 2002). A more empirical method was applied by Dettman
and van der Kamp (2001a & b), who calculated average area of ramets and genets based on

29

the distance between isolates that were collected along a transect. The drawbacks of this
method were that several assumptions were necessary and it could not provide an estimate of
genet shape. Garbelotto and colleagues (1997b) inferred clone size by presenting the distance
between adjacent trees infected with the same fungal genet, and discussed number of stems
infected by multi-tree genets. This method eliminates the need for some assumptions made
with Dettman and van der Kamp’s method like equal spread rates between isolates and even
shape of genets. As such, in this study clone size was estimated based on the methods of
Garbelotto et al. 1997b. The number of trees infected by an individual genet and the distance
between the two furthest trees infected with the same fungal genet were used to infer clone
size in this study. A single factor analysis of variance (ANOVA) was used to compare
average clone size by distance between stand type. Mean DBH was calculated for all trees
that were infected by either single-tree or multi-tree genets, as well as for all healthy trees as
compared to infected trees for all sites and a single factor ANOVA was used to test for
differences in these measures between stand type.

2.9 Statistical Analysis
Three data sets were generated, one for each method (VC, SSCP and RAPDs). For the
molecular methods, two data sets were constructed for population genetic analysis. One
consisted of all individuals in each study site and another that was “clone-corrected”, in
which each multi-locus genotype was represented only once. Multi-locus genotype refers to
the identity of an individual or group of individuals that display markers for several loci. The
data set for ‘only unique genotypes’ is based on the molecular data for all marker systems
pooled. RAPD markers with a frequency > l-(3/n) (where n = number of isolates analyzed)

30

were removed from the data set to avoid bias in allele frequeney estimates (Lynch and
Milligan 1994). The analyses for genetic diversity were carried out on the elone-eorreeted
data set (each multi-locus genotype represented only once) while genotypic diversity was
determined using the inclusive data set (all individuals). Gene frequencies and standard
population genetic statistics were calculated using POPGENE (PC version 1.31 Molecular
Biotechnology Centre, University of Alberta, Canada). Using RAPD data, the proportion of
polymorphic loci and the average marker diversity were calculated for each population.
Average marker diversity (M) corresponds (used because of dominance of RAPD markers) to
gene diversity (Nei 1973), and summarizes the distribution of marker frequencies in samples
of populations, representing the probability of drawing two different markers from each
locus, averaged over all loci. Using the RAPD data, observed genotypic diversity (Go) was
estimated using

where /?, is the frequency of the

genotype in a given population sample (Stoddart and

Taylor 1988). This method is specifically for use with dominant molecular markers. The
maximum value of G is n, (equal to the number of samples collected), and the minimum is 0
(only one genotype present). This number is compared to the expected genotypic diversity
(Ge) to produce a ratio of Go/Gg. Expected genotypic diversity was estimated through

computer simulations using a program that calculates genotypic diversity for dominant
markers like RAPDs."* A ratio close to 1 indicates a population is undergoing random mating.
If the ratio is significantly less than one there is less genotypic diversity than one would

' Michael Milgroom, Department of Plant Pathology, Cornell University, NY, USA.
31

expect in a true randomly mating population, which could be explained by asexual
reproduction.

Population structure was assessed using Arlequin v. 2.000 (Excoffier et al. 2000) to carry out
an analysis of molecular variance (AMOVA) on clone corrected data and produce
hierarchical F-statistics (Weir 1996) to partition the amount of genetic variation found
between and within populations and stand types. Population differentiation was visualized by
generating a UPGMA tree with RAPD marker data in POPGENE.

A test for deviation from Hardy-Weinberg Equilibrium in the actin locus was done using
POPGENE. The program computes expected and observed heterozygosity. Expected
heterozygosity is estimated using the algorithm for Nei’s (1978) unbiased heterozygosity. If
Ho > He then there is no evidence for an inbreeding effect in the population (Bonello et al.
1998). Significance of the deviation from expected was tested by Chi square based on the
algorithm developed by Levene (1949; as cited by Yeh et al. 1999). Allele frequencies of the
actin locus and the small and large mitochondrial sub-unit markers were examined to assess
genetic variation between stand types.

Analysis of linkage disequilibrium (LD) is a means of measuring the associations between
alleles of different loci to infer whether or not a population is in Hardy-Weinberg
equilibrium. A population is in Hardy-Weinberg equilibrium when the allele frequencies do
not change from one generation to the next. In this theoretical case, there would be no
association between pairs of alleles. Statistically, linkage is the association (or nonindependent assortment of alleles) between two loci in a population, and as such, tests for
32

linkage are based on tests for independence. If LD is detected in a population, it may be
assumed that departure of the loci from a state of equilibrium has occurred due to some
disturbing force such as non-random mating. Conversely, a population that is randomly
mating and dispersing (and not under the influence of any other disturbing forces) will
exhibit little, if any, LD in polymorphic markers (Lewontin 1995). LD between pairs of loci
detected for eaeh population was evaluated with RAPD data sets (both inclusive and clonecorrected) using two methods. First, an exact test of linkage disequilibrium for haplotypic
data based on the Fisher exact probability test using contingency tables (Slatkin 1994) was
employed. The null hypothesis is no association between the two tested loci, and was
calculated using Arlequin v. 2.000. The test statistic is L„, the probability of observed
genotype frequencies in combination occurring as frequently as combinations projected
under the hypothesis of equilibrium. Secondly, the Index of Association (U) (Maynard Smith
et al. 1993) was tested in the software program MULTILOCUS (PC version 1.3) Department
of Biology, Imperial College at Silwood Par, UK. This statistic compares the variance in the
observed number of mismatches between allele frequencies of isolates (Vobs) with the
expected variance (Vexp) of mismatches based on allelic frequencies for a randomly
recombining system without linkage disequilibrium. The Index of Association is calculated
as (Vobs-Vexp) - 1. If the population is randomly mating, the observed variance should not
significantly exceed the expected variance (i.e. should not differ significantly from 1), and if
it does, the population is exhibiting linkage disequilibrium. The significance of Ia was tested
by carrying out 1000 random permutations and all reports of significance are based on 95%
confidence limit.

33

3.0 RESULTS

3.1 Site Characteristics
Spruce composition in each stand ranged from 43% to 80% in unmanaged sites. Plantations
were 83% to 99% spruce. Species composition for each site has been tabulated and presented
in Table 2. Study site characteristics are summarized and presented in Table 3. The area of
each study plot ranged from approximately 1100 m^ to 1500 m^ in unmanaged stands and
400 m^ to 900 m^ in plantations. Plantations ranged in age from 27 to 33 years old, and
unmanaged stands were 78 to 152 years old. The oldest unmanaged stand was a mixedspecies stand in the understory reinitiation phase, and the second and third unmanaged stands
were dominated by spruce and were in the stem exclusion phase of development (Oliver and
Larson 1996).

3.2 Sample Collection and Species Verification
Symptomatic trees generally illustrated reduced growth and stunted leaders, as well as
chlorotic foliage and resinosis at the base of the stem. Below ground, the infected roots of
symptomatic trees were typically caked in black, soil-encrusted resin. Approximately 5-6
disease centres were identified by appearance of aboveground symptoms in each study plot,
except for in plantation site 3, which had only two large putative disease centres in close
proximity to one another. Of 165 attempted isolations from infected trees in all sites, 128
viable cultures were established from which DNA was extracted and subsequently identified
as 7. tomentosus using the species identification methods. The proportion of clones that were
successfully isolated from infected trees in each site ranged from 7% to 27% (Figure 4).

34

3.3 Vegetative Compatibility Analysis
Of 128 isolates, 111 were unambiguously grouped using VC analysis. Seventeen isolates
showed ambiguous (0.5 rating) results in one or more pairings but were grouped based on at
least one compatible reaction in repeated crosses with one individual in a VC group.
Ambiguous reactions were repeated, but frequently resulted in further ambiguous results. The
number of vegetative compatibility groups identified in each site ranged from 3 to 13 per site
(Table 4). Reactions were often distinct, either no reaction (0), or a strong reaction (2-3) after
8 weeks of incubation. Examples of these reactions are presented in Figure 5 a & b.

3.4 Genetic Diversity
Of 107 isolates that amplified with the RAPD primers, 28 polymorphic loci were identified
that generated 81 different banding patterns. Population statistics are presented in Table 5.
The proportion of polymorphic loci within sites ranged from 0.36 (site U l) to 0.71 (sites U2
and PI). Average marker diversity ranged narrowly from 0.16 to 0.25.

Mitochondrial marker frequencies are presented in Table 6. The marker for the small
mitochondrial sub-unit revealed two alleles (M sl and Ms2), each common to isolates in both
stand types. Allele Ms2 is shared by sites U2, U3 and PI. Six alleles were detected in the
marker for the large mitochondrial sub-unit. Allele M12 is also shared by these three sites.
SSCP analysis revealed 11 alleles for the actin locus over all six study plots. Actin allele

35

frequencies are presented in Table 7. Allele A2 is shared by sites U2, U3 and PI similar to
the alleles M12 and Ms2.

A test for deviation from Hardy-Weinberg equilibrium in the actin marker using the inclusive
data set revealed that there was significant deviation from equilibrium in all study sites (p <
0.001) except for the oldest unmanaged stand (U l) (Table 8). This remained true for 4 of 6
study sites when the same test was carried out using the clone corrected data set.

3.5 Genetic Differentiation
Results of the analysis of molecular variance (AMO VA) are presented in Table 9. AMO VA
revealed that the majority of genetic variation was due to variation between individuals
within populations (69.9%), with the remaining variation due to differences between
populations (28.4%). Only 1.7% of genetic variation occurred between managed versus
unmanaged stands, which indicates that there is no significant difference in genetic
composition of the populations of the pathogen when grouped by stand type. However, the
variation between and within sites is highly significant (p < 0.001).

AMOVA was also carried out on the inclusive data set with similar results. Additionally,
sites were grouped by geographic location based on their proximity (sites U2 and U3 and P I­
PS). There were no significant differences in variation between geographic groups, but
similar levels of variation occurred between and within study sites, significant at the 0.001
level. To visualize the differentiation occurring between the study sites a UPGMA
dendrogram (Figure 6) was generated with RAPD data (using clone corrected data set) based

36

on Nei’s (1978) genetic distance. Interestingly, the dendrogram indicates that site PI is most
similar to unmanaged study sites U2 and U3. This is reflected in the SSCP data sets (Tables 6
and 7) in which three alleles (Ms2, M12 and A2) are shared only by these three sites.

3.6 Genotypic Diversity and Random Association of RAPD Markers
From 128 isolates collected, 81 genotypes were detected using RAPDs. An assessment of
genotypic diversity carried out on this data revealed significant differences from expected
levels of genotypic diversity under completely random mating (Table 10). The number of
genotypes per population ranged from 6 to 20. The ratio of observed to expected genotypes
was measured as a minimum of 0.27 in the youngest plantation site (P3) to a maximum of
0.83 in site PI. The maximum value of Go would occur in the case that every isolate
possessed a different genotype (Stoddart and Taylor 1988). The observed level of genotypic
diversity is substantial in 5 of 6 sites, however the ratio of observed to expected genotypes is
significantly different from 1 in all sites (P_< 0.05).

Tests for linkage disequilibrium using inclusive and clone corrected RAPD data sets revealed
that all sites have a large proportion of pairwise markers that are not randomly associated
(Table 11). In the case of completely random mating, the proportion of linked loci should be
0. The percentage of markers in linkage disequilibrium among unique genotypes ranged from
2.2% to as high as 18.3% even in the clone corrected data set. Index of Association values
(Table 11) concur with these results. All sites show evidence of linkage disequilibrium in
both inclusive and clone corrected data sets.

37

3.7 Identifîcation of Genets
RAPD products ranged in size from 550 bp to approximately 2500 bp. Products over 2500 bp
were frequently too close together to distinguish and products under 550 bp were too faint to
score reliably. Primers opa-3, opa-10 and opa-13 produced a total of 28 repeatable markers
within this range. Eaeh primer produced 3 to 6 additional bands within the 550-2500 bp
range that were not reproducible between amplifications and were not used for analysis.
SSCP products for isolates that were successfully amplified but were not able to be
distinguished following electrophoresis were not included in the analysis. An assumption in
SSCP analysis is that there are no null alleles.

From 128 isolates colleeted, 91 distinet genotypes were found using SSCP, RAPDs and VC
testing combined. Using molecular methods alone, 82 genotypes were detected. Based on the
profile for eaeh isolate from all three methods, the total number of genets identified in each
study plot ranged from 7 to 24. Totals are presented in Table 4. RAPD markers revealed the
highest number of genetieally different isolates in each site. Over all sites, there were six
eases in which groups of two to four isolates identified as being of the same genotype based
on VC and SSCP analysis were split due to a difference of 1 RAPD band. In only one of
these cases was there an observed ambiguity of the VC reaetion (0.5 rating) associated with
one of these isolates. There was no apparent correlation between ambiguous results in VC
testing and isolates that appeared closely related based on shared RAPD markers. Of the
SSCP markers, actin markers agreed closely with the variation indicated by VC testing. The
least variation was seen in mitoehondrial SSCP markers. In one ease RAPDs grouped three

38

isolates as being identical but one isolate of the three differed in both its VC group and actin
marker.

To compare genotypic variation between sites, the number of genets per 10 square meters of
plot area (Figure 7) and number of genets per square meter of spruce basal area (Figure 8)
was plotted. There was a substantial occurrence of unique individuals in all sites by the
measure of number of genets by plot area. In four of six sites there was at least one unique
fungal genet occurring every ten square meters. The number of unique genets was found to
have a significant linear relationship with sample size and is reflected in the ratio of genets
per square meter. When number of genotypes was assessed by square meter of spruce basal
area, a pronounced difference between planted and managed stands in number of genotypes
in each site was apparent. The lowest occurrence was 1.2 genets per square meter of spruce
basal area in the oldest unmanaged stand (U l) and the maximum was 13.6 per square meter
of spruce basal area in plantation 3. This measurement does not appear to vary with sample
size and there is a significant difference in the average number of genets per square meter of
spruce basal area between stand types (Student’s t , p < 0.01).

All sites contained both single- and multi-tree genets. The count of genets was divided into
these two categories and is presented in Table 4. The frequency of single- and multi-tree
genets is presented by study plot in Figure 9. The proportion of single-tree genets as
compared to multi-tree genets was greater in five of six study plots, and highest in plantation
sites 1 and 2. Proportion of basal area colonized by single and multi-tree genets is presented
in Figure 10. Proportion of basal area infected by multi-tree genets ranged from 36% to 41%
while proportions on plantation sites ranged greatly from 16% to 87%.
39

Using the measurement of DBH taken in the field, the proportion of spruce basal area that
was colonized by single- and multi-tree genets was calculated. Unmanaged stands shared
similar proportions eolonized by both types of genets, while the proportion of spruce basal
area eolonized by single tree genets in plantation sites ranged from 13% to as high as 83%
(Fig 11).

3.8 Clone Size and Spatial Distribution
Clone size measurements are summarized by site in Table 12. Typically, no more than two to
four trees were encompassed by a single genet. The largest genet was found in plantation site
3, infecting seven trees. Stem maps of the study sites (Appendix I-VI), illustrate a common
pattern of clustering of two or more genotypes in what appeared to be single openings 10-15
m in diameter in four of six sites (U3, P I, P2, P3). Unmanaged stands U l and U2 shared this
pattern in some locations, but more frequently had single infection centres occupied by a
unique genet, surrounded by uninfected trees. There were no spatially separated ramets as
detected by RAPD markers, although in some sites overlapping vegetative compatibility
groups are apparent, as well as spatially separated groups of genets that share identical
mitochondrial haplotypes. The largest clone by distance was detected in the oldest
unmanaged site (U l), while the smallest clone by distance occurred in plantation site PI. An
analysis of variance of average clone size by distance showed no significant difference in this
measure between stand types (p = 0.27). Aside from a lack of clones in the smallest distance
class from site U l, all sites had genets in each distance class, but unmanaged stands had
higher numbers of genets in the larger distance classes. This may be a function of sample size

40

as there were more multi-tree genets detected in unmanaged study sites as opposed to
plantations. Mean DBH was calculated for all trees that were healthy or infected by either
single-tree or multi-tree genets and presented in Figure 11. Single factor ANOVA revealed
no significant difference in either stand type, unmanaged or plantation, between average
DBH (p = 0.85, p = 0.55, respectively) based on whether a tree was infected by either singleor multi-tree genets, and no significant difference between DBH of healthy trees as compared
to infected trees in any site (p = 0.79, p = .32 for unmanaged and plantation sites,
respectively).

4.0 DISCUSSION

4.1 Reproductive mode of Inonotus tomentosus
The results from the three methods of analyses were mutually supportive. Evidence of the
congruent nature of the data sets is seen in the UPGMA tree generated with RAPD data
(Figure 7) and the allele frequency data for the SSCP markers (Tables 6 and 7). Sites U2, U3
and PI are closely clustered based on multi-locus RAPD markers. This close relationship is
supported by the discovery of shared alleles between all of these three sites (A2, Ms2 & M12).
The amount of variation in the actin marker is more similar to the level of variation seen
through VC testing than with the RAPD data. This is not unexpected as the actin marker is in
a single targeted gene, while RAPDs survey coding and non-coding regions throughout the
entire genome (Lynch and Milligan 1994) and as such, would be more likely to detect
variations between different individuals. In only one case did SSCP and VC data provide
additional resolution to the RAPDs. One isolate of a group of three sharing identical RAPD
profiles was found to have a different VC and SSCP profile. It has been suggested that

41

caution must be taken before inferring population structure based upon any single class of
marker (Avise 1994). The use of three dissimilar yet co-supportive methods provides a solid
foundation for the assessment of the population genetic structure of I. tomentosus.

4.1.1 Sexual Reproduction and Meiotic Recombination
The first objective of this project was to investigate the genetic structure of populations of
Inonotus tomentosus in central British Columbia. The second objective was to understand the
contribution of sexual reproduction and vegetative propagation to the population structure of
this species. I. tomentosus does not produce asexual propagules (Nobles 1948). Vegetative
propagation and spread through host tree root contacts by I. tomentosus has been reported for
decades (Christensen 1940, Gosselin 1944; as cited in Whitney 1962; Whitney 1962; Merler
1984; Lewis and Hansen 1991a & b). Sexual reproduction occurs in this species, but to what
extent this contributes to the spread of the root disease caused by I. tomentosus had
previously been unclear. This study has revealed a substantial role for sexual reproduction in
the spread of Tomentosus Root Rot.

As for most basidiomycetes, the life cycle of Inonotus tomentosus involves alternation
between haploid and diploid (dikaryotic) phases (Webster 1980). The diploid phase is brief
and results in fruiting bodies (sporocarps), which produce large amounts of basidiospores that
are released in the fall (Whitney 1962). Between this stage and the establishment of a new,
heterokaryotic, vegetatively spreading fungal unit are two separate events that could result in
a unique individual. They both occur after haploid, mononucleate spores are released from
the sporocarp. Germination leads to the development of short haploid mononucleate hyphae

42

(Agrios 1997) that grow ectotrophically on the host’s roots (Merler 1984). It has been
suggested that these hyphae may also have the ability to grow through the duff layer (Merler
et al. 1988), but Whitney (1966) stated that hyphae can not grow more than a few centimetres
in this manner. When the hyphae come into contact with different mononucleate hyphae, the
two can fuse on the condition that they possess dissimilar mating alleles (depending on their
mating system). Plasmogamy (fusion of the cytoplasm) but not karyogamy (fusion of the
nuclei) occurs (Bos 1996). The organism continues to exist in the dikaryotic state for an
extended period of time and, although each cell contains two haploid nuclei, the organism is
functionally a diploid. It was suggested that the formation of the dikaryon is what permits the
fungus to infect and cause disease in its host (Lewis and Hansen 1991b). However,
Garbelotto and colleagues (1997c) illustrated that in H. annosum heterokaryosis was not
required for virulence. The mycelia of I. tomentosus have been observed as being primarily
dikaryotic when isolated from a colonized host (Lewis, unpublished data) but beyond this
observation, this aspect of the biology of I. tomentosus is not well understood. The molecular
analysis for this project is based on the understanding that this fungus spends most of its life
cycle in the dikaryotic (n + n) state and is therefore functionally a diploid. As such, the actin
marker was co-dominant and provided information regarding hetero- and homozygosity at
that locus.

The second process that results in a new dikaryon is the donation of one nucleus from an
established heterokaryon to a mononucleate hyphae. This process is referred to as the Buller
Phenomenon (Buller 1931; as cited by Webster 1980), or dikaryotization. Nuclear migration
from the donor heterokaryon to the monokaryon occurs after hyphal recognition, producing a
new genetically distinct individual that includes the cellular contents of the original
43

monokaryon (including the original haploid nucleus and mitochondrial DNA) with the
addition of new genetic material from the donated haploid nuclei. This individual possesses
new traits that may be passed onto future generations through the production of fruiting
bodies and establishment of propagules. This is called a di-mon mating event (dikaryon +
monokaryon) (Coates et al. 1985). How often this process occurs in natural populations of 7.
tomentosus and to what extent it effects the level of variation of populations is not fully
understood, but it is believed to be widespread in heterothallic basidiomycetes (Coates and
Rayner 1985; Chase and Ulrich 1983). Both of these processes involve sexual reproduction
and meiotic recombination to produce the monokaryotic hyphae. Vegetative compatibility
must not be confused with mating compatibility. Mating compatibility is a separate genetic
system in fungi that controls fusion of homokaryotic hyphae to form heterokaryons (i.e.
karyogamy), whereas vegetative incompatibility prevents the exchange of nuclei and
cytoplasm between individuals of the same population (i.e. plasmogamy) (Rayner 1991).
There are many aspects of the biology of I. tomentosus that have yet to be investigated. Due
to the gaps in our knowledge of the biology of I. tomentosus, the population structure of this
species as presented in this study is based on the current level of knowledge available. The
variable reproductive strategies as previously discussed may be contributing to population
variation in ways that will only be understood with continued research on the reproductive
biology and population genetics of fungi in this family.

4.1.2 Genotypic and Genetic Variation

44

The results of this study indicate that a great deal of variation exists within populations of
Inonotus tomentosus. Lewis and Hansen (1991b) were first to illustrate high levels of genetic
variation in this species through the use of vegetative compatibility testing and protein
electrophoresis. Lewis and Hansen’s results are strongly supported by the findings of this
study. Vegetative compatibility testing illustrated the existence of several VC groups within
each study site. Molecular analysis revealed that many of these VC groups were composed of
two or more genetically distinct individuals. This was not surprising, as vegetative
compatibility is understood to be a multi-allelic and/or multi-genic trait and, as such,
compatibility does not necessarily indicate clonality (Anderson and Kohn 1995). In other
words, isolates that have incompatible reactions are clearly genetically dissimilar, but when
two isolates appear compatible it does not prove that they are clones, only that they are
similar at the loci for compatibility (Hansen 1979). The results of this study are in agreement
with other research that has shown multi-locus identification methods like RAPDs can
further discriminate among genotypes identified by VC analysis (Jacobsen et al. 1993;
Stenlid and Vasiliauskas 1998). It is not known how many alleles or loci are involved in the
somatic incompatibility system of I. tomentosus, but in most fungi it is a complicated multi
allelic system (Leslie 1993; Adams and Roth 1967; Barret and Uscuplic 1971; Hansen 1979;
Nauta and Hoekstra 1994; Saupe and Glass 1997).

Population structure of fungal species can range from strictly clonal to completely panmictic
(Maynard Smith et at. 1993). A way of understanding the relative contribution of sexual and
asexual (clonal) reproduction to population structure is to determine the number of unique
genotypes present (genotypic variation) in a population as compared to the expected levels
under Hardy-Weinberg equilibrium (Milgroom 1996). High proportions of unique genotypes
45

is consistent with the hypothesis of sexual reproduction, although caution is necessary before
assuming the amount of sexual reproduction within a population because a high mutation rate
may also create a non-clonal structure (Milgroom 1996). The mutation rate in I. tomentosus
is currently unknown. Populations of soil-borne fungi that spread primarily by vegetative
propagation like Armillaria ostoyae and Phellinus weirii, or by asexual propagules like
Colletotrichum gmminicola, have very low genotypic diversity (Childs 1970; Dettman and
van der Kamp 2001a & b; Chen et al. 2002). In this study several fungal genotypes were
detected in each site. Genotypic diversity, as estimated with the method of Stoddart and
Taylor (1988), was significantly different from 1 in all sites (the case of all isolates being
genetically different) (p < .05) but the proportion of unique genotypes was still relatively
high for a species that is spreading primarily by vegetative means. The maximum genotypic
value (G q/G e) measured in this study ranged from 0.27 to 0.85. This relatively high level of
genotypic diversity supports the occurrence of frequent genetic exchange and dispersal
events. Similar measurements of genotypic diversity have been made in other studies of
fungal plant pathogens that have mixed modes of reproduction. For example, Milgroom and
colleagues (1992) found very high proportions of unique genotypes in Cryphonectria
parasitica (Murrill) Barr (Gq/Ge of 0.77 - 1.00) based on Stoddard and Taylor’s (1988)
genotypic diversity, suggesting that a large proportion of individuals from these populations
were the result of sexual reproduction. Similarly, McDonald and colleagues (1999) measured
high levels of genotypic diversity in Rhynchosporium secalis (Oudem.) J.J. Davis (0.45 0.97) also using Stoddard and Taylor’s (1988) measure of genotypic diversity. This organism
was once thought to reproduce exclusively asexually and as such, expected to sustain limited
genetic diversity within populations. This was disproved with the use of molecular methods

46

that revealed high genotypic (and gene) diversity leading researchers to conclude that this
pathogen is spread over long distances by sexually produced propagules.

A locus is polymorphic within a population if the most common allele occurs at a frequency
of less than 95% (King and Stansfield 1990). Proportion of polymorphic loci is a way to
quantify the amount of information provided by the molecular markers and to a lesser degree
used to give a general indication of the variation within each population (Weir 1996). Marker
diversity is an alternative to average heterozygosity as a measure of population genetic
variation (Avise 1994). High proportions of polymorphic loci and high levels of marker
(gene) diversity in populations of saprotrophic fungi have been found to be indicative of
population variation influenced by sexual reproduction and long distance spore spread
(Urbanelli et al. 2003; Boisselier-Dubayle et al. 1996; James et al. 1999). In contrast, very
few polymorphic loci and very low measures of marker diversity indicate restricted gene
flow and limited dispersal (Chen et al. 2002; Coletta-Filho and Machado 2002). In this study,
the proportion of polymorphic loci using multilocus RAPD markers was relatively high even
in sites that had lower sample sizes (U 1 and U2), providing a level of resolution comparable
to other studies of pathogen populations (Chen et al. 2002; Goggioli et al. 1998; Hsiang and
Mahuku 1999; Otrosina et al. 1993) and indicating a substantial level of variation exists
within populations of I. tomentosus. Among the six populations of I. tomentosus in this study,
marker diversity ranged narrowly from 0.16 to 0.25. This value is consistent with gene
diversity measured using multi-locus marker sets for other fungal species which have been
found to reproduce both sexually and asexually (Otrosina et al. 1993; Goggioli et al. 1998;
Chen et al. 2002; Ceresini et al. 2002). Values associated with these measures are not
directly comparable between studies because of the inherent differences between marker
47

types and the application of the methods used for each analysis, but from them
generalizations can be made regarding relative levels of diversity between organisms (James
etal. 1999).

Burdon (1993) suggests an examination of ‘meta-populations’ is the most appropriate scale at
which to study pathogen populations. Meta population genetic variation is influenced by
fluctuations within smaller populations undergoing genetic drift, selection and migration.
Local extinctions followed by genetic drift during a ‘crash’ phase can contribute to local
differentiation between sub-groups. Drift in species with poorly developed recombination
systems will progressively reduce the number of different multi-locus genotypes present in a
population. There were substantial numbers of multi-locus genotypes in the populations of /.
tomentosus examined. Burdon (1993) also stated that populations of pathogens that undergo
regular meiotic or parasexual recombination may slowly lose alleles over time as well, but
will maintain their overall diversity because the remaining alleles can be recombined into a
variety of genotypes. The substantial number of different genotypes within all six study sites
indicates that regular recombination (meiotic or parasexual) is occurring in these populations.
It is possible, although unlikely, that the six study sites had abnormally high levels of genetic
diversity in the resident populations of /. tomentosus. This is unlikely because disease levels
were not abnormally high in comparison to what has been observed in disease surveys
(Whitney 1995; Lewis 1997), despite the purposeful selection of areas with disease.
Variation may also arise through somatic recombination or mutations. As was previously
stated, the mutation rate in this species is not known. Spontaneous mutation has been found
to be a powerful source of variation in certain fungal pathogen populations (Burdon and Silk
1997). As such, it cannot be ruled out as a source of variation in this species. It may also be
48

argued that the genets are from old infections (previously established fungal genets
harboured in old stumps), especially in the newly planted sites. It is very likely that some of
the genets in the plantations were established pre-harvest, but the overall variation would
have to arise from some source that would likely be meiotic recombination and production of
basidiospores. Based on the information from this study, it is not possible to say if any or all
of the genets were established post- or pre-harvest. Based on what is known of fungi that
spread by spores, the level of variation and spatial patterns observed in populations of I.
tomentosus are indicative of a pathogen that is spreading by sexually reproduced propagules
which is sufficient information to address the objectives of this project.

The most useful application of the mitochondrial markers in this study is to assist in the
determination of historical relationships of genets. In pathogenic fungi, the mitochondrial
genome is inherited independently of the nuclear genome, usually exhibits little or no
recombination, and is usually inherited from only one parent (McDonald 1997). As a result
of these traits, mitochondrial genomes exist as a series of clonal lineages that can be used to
determine lines of descent or paths of gene flow (McDonald 1997). The information from
mitochondrial markers as applied to each genet will be referred to as mt-haplotypes. The
largest number of mt-haplotypes was found in unmanaged study site 3 (= 7), followed by
unmanaged study site 2 (= 4). Only two to three mt-haplotypes were detected in any one of
the managed study sites and in unmanaged study site 1. There is no available information
regarding typical levels of mitochondrial variation within populations of this species but the
majority of the mitochondrial genome is known to be highly conserved (McDonald 1997).
The amount of variation observed in these populations is unexpectedly high considering the
modest sample sizes and relatively confined geographic areas. In a study of mitochondrial
49

DNA variation detected in Armillaria, researchers determined that variation was not a result
of vegetative propagation of the clones and that there was a relatively low mutation rate
within individuals, therefore, the mtDNA variation in the population could have been a result
of sexual recombination and subsequent dispersal of propagules (Smith et al. 1990). This
hypothesis is based on evidence that during sexual crosses of some fungi, limited
cytoplasmic mixing does not allow full transmission of mtDNA from one parent to the other.
It does provide a limited opportunity for mitochondrial recombination between the mtDNA
of both parents (Hintz et al. 1988; May and Taylor 1988). Although evidence of spore spread
is rare in Armillaria, Dettman and van der Kamp (2001a & b) concluded that unique
individuals in local populations may arise from very rare mating events between closely
related individuals or somatic mutation within individuals, but that at the meta-population
scale new individuals likely arise through sexual recombination and long-distance dispersal
via basidiospores. This type of recombination of the mitochondrial genome within sexually
reproducing populations of I. tomentosus could also be responsible for the variation detected
in the mitochondrial markers of this species.

4.1.3 Hardy-Weinberg Equilibrium and Random Association of Markers
One of the assumptions of a population in H-W equilibrium is random mating. Deviation
from H-W equilibrium in a population is detectable as a heterozygote deficit that often arises
as a result of non-random mating (Avise 1994). The amount of heterozygosity at a single
locus, or averaged over several loci, is also a simple measure of genetic variation in a
population (Weir 1996). Expected and observed levels of heterozygosity were measured in
the co-dominant nuclear marker in the actin locus. The hypothesis was no difference between

50

observed values of heterozygotes and the number expected if the population was in HardyWeinberg Equilibrium. In the inclusive data set all study sites except U 1 had a p-value of less
than 0.001, indicating significant departure from Hardy-Weinberg condition, and therefore
evidence of some disturbing force acting on the population leading to the deviation. In the
clone corrected data sets, the probability values increased but were still significant to p < 0.01
for 4 of 6 sites, but site P3 became non-significant, similar to site U l. Both cases of non significance could be due to small sample size after clone-correcting the data set that can lead
to a decrease in the power to reject the null hypothesis (Lenski 1993). In some studies, this
problem is addressed by pooling the data from several populations to increase sample size
(Douhan et al. 2002), but in this study I cannot do so because all of the sites were found to
have significant population differentiation as determined by the analysis of molecular
variance (AMOVA). In other words, the individuals within study sites are not genetically
similar enough between study sites to be able to combine all of the genetic data. From the
information collected regarding heterozygosity in the actin marker, there is a deficit of
heterozygotes in most populations leading to significant deviation from H-W equilibrium. A
significant deficit in heterozygous individuals strongly suggests clonal reproduction in the
fungal population (Milgroom 1996). Therefore these results indicate that the populations of I.
tomentosus are likely influenced by clonal propagation.

Linkage disequilibrium analysis of multilocus RAPD markers revealed that all isolates within
populations of Inonotus tomentosus have a substantial proportion of pairwise markers that are
not randomly associated in both inclusive and clone-corrected sets. Similar results for these
measures were detected in populations of Colletotricum graminicola, a pathogen of turf
grasses (Chen et al. 2002) that was found to have a mixed reproductive mode involving the
51

production of asexual propagules (conidia) and ascospores. In this case, the researchers found
that linkage disequilibrium occurred even with removal of the clonal component of the
population, indicating restricted gene flow, as observed in 7. tomentosus. This was also seen
in a study of a population of Gremmeniella abietina in which a decrease from 29.6%
significant associations of RAPD loci in 126 isolates to 14.7% in clone corrected data sets
was seen as a strong indication that random mating was very common in the population
(Wang 1997). Index of Association values were significant to the 0.01 level for the inclusive
data set and to 0.05 for the clone corrected data set. The Index of Association is another
measure of linkage disequilibrium that quantifies the degree of association between loci
(Maynard Smith et al. 1993). The Index of Association of populations of /. tomentosus in this
study deviated significantly from 0, which indicates limited recombination. This could be a
result of spatial isolation between lineages or beeause there is no meehanism for genetic
exchange, i.e. reproductive isolation because strains have grown too distant genetically to
permit recombination (Maynard Smith et al. 1993). Linkage disequilibrium may also appear
in populations because of chromosomal linkage between markers (Haiti 1988). The use of
selectively neutral multilocus markers minimizes ehromosomal linkage as a likely influence
in this study. Other possible explanations for the occurrence of linkage disequilibrium could
be local occurrences of multiple intersterility groups, limited dispersal (i.e. vegetative spread
or limited spore dispersal), or occurrence of the Buller phenomenon (Hogberg and Stenlid
1999). The occurrence of linkage disequilibrium as measured by two different algorithms in
this study and agreement between the measures of LD in RAPD markers and heterozygosity
in the actin locus is suggestive of non-random mating. As clonal propagation is known to
occur in this species, this is likely the reason for the occurrence of disequilibrium in these
populations. This assumption comes with a caveat; the lack of knowledge regarding the other
52

biological reasons for the occurrence of linkage disequilibrium and heterozygote deficits in
populations of I. tomentosus makes drawing a conclusion challenging. In addition to the
genetic mixing that may result from the Buller phenomenon, it is not known if intersterility
groups exist within this species, as they do in H. annosum.

Beyond intersterility groups, perhaps the existing vegetative compatibility system is a
sufficient deterrent to population mixing such that small, genetically isolated sub-populations
may begin to develop within an infected stand. Leslie (1993) suggested that it is likely that
several small sub-populations exist in apparently uniform geographic populations because of
differences in VC loci that prevent genetic exchange. A progressive separation of fungal
hyphae even in a limited manner can lead to genetic divergence (Farnet et al. 1999). The
existence of localized interbreeding populations within a larger sampled population can lead
to significant disequilibrium and the appearance of heterozygote deficits even though random
mating is occurring. This is referred to as the “Whalund effect” (Gillespie 1998). Both
mating and vegetative compatibility systems impose limitations on the development of fungal
populations. Mating compatibility systems in fungi appear to override vegetative
compatibility, leading to a rather stringent set of circumstances before karyogamy and
meiosis can occur (Coates et al. 1985). Strains that are capable of forming a successful sexual
(mating-type) heterokaryon may not be able to form a successful vegetative heterokaryon and
vice versa (Leslie 1993). Typically, vegetatively incompatible strains exhibit a strong
rejection reaction (demarcation zones) in vitro. Both mating compatibility and vegetative
compatibility are complicated multi-allelic or multi-genic systems (Leslie 1993) that are yet
to be fully understood. In the vegetative compatibility system, genetic exchange can occur
between unrelated individuals only if they are compatible at VC loci. Coates and colleagues
53

(1985) observed a differential ability of unrelated isolates as opposed to sibling-related
isolates to exchange nuclei. Sibling-related monokaryons were capable of exchanging nuclei
to form a heterokaryon, but the process was significantly delayed compared to between
unrelated isolates. Fusion between two compatible monokaryons is not unlikely in nature
because field populations are usually highly polymorphic (Leslie 1993). As there is no
research regarding these systems in I. tomentosus in particular, further study is required to
understand both their occurrence and potential influence on reproduction and population
structure.

The lack of knowledge of the population genetic structure of I. tomentosus coupled with the
well-documented occurrence of clonal propagation through root contacts (Whitney 1962;
Lewis 1992) and the relatively slow rate of disease development in its hosts (Merler 1984;
Myren and Patton 1971; Whitney 1962) have contributed to the assumption that sexual
reproduction was a rare contributor to the spread of this pathogen and as such, populations
were expected to have low levels of genetic diversity. This study has provided evidence to
the contrary. The results of this study indicate that although population genetic structure of 7.
tomentosus is partially influenced by clonal propagation, recombination may be occurring
more frequently than previously thought at a local scale. Both marker diversity and genotypic
diversity are surprisingly high for a root infecting saprotrophic fungus that, until about the
past decade, was believed to be spreading almost entirely by asexual propagation through
root contacts. Although substantial measures of linkage disequilibrium and heterozygote
deficits suggest limited recombination, genetic diversity measures and analysis of molecular
variance suggest an underlying genetic structure in these populations that is influenced by
genetic recombination and spore dispersal.
54

4.2 Population Structure of Inonotus tomentosus

4.2.1 Genet Size and Distribution
High numbers of genets were detected in all sites, based on the results of RAPDs, SSCP and
VC testing. This agrees with the findings of Lewis and Hansen (1991b) who discovered
multiple VC groups within single disease centres of spruce based on somatic incompatibility
testing and protein electrophoresis. The proportion of single tree clones was high in all sites,
ranging from 47% to as high 87.5%. These proportions are similar to those observed for H.
annosum. Garbelotto and others (1999) discovered high numbers of single tree genets in
white fir mortality centres caused by Annosus Root Rot using a similar strategy of intensive
selective sampling of infected woody material in discrete mortality centres. Additionally,
multi-tree genets encompassed no more than 2-7 stems, similar to what was found in my
study of I. tomentosus. Low numbers of colonized stems per genet could be due to recent
establishment of the pathogen on the sites or to site conditions which were not favourable to
secondary spread of the disease. These also may be reasons for the apparent lack of extensive
vegetative spread by I. tomentosus although in this case, all six sites would not be expected to
have conditions unfavourable to disease spread. At least a few very large clones were
expected in some sites based on past research on the mode of spread. Research to date on the
spread of I. tomentosus has documented the ability of this pathogen to directly penetrate host
roots (Lewis et al. 1992) and trees in the early stages of the disease often exhibit dead lateral
roots in the direction of disease centres that have been known to be several meters to several
hectares in size (Whitney 1962). As such, very large patches of dead trees have been assumed
to have been killed by a single fungal clone. This is not the case in the disease centres I have

55

examined in this study. The extent of clone size of some of the largest genets that have been
detected combined with the slow rate of spread of this fungus (Whitney 1962, Hunt and Peet
1997) makes it unlikely that they are recently established, but it is possible that the small
(single-tree) genets could have arisen more recently from spore mediated infections.

Clone size, as measured by number of trees infected by each vegetatively spreading fungal
genet and the maximum distance between furthest trees infected by that genet revealed a
range of clonal and apparently non-clonal growth patterns throughout all sites. Clone sizes of
genets that spread to more than one tree ranged from as small as two trees l-5m apart, to as
large as several trees up to almost 10 meters in distance. Similar sized clones based on
distance travelled between host trees were found for H. annosum (Garbelotto et al. 1999).
This is in contrast to very large clone sizes reported for pathogens which are known to spread
primarily vegetatively such as Phellinus weirii (Childs 1963, 1970), and Armillaria ostoyae
(Dettman and van der Kamp 2001a & b). In the populations of 7. tomentosus, somatically
compatible reactions were frequently seen between genetically distinct individuals within
geographically localized VC groups. This is consistent with the hypothesis of sub-groups
delimited by the somatic compatibility of the individuals of each sub-group.

4.2.2 Likelihood and Potential Impact of Spore Dispersal
Gene flow through spore dispersal can be a major determinate in local genetic population
structure of fungal pathogens (Anderson and Kohn 1995). Studies of fungal species have
found that local populations maintained by spore dispersal alone tend to contain many
genetically different individuals occupying discreet areas within a single substrate (Rayner

56

and Todd 1977; Boisselier-Dubayle et al. 1996). Conversely, populations that are maintained
by very limited spore dispersal followed by extensive vegetative spread consist of one or a
few individuals and their genetically identical clones occupying a large geographic area
(Smith et al. 1992; Dickman and Cook 1989). The intermediary of these situations is seen in
Heterobasidion annosum, known to spread vegetatively (Garbelotto et al. 1997a), as well as
by spores (Garbelotto et al. 1999). Swedjmark and Stenlid (2001) found 35 genets of H.
annosum existed on a single stump of Picea abies, and speculated that spore spread and
subsequent mon - mon and di - mon pairings were the reason for such high levels of variation
on such a fine spatial scale. The results of my study indicate a reproductive strategy and
mode of spread for I. tomentosus that may be similar to this species. Large clones were the
exception rather than the rule when studying the population structure of this pathogen. The
existence of numerous small genets provides additional support for a mixed mode of
reproduction similar to that of H. annosum. Interestingly, ongoing work to compare
genotypes of I. tomentosus isolated from stumps in plantations with genotypes from adjacent
planted trees shows that genotypes isolated from trees are usually different from the
genotypes in the adjacent stumps. Additionally, stumps colonized with more than one
genotype have been found (Lewis, unpublished data). Forest researcher Richard Reich has
spent much time and effort studying /. tomentosus. He has observed gradual expansion of
disease centres in study plots over a period of 20 to 30 years centered around symptomatic
stumps, and reported that no new centres appear to develop over this time period
(unpublished data), which is typical of vegetative propagation. The results of my research do
not necessarily conflict with these observations. Vegetative spread and spore dispersal may
be acting concurrently. If spores are dispersed over a very small distance and are further

57

contained by compatibility systems in this species, than disease centres would continue to
develop in “clumps”, as has traditionally been observed.

Previous research on infection of hosts by Inonotus tomentosus has focussed heavily on root
penetration by mycelia because it is thought to be the most likely point of entry for inoculum
(Lewis and Hansen 1991a; Lewis et al. 1992; Whitney 1993). Lewis and colleagues (1992)
identified two routes of mycelial spread between hosts; direct penetration of bark on roots
less than four centimetres in diameter, and through feeder roots less than one centimetre in
diameter. Infection was not associated with root wounds in that study and there were 2 plots
in which the source of infection could not be identified. Among the likely explanations for
this was infection by spores based on the results of a companion study by Lewis and Hansen
(1991b) of several unique fungal genotypes inhabiting infected stands. Infection by spores
was also suspected by Whitney (1993) in plantations that were established on old agricultural
fields with no previous history of the disease. He postulated that the infections arose from
spores that originated in nearby unmanaged stands that harboured the disease. There may be
a shared history between the populations of some of the study sites based on the similarities
observed in the molecular markers. Although it is only speculation, it is possible that the
populations are related, established in the past between these locations via propagules (most
likely spores).

To what extent spores are viable after sporulation is unclear. Spores of 7. tomentosus have
been detected germinating underneath sporocarps on the forest floor (Whitney 1962) and
germination was shown to occur even after twenty months of storage at -18 °C (Whitney
1966). Whitney (1966) also showed that spore suspensions could cause infection in roots

58

inoculated in the field. Long-distance dispersal of spores generally leads to genetically
uniform populations over large geographical distances (Kauserud and Schumacher 2002;
Hogberg et al. 1999). Conversely, population subdivision tends to develop within species that
have a more limited ability to disperse (Stenlid et al. 1994; Hogberg and Stenlid 1999).
Partitioning of genetic variation within, rather than among, populations of species with
limited dispersal has been observed in basidiomycetes leading researchers to hypothesize that
outcrossing species tend to maintain most of their genetic variability within populations
while inbreeding species partition most variability among populations (James et al. 1999).
AMOVA results on the clone corrected data sets for I. tomentosus showed high diversity
within (69.9%) and moderate levels between (28.4%) populations of Inonotus tomentosus
indicating that most of the diversity is contained within local populations. This level of intra­
population diversity reflects out-crossing populations that are influenced by frequent
recombination and local dispersal of propagules. This does not exclude the possibility of dimon mating events or the existence of intersterility groups. The level of intra-population
variation detected contrasts with the level of linkage disequilibrium in these populations.
Significant variation between individuals (p < 0.001), as presented in Table 9 is analogous to
the inbreeding coefficient (Fis), which is a measure of the decrease in heterozygotes due to
inbreeding effects in the population. Although a high proportion of variation (70%) between
individuals within study sites alone does not necessarily indicate population sub-structure,
the significant Fis value further supports this line of reasoning and is consistent with the
hypothesis of population substructure in this species.

At this time, the infection court for spores of this pathogen is unknown. In an extensive
investigation of the germination and inoculation potential of this pathogen, Whitney (1966)
59

was not able to cause infections with basidiospore suspensions in unwounded spruce roots
nor in roots or stems with bark wounds or shallow wood wounds, although infection did
occur in deeply-wounded roots. If direct penetration of small feeder roots (Lewis et al. 1992)
is the primary means of infection, trees with larger root systems would tend to be susceptible
to infection both by spores and by mycelia from other infected roots. Lewis (1997) studied
growth reduction in spruce infected by I. tomentosus and concluded that larger trees were
more likely to be infected by this pathogen because a larger root system would lead to a
greater probability of contact with infected roots of other trees, while smaller trees would
remain uninfected longer beeause their root systems would be more isolated. My study of I.
tomentosus did not support this conclusion. I measured the DBH of all infected trees in this
study and found that the DBH of healthy trees was marginally higher than (but not
significantly different from) infected trees in both managed and unmanaged stands. This is
similar to results of surveys of diseased spruce in Alaska (Lewis, unpublished data) in which
healthy trees were larger at one site and not significantly different from infected trees at
another site. In that case, the lack of larger sized hosts was credited to selective removal of
larger trees by spruce beetle. In my study it is likely that the trees have experienced stunted
growth and decreased increment over time (Whitney 1962, Lewis 1997), but it is possible
some infected trees in my study once had a much greater relative DBH and are now similar in
size to healthy trees only beeause of a decrease in vigour due to their diseased state. The size
effect in Lewis’s 1997 study was most predominant in a site with a lower disease incidence,
therefore the larger trees would tend have a greater chance of coming into contact with more
rare inoculum assuming spread by root contacts. My study was in areas that had high
occurrence of disease so even small trees had a good chance of becoming infected.
Additionally, Lewis looked at growth increment in spruce over time while this study was

60

only a snapshot in time of unmanaged and plantation sites that were relatively young and
even-aged whieh may have contributed to the differences between the results of this study
and the conclusions made by Lewis (1997).

I also found no significant difference between the DBH of trees infected by multi-tree and
single-tree genets. This is not surprising given that the disease was advanced in many hosts
and whether they were infected by sexually produced spores or by root contacts of infected
trees, it’s likely that they had all experienced a decline in growth over time. Size of the tree
apparently had no bearing on whether the tree was infected or not, nor on the nature of the
infection (single- or multi-tree). The apparently random occurrence of infections, regardless
of tree size suggests dispersal by spores rather than a disease spread strictly by root contacts.
It is important to acknowledge that this project did not encompass the question of diseased
stumps and how they are related to the pattern of diseased trees across the landscape. This
question was addressed in part with an undergraduate thesis project that examined genotypes
of stumps and surrounding infected trees. As this study was limited in sample size, additional
research in this area is necessary before any conclusions can be drawn. The information that I
have at this time suggests that further research should be aimed at questions surrounding
spatial distribution and population genetics together to better understand population
development and spread of this pathogen.

4.3 Management Implications
Both stand types contained populations of Inonotus tomentosus that had high genotypic and
genetic diversity. Molecular markers indicated that population structure is influenced by

61

clonal propagation but that recombination is occurring relatively frequently, providing
evidence for sexual reproduction and spore dispersal. There is also evidence for the existence
of fine-scale population genetic structure due either to spatially limited spore dispersal or the
existence of small isolated sub-groups within the populations that were sampled.

I failed to rejeet the null hypothesis of no difference in population genetic structure between
plantations and unmanaged stands. The genetic characteristics of populations (i.e. genotypic
variation, marker diversity, heterozygosity and linkage disequilibrium) were similar for all
six study sites. Analysis of molecular variance of RAPD markers revealed no significant
differences in allele frequencies between stand types, although there was signifieant
difference in genetic variation between all of the individual sites.

In a pathogen population that spreads readily through root contacts one might expect to see
ample evidence of elonal development in dense young spruce monocultures, but this was not
the case. Higher spruce density is generally thought to lead to an increased incidence of
disease due to a greater number of root contaets (Lewis and Hansen 1991a; Whitney 1980).
Furthermore, Lewis (1997) stated that trees growing in stands with high spruce density are
more likely to beeome infected at an earlier age. Conversely, Bernier and Lewis (1999)
examined site and soil characteristics as related to Tomentosus Root Rot and found no
significant relationship between spruce density and disease incidence. As previously stated,
the level of variation in the plantations was indicative of an outcrossing, sexually reproducing
pathogen and remarkably indistinguishable from the population strueture of the same species
in unmanaged stands, both spatially and genetically. Although I did not measure disease
incidence direetly, the limited amount of clonal development in managed study sites and the
62

similarity of population size and structure between unmanaged, mixed-species sites and
spruce monocultures indicates that stand composition and host density has little impact on
disease incidence, which agrees with the findings of Bernier and Lewis (1999).

The only distinct difference between stand types was seen in the quantification of genets per
unit of spruce basal area. There was an observable difference between stand types by this
measure of variation. The sample sizes were too small to test the statistical significance of
these measures. The number of unique genets per square meter of spruce was higher in study
sites located in plantations than in unmanaged stands. This could be an artefact of the
difference in basal area between the two stand types; as the plantation stands grow and basal
area increases, the ratio of genets per unit basal area would decline. However, when the mean
spruce basal area from the unmanaged forests is used as an example of mature basal area for
the plantations, the number of unique genets per unit spruce basal area does not decline
below that found in the old growth forests except for plantation 3 (0.56, 0.44 and 0.16
respectively). This finding indicates that genotypic diversity appears to be at least maintained
when forests are harvested and then artificially regenerated.

The lack of difference between the population structures of this pathogen in unmanaged and
managed study sites is in itself informative. The density of host populations typically has a
strong impact on the pathogen population structure (Burdon 1993; Burdon and Chilvers 1982)
and in the managed study sites, spruce density is substantially higher than in unmanaged
stands. Based on these facts and most work on I. tomentosus in spruce stands (Lewis 1992),
increased clonal development was expected in spruce plantations but was not observed. This

63

leads to the conclusion that the stem densities in the study sites investigated in this research
project had no impact on population structure or clone size of I. tomentosus.

I speculate that in addition to spreading vegetatively, this species may release spores that,
being the product of meiotic recombination, have new and unique combinations of alleles
including those that code for vegetative compatibility. In addition to this, di-mon matings
may be occurring between established genets and newly formed monokaryotic hyphae
established from spores. This could potentially be the source of clusters of genetically
distinct clones that are somatically compatible. From the identities of the genets and their
historical relationships based on mitochondrial markers and vegetative compatibility
groupings, it appears that the spores may spread a moderate distance from their origin before
becoming established on a new host. Although the architecture of the roots of individual trees
in these sites is unknown, Lewis and Hansen (1991a) found that colonized spruce stump roots
occupy an average of 8.3 m^. Based on this estimate, and using a more conservative
assumption that genotypes of the same VC group originated from spores of the same source
(rather than genotypes sharing the same mitochondrial markers) which were measured as
being 1 to 14 m from one another (av. = 6.3 m) in unmanaged stands and 1 to 16 meters in
plantations (av. = 5.4 m) (data not shown), spores may be able to infect trees that are greater
than 10 meters away from each other. Furthermore, although one mode of spread may occur
more frequently than the other depending on site conditions, it is likely that both types of
spread occur in concert to produce the patchy, highly diverse population structure observed
in these unmanaged spruce stands.

64

Plantation sites PI, P2, and part of P3 contain a similar pattern to that observed in the
younger unmanaged stands (U2 and U3). There are many clustered genets that share the same
VC identity as well as several spatially isolated fungal genets that are unique in their VC
identity and even their mitochondrial history. Again, the pattern of the population structure of
7. tomentosus in these sites illustrates a dual mode of spread. Despite high concentrations of
spruce, there is minimal clonal growth apparent in PI and P2. This could be due to reasons
such as competition from other vegetation or unfavourable soil conditions. The population
structure of the pathogen suggests that something has occurred in these sites to cause
observable patterns of unique, spatially distinct genets. Given the age of the plantations and
the extent of the genetic differences detected, mutation is an unlikely cause of the level of
variation seen in these populations (Lewis and Hansen 1991b) and the fungus could not have
spread a great distance clonally based on its minimum known rate of spread (Whitney 1962).
It is likely that there were several genets harboured in old stumps on the sites before planting
which became established on the young spruce trees. Of interest is the clone that occurred in
study site P3. This site underwent a severe burn after harvesting, evidence of which was still
apparent on many old stumps. Perhaps this treatment negatively affected the ability of the
pathogen to disperse by spores by destroying the disseminated dormant spores in the duff
layer. There is evidence for restriction of spore spread by fire for Phellinus weirii (Dickman
and Cook 1989). If this is the case, it could explain the success of the large genet in site P3.
Unimpeded by competition from several other spore-dispersed genets, a vegetatively
spreading genet could grow extensively in such a substrate rich environment. The genet in
study site P3 suggests that fire should perhaps be investigated as a potential method of
inhibiting the spread of spores of this pathogen. If so, the use of controlled burning to
decrease the occurrence of spore infections in addition to removal of infected stumps to avoid
65

vegetative spread may be a an effective method of treating stands infected with TRR. This
speculation is based on a single observation. As such, additional research would be necessary
to test this hypothesis.

The significance of these findings in regards to management of stands infected with
Tomentosus Root Rot are that the causal agent, /. tomentosus must be viewed as a pathogen
that is fully capable of both vegetative and sexual reproduction. TRR is described in the Root
Disease Management Guidebook as spreading by vegetative propagation alone and is
currently managed for under this premise. In a Technology Transfer Note published by
Natural Resource Canada on root disease in 2000, spore-initiated infections for /. tomentosus
are described as “infrequent”. My study provides evidence to the contrary, that the pathogen
is likely spreading concurrently via both types of reproduction. It is possible that subtle
ecological factors promote one or the other at different times in the development of the host
stand. It is also apparent that increased density of host species in even-aged monoculture
plantations does not promote clonal development over spore-mediated infection within
populations of this pathogen. Instead, there are a variety of individual infectious genets
established throughout these stands indicating frequent recombination and dispersal events.

Current approaches to root disease management range from no treatment, to planting less
susceptible or immune species, to mechanical removal of inoculum (i.e. stumping) (Sturrock
2000). Planting less susceptible or resistant species as a treatment option for TRR is
challenging because it attacks a wide range of conifers, although not to the same severity,
including several economically important species and there are few other conifers that grow
well in northern climates. In addition to economic pressures to select species that will provide

66

financial return, the potential ecological impacts of this method could be substantial. Insect
and fungal pests tend to be most harmful when plants are stressed by poor soils, erowding or
other unfavourable environmental conditions (Odum 1985). Conditions such as these may
develop in single speeies plantations, leading to extensive damage. Thinning is also
suggested as an effective method of controlling the pathogen in infected stands, due in part to
the clumpy nature of the occurrence of this disease and based on the assumption that root
contacts are the primary mode of spread between hosts (Whitney 1980).

Stumping acts to remove the majority of the inoculum and leads to desiccation of the stump
and associated infectious material. An Ontario study reported that the proportion of dominant
and co-dominant trees killed by TRR was reduced as a result of this treatment (Whitney
1993). Trials to test the effectiveness of stumping to manage TRR are underway, but it will
be several years until the results will be analyzed and published (Dr. Eric Allen, per s. comm.).
There is no evidence yet that stumping is an effective control for this disease. Early
observations suggest that there is improved growth of regenerated trees in stumped sites but
this may be due to soil mixing and the fact that there was better competition control from
shrubs and herbaceous growth where the site was stumped (Alex Woods, pers. comm).
Conversely, in a reeent study published by Delong and colleagues (2005) inoeulum reduction
through stumping was found to have no effect on seedling survival or inoculum reduction.
This study was after 5 years of treatment only, therefore the long-term effects of this
treatment are not known. This type of inoculum removal may be the most appropriate way to
manage for this disease considering that myeelia within roots are sources of new infections
whether they contaet and directly penetrate the roots of another host, or they produce fruiting
bodies leading to spore production and dispersal. At this time the extent of fruiting body

67

production over time from infected stumps in clear cuts is not known. Production of fruiting
bodies by this species is irregular and is dependent on environmental conditions.

The benefits and costs of carrying out stumping are further reviewed by Sturrock (2000).
Sturrock notes there are additional benefits from stumping such as increased productivity of
regenerated species because of soil mixing and removal of herbaceous growth (as observed
for stumping treatments of TRR by Woods (pers. comm.)), but the cost of stumping makes
the operation an unappealing treatment to forest managers. Two published studies on
inoculum removal for Phellinus weirii and Armillaria root disease suggest that the cost of
inoculum removal may be justified by the rates of return in cases of high disease incidence
by reducing disease-related losses in harvested stands (Russel et al. 1986; Shaw and
Calderon 1977).

5.0 Conclusions and Future Research Directions

An ecologically and economically important fungal pathogen, I. tomentosus appears to
spread through a combination of clonal propagation by root-to-root contacts and substantial
basidiospore spread. This study is the first to collect and present extensive population genetic
structure data for /. tomentosus to make it available for future use in forest management
applications and in forest health research.

Vegetative compatibility (VC), random amplified polymorphic DNA (RAPDs) and single
strand conformation polymorphism (SSCP) revealed high genotypic variation within all
populations, as well as moderate levels of marker (gene) diversity, significant linkage
68

disequilibrium, significant deviation from Hardy-Weinberg Equilibrium and high intra­
population variation. These results indicate some clonal propagation is occurring in these
populations but that frequent recombination (i.e. sexual reproduction) and subsequent spore
dispersal is the most likely cause of the high level of genotypic diversity observed in these
sites. High intra-population variation and a significant decrease in heterozygosity due to
inbreeding effects, while not entirely conclusive, is consistent with the hypothesis of small
interbreeding sub-groups within the sampled populations. There was no apparent difference
in the population structure of this pathogen between unmanaged mixed-species stands and
spruce plantations, however, the results present strong evidence that this species is capable of
spreading by spores. The ability of I. tomentosus to spread via spores should be taken into
consideration when developing management guidelines for this pathogen.

There are many aspects of the biology of Inonotus tomentosus that are not yet known. A
basic understanding of the sexual and somatic compatibility systems is required to properly
assess gene flow within and between fungal populations and to understand the distribution
and spatial relationships of genets in infected stands. In the few studies that have been done
on some Inonotus species and the closely related genus Phellinus, most species have been
found to be heterothallic with a unifactorial mating system (Fischer 1987, 1994; Angwin and
Hansen 1993). Pairing tests to confirm the systems of mating compatibility and somatic
incompatibility in I. tomentosus would fill a knowledge gap that exists concerning the basic
biology of this fungus and would result in additional tools for use in discerning relationships
between genets.

69

The high level of intra-population variation within each study site provides evidence for the
existence of spatially limited inter-breeding groups within each population. A sampling
methodology that uses several spatial scales to investigate the existence of sub-groups and to
quantify the area or distance that an interbreeding unit might occupy could prove to be highly
informative for future studies of the population biology of this pathogen. Several scales of
measurement could increase the resolution of the data and assist in inferring more explicitly
the extent to which genets are inter-breeding, to what distance offspring are dispersed and if
distinct sub-groups do exist.

It cannot be established at this time the extent to which mutation, the Buller phenomenon and
the parasexual cycle contribute to the variation that exists within these populations. Based on
an understanding of other closely related pathogens like Heterobasidion annosum and the
extent of shared characteristics between these and I. tomentosus, it is likely that the variation
observed in this study is primarily a result of basidiospore production and dispersal. If this is
true than the next step is to investigate how and where this pathogen infects its host within a
stand. Spore viability and germination, studied in detail by Whitney (1966) was found to be
highly variable. Past research suggested that stump tops were not a viable infection court
(Myren and Patton 1971), but perhaps this conclusion should be re-examined. Furthermore,
new molecular tools and advances in microscopy and staining techniques are now being
applied in studies of basidiospores (Miller et al. 1993) and may provide more conclusive
results regarding the viability, dormancy and activation of spores.

70

Literature Cited
Adams DH and Roth LF. 1967. Demarcation lines in paired cultures of Fames cajanderas, a
basis for detecting genetically distinct mycelia. Canadian Journal o f Botany. 45:1585-1589.
Agrios GN. 1997. Plant Pathology, Fourth Edition. Academic Press. San Diego, California,
pp. 635.
Alexopoulos CJ, Mims CW, Blackwell M. 1996. Introductory Mycology. 4th ed. USA: John
Wiley & Sons Inc. pp. 589.
Allen E, Morrison D, Wallis G. 1996. Common Tree Diseases of British Columbia. Canadian
Forest Service. Pacific Forestry Centre, pp 178.
Anderson JB and Kohn LM. 1995. Clonality in soilborne plant pathogenic fungi. Annual
Review o f Phytopathology. 33:369-391.
Anderson JB and Kohn LM. 1998. Genotyping, gene genealogies and genomics bring fungal
population genetics above ground. Tree. 13(11):444-449.
Angwin PA and Hansen EM. 1993. Pairing tests to determine mating compatibility in
Phellinus weirii. Mycological Research. 97(12): 1469-1475.
Avise JC. 1994. Moleeular Markers, Natural History and Evolution. Chapman & Hall Inc.
New York, NY. pp 511.
Barret DK and Uscuplic M. 1971. The field distribution of interacting strains of Polyporus
schweinitzii and their origin. New Phytologist. 70:581-598.
Basham JT and Morawski ZJR. 1964. Cull studies, the defects and associated basidiomycete
fungi in the heartwood of living forest trees in the forests of Ontario. Ottawa: Canadian
Department of Forestry.
Bernier D and Lewis KJ. 1999. Site and soil eharaeteristies related to the incidence of
Inonotus tomentosus. Forest Ecology and Management. 120:131-142.
Boisselier-Dubayle MC, Perreau-Bertrand J, Lambourdier J. 1996. Genetic variation in wild
populations o f Mycena rosea. Mycological Research. 100:753-758.
Bonello P, Bruns TD, Gardes M. 1998. Genetic structure of a natural population of the
ectomycorrhizal fungus Suillus pungens. New Phytologist. 138:533-42.
Bos CJ. 1996 Somatie recombination, pp. 73-95 in Fungal Genetics, Principles and Practice,
edited by C. J. Bos. Marcel Dekker, New York.
Burdon JJ. 1993. The strueture of pathogen populations in natural plant eommunities. Annual
Review o f Phytopathology. 31:305-323.

71

Burdon JJ and Chilvers GA. 1982. Host density as a factor in plant disease ecology. Annual
Review o f Phytopathology. 20:143-166
Burdon JJ and Silk J. 1997. Sources and patterns of diversity in plant pathogenic fungi.
Phytopathology. 87(7):664-669.
Caligiorne RB, Resende MA, Paiva E, Azevedo V. 1999. Use of RAPD (random amplified
polymorphic DNA) to analyze genetic diversity of dematiacious fungal pathogens. Canadian
Journal o f Microbiology 45:408-12.
Ceresini PC, Shew DH, Vilgalys RJ, Rosewich UL, Cubeta MA. 2002. Genetic structure of
populations of Rhizoctonia solani AG-3 on potato in eastern North Carolina. Mycologia.
94(3): 450-460.
Chase TE. 1985. Genetics of sexuality and spéciation in the fungal pathogen, Heterobasidion
annosum. Ph.D. Thesis. University of Vermont, Burlington.
Chase TE and Ullrich RC. 1983. Sexuality distribution and dispersal of Heterobasidion
annosum in pine plantations of Vermont. Mycologia. 75(5):825-831.
Chase TE and Ullrich RC. 1990. Five genes determining intersterility in Heterobasidion
annosum. Mycologia 82:73-81.
Chen F, Goodwin PH, Khan A, Hsiang T. 2002. Population structure and mating-type genes
of Colletotrichum graminocola from Agrostis palustris. Canadian Journal o f Microbiology
48:427-436.
Childs TW. 1963. Poria weirii Root Rot. Phytopathology. 53(1): 1124-1127.
Childs TW. 1970. Laminated Root Rot of Douglas-fir in Western Oregon and Washington.
USDA Forest Service Paper PNW-102. Portland, Oregon.
Chung MG and Epperson BK. 1999. Spatial genetic structure of clonal and sexual
reproduction in populations of Adenophora grandiflora (Campanulaceae). Evolution. 53(4).
1068-1078.
Coates D and Rayner ADM. 1985. Heterokaryon-homokaryon interactions in Stereum
hirsutum. Proceedings o f the British Mycological Society. 84(4):637-645.
Coates D, Rayner DM, Boddy L. 1985. Interactions between mating and somatic
incompatibility in the basidiomycete Stereum hirstum. New Phytologist. 99:473-483.
Cook LM. 1991. Genetic and Ecological Diversity: The sport of nature. Chapman and Hall.
London, England, pp 192.

72

Dahlberg A. 1997. Population ecology of Suillus variegatus in old Swedish Scots pine forests.
101(l):47-54.
Dahlberg BA and Stenlid J. 1990. Population structure and dynamics in Suillus bovinus as
indicated by spatial distribution of fungal clones. New Phytologist. 115:487-493.
Davidson AG and Redmond DR. 1957. Decay of spruce in the maritime provinces. Forestry
Chronicle 33:374-80.
DeLong DL, Simard SW, Comeau PG, Dykstra PR, Mitchell SJ. 2005. Survival and growth
response of seedlings in root disease infected partial cuts in the Interior Cedar Hemlock zone
of south eastern British Columbia. Forest Ecology and Management. 206:365-379.
Dettman JR and van der Kamp BJ. 2001a. The population structure of Armillaria ostoyae in
the southern interior of British Columbia. Canadian Journal o f Botany. 79:612-620.
Dettman JR and van der Kamp BJ. 2001b. The population structure of Armillaria ostoyae
and Armillaria sinapina in the southern interior of British Columbia. Canadian Journal o f
Botany. 79:600-611.
Dickman A and Cook S. 1989. Fire and fungus in a mountain hemlock forest. Canadian
Journal o f Botany. 67:2005-2016.
Dimitri L and Schumann G. 1989. Further experiments on the hostparasite relationship
between Norway spruce and Heterobasidion annosum - In: Morrison DJ (ed.) Proceedings of
the seventh international conference on root and butt rots. Forestry Canada Pacific Forestry
Centre, Victoria BC. pp. 171-179.
Douhan GW, Peever TL, Murray TD. 2002. Multilocus population structure of Tapesia
yallundae in Washington State. Molecular Ecology 11:2229-2239.
Excoffier L, Schneider S, Roessli D. 2000. Arlequin V. 2000: A software for population
genetic analysis. Genetics and Biometry Laboratory, University of Geneva, Switzerland.
Farnet AM, Roux M, Le Petit J. 1999. Genotypic variations among isolates of Marasmus
quercophilus, a white-rot fungus isolated from evergreen oak litter. Canadian Journal o f
Botany 77:884-90.
Fries EM. 1821. Systerna Mycologium. Vol. 1.
Garbelotto MA, Bruns TD, Cobb FW, Otrosina WJ. 1993. Differentiation of intersterility
groups and geographic provenances among isolates of Heterobasidion annosum detected by
random amplified polymorphic DNA assays. Canadian Journal o f Botany 71: 565-69.
Garbelotto MA, Ratcliff A, Bruns TD, Cobb FW, Otrosina WJ. 1996. Use of taxon specific
competitive-priming PCR to study host specificity, hybridization and intergroup gene flow in
intersterility groups of Heterobasidion annosum. Phytopathology 86, no. 5: 543-51.
73

Garbelotto, MA, Slaughter G, Popenuck T, Cobb FW, Bruns TD. 1997a. Secondary spread of
Heterobasidion annosum in white fir root-disease centers. Canadian Journal o f Forest
Research. 27:766-773.
Garbelotto MA, Cobb FW, Bruns TD, Otrosina WJ, Popenuck T, Slaughter G. 1997b. The
distribution of genets and their nuclear composition reveal the dynamics of establishment and
survival of Heterobasidion annosum in white fir stands. Root and Butt Rots o f Forest Trees.
Carcans-Maubuisson, France. September 1-7. Paris.
Garbelotto MA, Lee HK, Slaughter G, Popenuck T, Cobb FW, Bruns TD. 1997c.
Heterokaryosis is not required for virulence of Heterobasidion annosum. Mycologia. 89(1):
92-102.
Garbelotto MA, Cobb FW, Bruns TD, Otrosina WJ, Popenuck T, Slaughter G. 1999. Genetic
structure of Heterobasidion annosum in white fir mortality centers in California.
Phytopathology 89, no. 7:546-54.
Germain GL, Laflamme G, Bernier L, Boulet B, Hamelin RC. 2002. DNA polymorphism
and molecular diagnosis in Inonotus spp. Canadian Journal o f Plant Pathology 24:194-99.
Gherbi H, Delaruelle C, Selosse MA, Martin F. 1999. High genetic diversity in a population
of the ectomycorrhizal basidiomycete Laccaria amethystina in a 150-year-old beech forest.
Molecular Ecology. 8:2003-2013.
Gilbertson, R. L. 1986. North American Polypores. Vol. 1. Oslo, Norway: Fungiflora A/S.
Gillespie JH. 1998. Population Genetics: A Concise Guide. The Johns Hopkins University
Press. Baltimore, Maryland, pp. 174.
Goggioli V, Capretti P, Hamelin RC, Vendramin G. 1998. Isozyme and RAPD
polymorphisms in Heterobasidion annosum in Italy. European Journal o f Eorest Pathology
28:63-74.
Gonthier P, Garbelotto M, Cristina G, Nicolotti G. 2001. Relative abundance and potential
dispersal range of intersterility groups of Heterobasidion annosum in pure and mixed forests.
Canadian Journal o f Botany. 79:1057-1063.
Grimes JP. 1974. Vegetation classification by reference to strategies. Nature. 250:26-30.
Hamelin RC. 1996. Genetic diversity between and within cankers of the white pine blister
rust. Genetics 86(8):875-879.
Hamelin RC. 1998. Molecular epidemiology of white pine blister rust. Saariselka, Finland:
Finnish Forest Research Institute. 255-259.

74

Hamelin RC, Beaulieu J, Plourde A. 1995a. Genetic diversity in populations of Cronartium
ribicola in plantations and natural stands of Pinus strobus. Theoretical and Applied Genetics
91:1214-21.
Hamelin RC, Lecours N, Hansson P, Hellgren M, Laflamme G. 1995b. Genetic
differentiation within the European race of Gremmeniella abietina. Mycological Research
100(l):49-56.
Hamelin RC, Hunt RS, Geils BW, Jensen GD, Jacobi V., Lecours N. 2000. Barrier to gene
flow between eastern and western populations of Cronartium ribicola in North America.
Phytopathology. 90(10): 1073-1078.
Hansen EM, Stenlid J, Johansson M. 1993. Somatic incompatibility and nuclear reassortment
in Heterobasidion annosum. Mycological Research. 97(10): 1223-1228.
Hansen EM. 1979. Survival of Phellinus weirii in Douglas-fir stumps after logging.
Canadian Journal o f Forest Research. 9:484-488.
Hartl DL. 1988. A Primer of Population Genetics. Sinaur Associates Inc. Mass. USA. pp. 305.
Hegedus DD and Khachatourians GG. 1996. Identification and differentiation of the
entomopathogenic fungus Beauveria bassiana using polymerase chain reaction and single
strand conformation polymorphism analysis. Journal o f Invertebrate Pathology 67:289-299.
Hendrix FF and Kuhlman EG. 1964. Root infection of Pinus elliottii by Fomes annosus.
Nature. 201:55-56.
Hintz WEA, Anderson JB, Horgen PA. 1988. Nuclear migration and mitochondrial
inheritance in the mushroom Agan'cM^ bitorquis. Genetics 119:35-41.
Hodges CS Jr. 1969. Modes of infection and spread of Fomes annosus. Annual Review o f
Phytopathology. 7:247-266.
Hogberg N and Stenlid J. 1999. Population genetics of Fomitopsis rosea - a wood decay
fungus of the old - growth European taiga. Molecular Ecology. 8:703-710.
Hogberg N, Holdenrieder O, Stenlid J. 1999. Population structure of the wood decay fungus
Fomitopsis pinicola. Heredity. 83:354-360.
Hsiang Tand Mahuku GS. 1999. Genetic variation within and between southern Ontario
populations of Sclerotinia homeocarpa. Plant Pathology. 48:83-94.
Hunt RS and Unger L. 1994. Forest Pest Leaflet: Tomentosus Root Disease. Forest Insect
and Disease Survey, Forestry Canada.
Hunt RS. 1997. Differential medium for Phellinus pini and Inonotus tomentosus. Canadian
Journal o f Plant Pathology. 19:307-309.
75

Hunt RS and Peet FG. 1997. Annual spread rate of Tomentosus Root Disease. Plant Disease.
81(9): 1053-1056.
James TY, Hamerick JL, Vilgalys R. 1999. Evidence for limited intercontinental gene flow in
the cosmopolitan mushroom, Schizophyllum commune. Evolution. 53: 1665-1667.
Jacobsen KM, Miller OK Jr., Turner, BJ. 1993. Randomly amplified polymorphic DNA
markers are superior to somatic incompatibility tests for discriminating genotypes in natural
populations of the ectomycorrhizal fungus Suillus granulatus. Proceedings o f the National
Academy o f Sciences o f the USA. 90:9159-9163.
Kauserud H and Schumacher T. 2002. Population structure of the endangered wood decay
fungus Phellinus nigrolimitatus (Basidiomycota). Canadian Journal o f Botany 80:597-606.
Kim M, Klopfenstein NB, McDonald GI, Kathiravetpillai A, Vidaver AK. 2000.
Characterization of North American Armillaria species by nuclear DNA content and RFLP
analysis. Mycologia. 92(5):874-883.
Kjoiler R and Rosendahl S. 2000. Detection of arbuscular mycorrhizal fungi (Glomales) in
roots by nested PCR and SSCP (single stranded conformation polymorphism). Plant and Soil.
226:189-196.
Korhonen K. 1978. Intersterility groups of Heterobasidion annosum. Communicationes
Instituti Forestalis Fenniae. 94:1-25.
Krebs CJ. 1985. Ecology: The Experimental Analysis of Distribution and Abundance, 3'^^ ed..
Harper and Row Publishers Inc. New York, NY. pp. 800.
Lenski RE. 1993. Assessing the genetic structure of microbial populations. Proceedings o f
the National Academy o f Sciences o f the USA. 90:4334-4336.
Leslie JF. 1993. Fungal vegetative compatibility. Annual Review o f Phytopathology. 31:127150.
Lewis KJ. 1990. Epidemiology and population biology of Inonotus tomentosus as a pathogen
of forests of British Columbia. Ph D Thesis. Oregon State University.
. 1997. Growth reduction in spruce infected by Inonotus tomentosus in central British
Columbia. Canadian Journal o f Forest Research 27:1669-74.
Lewis KJ, Morrison DJ, Hansen EM. 1992. Spread of Inonotus tomentosus from infection
centers in spruce forests in British Columbia. Canadian Journal o f Forest Research. 22:6872.

76

Lewis KJ and Hansen EM. 1991a. Survival of Inonotus tomentosus in stumps and subsequent
infection of young stands in north central British Columbia. Canadian Journal o f Forest
Research. 21:1049-1057.
. 1991b. Vegetative compatibility groups and protein electrophoresis indicate a role
for basidiospores in spread of Inonotus tomentosus in spruce forests of British Columbia.
Canadian Journal o f Botany. 69:1756-1763.
Lewis K J and Lindgren SB. 1999. Influence of decay fungi on species composition and size
class structure in mature Picea glauca x engelmannii and Abies lasiocarpa in sub-boreal
forests of central British Columbia. Forest Ecology and Management. 123:135-143.
. 2000. A conceptual model of biotic disturbance ecology in the central interior of BC:
How forest management can turn Dr. Jekyll into Mr. Hyde. The Forestry Chronicle. 76(3):
433-443.
. 2002. Relationship between spruce beetle and Tomentosus Root Disease: two
natural disturbance agents of spruce. Canadian Journal o f Forest Research. 32:31-37.
Lewis KJ, Morrison DJ, Hansen EM. 1992. Spread of Inonotus tomentosus from infection
centers in spruce forests in British Columbia. Canadian Journal o f Forest Research. 22:6872.
Lewontin RC. 1995 The detection of linkage disequilibrium in molecular sequence data.
Genetics. 140:377-388.
Lumley TC, Gignac DL, Currah, RS. 2001. Microfungus communities of white spruce and
trembling aspen logs at different stages of decay in disturbed and undisturbed sites in the
boreal mixed wood region of Alberta. Canadian Journal o f Botany. 79:76-85.
Lundquist JE and Klopfenstein NB. 2001. Integrating concepts of landscape ecology with the
molecular biology of forest pathogens. Forest Ecology and Management. 150:213-22.
Lynch M and Milligan BG. 1994. Analysis of population genetic structure with RAPD
markers. Molecular Ecology. 3:91-99.
Mackinnon A, DeLong C, Meidinger D. 1990. A field guide for identification and
interpretation of ecosystems of the northwest portion of the Prince George forest region. BC
Forest Service, BC Ministry of Forests, Victoria, BC.
May G and Taylor JW. 1988. Patterns of mating and mitochondrial DNA inheritance in the
agaric basidiomycete, Coprinus cinereus. Genetics. 118:213-220.
Maynard Smith J, Smith NH, O’Rourke M, Spratt BG. 1993. How clonal are bacteria?
Proceedings o f the National Academy o f Sciences o f the USA 90:4384-4388.

77

McDonald, BA. 1997. The Population Genetics of Fungi: Tools and Techniques.
Phytopathology. 87(4):448-453.
McDonald BA, Zahn J, Burdon JJ. 1999. Genetic Structure of Rhynchosporium secalis in
Australia. Phytopathology. 89: 639-645.
McCarthy J. 2001. Gap dynamics of forest trees; A review with particular attention to boreal
forests. Environmental Review 9:1-59.
Merler HA. 1984. Tomentosus Root Rot of White Spruce in Central British Columbia.
Master’s thesis. University of British Columbia, Vancouver, BC.
Merler HA, Schulting PJ, van der Kamp BJ. 1988. Inonotus tomentosus (Fr.) Teng in central
British Columbia. In Proceedings of the 7'*’ International Conference on Root and Btt Rots,
Vernon and Victoria, BC. August 9-16, 1988. lUFRO working party S2.06.01. Edited by
Morrison D. Forestry Canad, Pacific Forestry Centre, Victoria BC. pp 550-562.
Milgroom MG. 1996. Recombination and the multilocus structure of fungal populations.
Annual Review o f Phytopathology. 34:457-477.
Milgroom MG and Cortesi P. 1999. Analysis of population structure of the chestnut blight
fungus based on vegetative incompatibility genotypes. Proceedings o f the National Academy
o f Science USA: Population Biology. 96(18): 10518-10523.
Milgroom MG, Lipari SE, Powell, WA. 1992. DNA fingerprinting and analysis of population
structure in the Chestnut Blight Fungus Cryphonectria parasitica. Genetics. 131:297-306.
Miller SL, Torres P, McClean TM. 1993. Basidiospore viability and germination in
ectomycorrhizal and saprotrophic basidiomycetes. Mycological Research. 97(2): 141-149.
Ministry of Forests (MoF). 1995. Forest Practices Code: Root Disease Management
Guidebook. British Columbia, Canada.
Myren DT and Patton RF. 1971. Establishment and spread of Polyporus tomentosus in pine
and spruce plantations in Wisconsin. Canadian Journal o f Botany 49:1033-40.
Nauta MJ, Hoekstra RF. 1994. Evolution of vegetative incompatibility in filamentous
ascomycetes. I. Deterministic Models. Evolution. 48(4):979-995.
Nei M. 1973. Analysis of gene diversity in sub-divided populations. Proceedings o f the
National Academy o f Sciences o f the USA. 70:3311-3315.
Nei M. 1978 Estimation of average heterozygosity and genetic distance from a small number
of individuals. Genetics 89:583-590.
Newbery JE. 2001. Small scale disturbances and stand dynamics in Inonotus tomentosus
infected and uninfected old-growth and partial cut wet, sub-boreal forests in British
78

Columbia. M.Sc. thesis, Faculty of Natural Resources and Environmental Studies, University
of Northern British Columbia, Prince George, BC.
Nobles MK. 1948. Studies in Forest Pathology. VI. Identification of wood-rotting fungi.
Canadian Journal o f Research. 26:281-431.
Norris D, Cruickshank M, Morrison D. 2003. Root and Butt Rot: a sustainable forestry issue.
Pacific Forestry Centre. Canadian Forest Service. Poster.
Odum, EP. 1985. Trends expected in stressed ecosystems. Bioscience. 35(7):419-422.
Oliver CD and Larson BC. 1996. Forest Stand Dynamics: Update Edition. John Wiley and
Sons. Toronto, Canada, pp. 520.
Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T. 1989. Detection of polymorphisms
of human DNA by gel electrophoresis as single strand conformation polymorphisms.
Proceedings o f the National Academy o f Science, USA. 86:2766-2770.
Otrosina WJ, Chase TE, Cobb FW. 1992. Allozyme differentiation of intersterility groups of
Heterobasidion annosum isolated from conifers in the western United States. Phytopathology
82:540-545.
Otrosina WJ, Chase TE, Cobb FW, Karhonen K. 1993. Population structure of
Heterobasidion annosum from North America and Europe. Canadian Journal o f Botany
71:1064-1071.
Overholts LO. 1953. The Polyporaceae of the United States, Alaska and Canada. University
of Michigan Press, Ann Arbor Michigan, USA.
Patton RF and Myren DT. 1968. Polyporus tomentosus root rot in pine an spruce plantation
in Wisconsin. First International Congress o f Plant Pathology .
Printzen C, Lumbsch HT, Schmitt I, Feige GB. 1999. A study of the genetic variability of
Biatora helvola using RAPD markers. Lichenologist. 31(5):491-499.
Rayner ADM and Todd NK. 1977. Intraspecific antagonism in natural population of Wooddecaying basidiomycetes. Journal o f General Microbiology. 103:95-90.
Risbeth J. 1951. Observations on the biology of Fomes annosus with particular reference to
East Anglian pine plantations (II) spore production, stump infection and saprophytic activity
in stumps. Annals o f Botany. 15:1-21.
Russel K, Johnsey R. Edmonds R. 1986. Disease and insect management for Douglas-fir. P
189-207 in Douglas-fir: stand management for the future. CD Oliver, DP Hanley and JA
Johnson, eds. College of Forest Resources, Institute of Forest Resources, Contribution No. 55.
University of Washington, Seattle.

79

Saupe SJ, Glass, NL. 1997. Allelic specificity at the het-e heterokaryon incompatibility locus
of Neurospora crassa is determined by a highly variable domain. Mycologia. 46:1299-1309.
Schnitzer SA, and Carson WP. 2001 Treefall gaps and the maintenanee of species diversity
in a tropical forest. Eeology. 82(4):913-919.
Shaw CG, Calderon S. 1977. Impact of Armillaria root rot in plantations of Pinus radiata
established on sites converted from indigenous forest. New Zealand Journal of Forest
Science. 7:359-373.
Slatkin M. 1994. Linkage disequilibrium in growing and stable populations. Genetics.
137:331-336.
Smith ML, Duehesne LC, Bruhn JN, Anderson JB. 1990. Mitochondrial genetics in a natural
population of the plant pathogen Arm///ana. Genetics. 126:575-582.
Smith ML, Bruhn JN, Anderson JB. 1992. The fungus Armillaria bulbosa is among the
largest and oldest living organisms. Nature. 356:428-431.
Stenlid J. 1985. Population structure of Heterobasidion annosum as determined by somatic
incompatibility, sexual incompatibility and isoenzyme patterns. Canadian Journal o f Botany
63:2268-2273.
Stenlid J, Karlsson J, Hogberg N. 1994. Intraspecific genetic variation in Heterobasidion
annosum revealed by amplification of minisatellite DNA. Mycological Research. 98(l):57-63.
Stenlid J and Redfern PB. 1998. Spread within the tree and stand. In Heterobasidion
annosum; biology, eeology, impact and control. Ed. by Woodward S, Stenlid J, Karjalainen
R, Huttermann A. CAB International Oxon U.K. pp.124-141.
Stenlid J and Vasiliauskas R. 1998. Genetic diversity within and among vegetative
eompatibility groups of Sterum sanguinolentum determined by arbitrary primed PCR.
Moleeular Eeology. 7:1265-1274.
Stoddart JA and Taylor JE. 1988. Genotypic Diversity: Estimation and Prediction in Samples.
Genetics. 118:705-711.
Storfer A. 1996. Quantitative genetics: a promising approach for the assessment of genetic
variation in endangered species. Tree. 11(8):343-348.
Sturroek RN. 2000. Management of root diseases by stumping and push-falling. Teehnology
Transfer Note. Forestry Researeh Applications. Pacific Forestry Centre, no. 16 pp. 8.
Swedjmark G and Stenlid J. 2001. A highly diverse population of Heterobasidion annosum in
a single stump of Picea abies. Mycological Research 105(2): 183-189.
Teng, S. C. 1964. Fungi o f China. Ed. by Korf RP. Ithaca: Mycotaxon, Ltd. pp 586.

80

Tkacz BM and Baker FA. 1991. Survival of Inonotus tomentosus in spruce stumps after
logging. Plant Disease. 75(8):788-90.
Todd NK and Rayner ADM. 1980. Fungal Individualism. Scientific Progress. Oxford.
66:331-354.
Urbanelli S, Della Rosa V, Fanelli C, Fabbri AA, Reverberi M. 2003. Genetic diversity and
population structure of the Italian fungi belonging to the taxa Pleurotus eryngii (DC.:Fr.)
Quel and P.ferulae (DC.: Fr.) Quel. Heredity. 90:239:259.
van der Kamp BJ. 1991. Pathogens as agents of diversity in forested landscapes. The
Forestry Chronicle. 67(4):353-354.
Viaud M, Pasquier A, Brygoo Y. 2000. Diversity of soil fungi studied by PCR-RFLP of ITS.
Mycological Research. 104(9): 1027-1032.
Wagner T and Fischer M. 2002. Proceedings towards a natural classification of the
worldwide taxa Phellinus s.l. and Inonotus s.L, and phylogenetic relationships of allied
genera. The Mycological Society o f America 94(6): 998-1016.
Wang X-R. 1997. Genetic variability in the canker pathogen fungus, Gremmeniella abietina.
Contribution of sexual compared with asexual reproduction. Mycological Research.
101(10):1195-1201.
Wang X-R. and Szmidt A E. 2000. Population genetic analysis of pathogenic forest fungi. In:
Molecular Biology of Woody Plants, Volume 1, S. M. Jain and S. C. Minocha (eds). Kluwer
Academic Publisher, The Netherlands: 491-520.
Webster J. 1980. Introduction to the Fungi, 2"^ Ed. Cambridge University Press. New York.
Weir B. 1996. Genetic Data Analysis II. Sinaur Associates Inc. Sunderland MA. pp 445.
White TJ, Bruns TD, Lee SB, Taylor JW. 1990. Amplification and direct sequencing of
fungal ribosomal RNA Genes for phylogenetics, pp 315-322 In: PCR - Protocols and
Applications - A Laboratory Manual. Eds, Innis N, Gelfand D, Sninsky J and White T.
Academic Press, New York.
Whitney RD. 1962. Studies in forest pathology XXIV Polyporus tomentosus Fr. as a major
factor in stand opening disease of white spruce. Canadian Journal o f Botany 40:1631-1658.
--------- . 1963. Artificial infection of small spruce roots with Polyporus tomentosus.
Phytopathology. 53:441-43.
. 1964. Hardwoods as inoculum carriers for Polyporus tomentosus inoculations.
Phytopathology. 54:1484-85.

81

. 1966. Germination and inoculation tests with basidiospores of Polyporus tomentosus.
Canadian Journal o f Botany. 44:1333-1343.
. 1980. Polyporus tomentosus root and butt rot of trees in Canada. Proceedings o f the
5th International Conference on Problems o f Root and Butt Rot in Conifers. L. Dimitri
Kassel, Germany: lUFRO.
. 1993. Damage by Tomentosus Root Rot in white spruce plantations in Ontario, and
the effects of thinning on the disease. The Forestry Chronicle. 69(4):445-449.
. 1995. Root rotting fungi in white spruce, black spruce and balsam fir in northern
Ontario. Canadian Journal o f Forest Research. 25:1209-30.
. 2000. Forest Management Guide for Tomentosus Root Disease. Ontario Ministry of
Natural Resources: Science Development and Transfer.
Whitney RD and Boyhachuck WP. 1976. Pathogenicity of Polyporus tomentosus and P.
tomentosus var. circinatus on seedlings of 11 conifer species. Canadian Journal o f Forest
Research. 6:129-31.
. 1977. Variation of Polyporus tomentosus Fr. as a major factor in stand-opening
disease of white spruce. Canadian Journal o f Botany. 55:1389-98.
Worrall JJ. 1994. Population structure of Armillaria species in several forest types.
Mycologia. 86(3):401-407.
Worrall JJ and Harrington TC. 1988. Etiology of canopy gaps in spruce-fir forests at
Crawford Notch, New Hampshire. Canadian Journal o f Forest Research.\%\ 1463-1469.
Yeh FC, Yang RC and Boyle T. 1999. POPGENE v. 1.31: Microsoft Window-based
freeware for population genetic analysis user guide. Centre for International Eorestry
Research & the University of Alberta.
Zolan M and Pukkila P. 1986. Inheritance of DNA méthylation in Coprinus cinereus.
Molecular and Cellular Biology. 6:195-200

82

Table 1. Primer sequences for nuclear and mitochondrial markers used in species
identification and SSCP analysis.
Primer Name

Sequence (5’-3’)

IT 112.31ACT2501F

GTGAAATTGTGCGCGACATC

IT112.31ACT2700RC

AACACGCCGCAAGTCAAC

MS 1

CAGCAGTCAAGAATATTAGTCAATG

MS 2

GCTGATTATCGAATTAAATAA

ML 5

CTCGGCAAATTATCCTCATAAG

ML 6

CAGTAGAAGCTGCATAGGGTC

83

Length of
Amplified
Fragment
(bp)

Annealing
Temp.
(°C)

199

65

600

55

800

55

Table 2. Species composition by study site
Species Composition (%)
Site

Spruce

Sub-Alpine Fir

Douglas-fir

Other Conifer

Deciduous

U1

42.4

38.1

4.3

5.0

10.1

U2

57.8

3.9

38.3

0.0

0.0

U3

80.5

18.6

0.8

0.0

0.0

PI

99.2

0.0

0.0

0.8

0.0

P2

91.0

0.8

0.0

1.5

6.8

P3

83.5

0.0

0.0

2.20

14.3

84

Table 3. Study site characteristics

Site

Age

Area
(m")

Total stem
density
(stems/ha)**

Spruce
density
(stems/ha)'’

Total
basal area
(m^)/ha"

Spruce
basal area
(m^)/ha^

Average
spruce DBH*’
(cm), (SD)

U1

152

1396

824

350

72

44

35 (9)

U2

78

1455

1278

735

72

34

22 (7)

U3

80

1116

896

722

66

50

26 (9)

PI

33

891

1010

1001

23

23

15(5)

P2

32

680

1545

1452

34

33

15(4)

P3

27

405

1800

1504

18

13

9 (2 )

^includes all species in plot, live and standing dead
’ineludes live and standing dead spruce trees

85

Table 4. Sample Sizes and Number of Unique Genets Detected
Site

VC"

Molecular
Methods Pooled

All Methods
Pooled

No. of Multi Tree Genets

No. of Single Tree Genets

U1

11

6

6

7

2

5

U2

19

12

13

13

5

8

U3

31

12

18

21

9

12

PI

27

13

20

24

3

21

P2

24

11

18

19

3

16

P3

16

3

7

7

4

3

Total

128

57

82

91

26

65

‘Number of isolates identified as I. tomentosus by species verification tests.
Number of vegetative compatibility groups identified.

86

Table 5. Population genetic statistics in 107 isolates of Inonotus tomentosus detected with
RAPD analysis, n, sample size (no. of isolates); L, proportion of polymorphic loci; M,
average marker diversity; G, total number of genotypes; P, proportion of unique genotypes.
Site

n

L

M

G

P

U1

8

0.36

0.16

6

0.75

U2

17

0.71

0.23

13

0.76

U3

22

0.61

0.21

18

0.82

PI

22

0.71

0.25

20

0.91

P2

23

0.68

0.23

18

0.78

P3

15

0.50

0.20

7

0.47

87

Table 6. Frequency of alleles for Ms and Ml loci
M il

M12

M13

M14

M15

M16

10

0.67

-

-

-

-

0.33

0.17

15

0.38

0.25

0.12

0.25

-

-

0.50

0.50

22

0.57

0.14

0.14

-

0.14

-

25

0.89

0.11

25

0.89

0.11

-

-

-

-

P2

22

1.00

-

21

0.50

-

0.38

-

0.12

-

P3

16

1.00

-

15

0.33

-

0.67

-

-

-

Site

râ

M sl

Ms2

U1

9

1.00

-

U2

15

0.83

U3

22

PI

®Sample sizes for molecular markers differed based on ability to amplify each isolate with
associated primers.

88

Table 7. Frequency of alleles for actin locus.
Site

n

A1

A2

A3

A4

A5

A6

A7

A8

A9

AlO

A ll

U1

9

0.67

-

-

0.11

-

0.22

-

-

-

-

-

U2

17

0.12

0.50

-

0.29

-

-

0.09

-

-

-

-

U3

19

-

0.37

-

0.47

0.11

-

-

0.05

-

-

-

PI

23

0.27

0.39

-

0.16

-

0.04

-

0.05

-

0.09

-

P2

20

0.15

-

-

0.48

-

0.22

-

0.05

-

-

0.10

P3

15

0.13

-

0.03

-

-

0.13

0.67

-

0.03

-

-

89

Table 8. Tests for deviation from Hardy-Weinberg Equilibrium in the actin marker. H zq .
observed heterozygosity; Hzg. expected heterozygosity.

All Individuals

Only Unique Genotypes

Site

n

Hzo

HZe

p-value

n

Hzo

HZe

p-value

U1

9

0.667

0.529

0.611

6

0.667

0.600

0.954

U2

17

0.412

0.661

<0.001

13

0.500

0.700

0.008

U3

19

0.737

0.643

<0.001

18

0.429

0.648

0.010

PI

23

0.273

0.753

<0.001

20

0.286

0.857

0.003

P2

20

0.450

0.706

<0.001

18

0.250

0.825

<0.001

P3

15

0.333

0.536

<0.001

7

0.667

0.933

0.285

90

Table 9. Analysis of molecular variance (AMOVA) of clone-corrected RAPD data describing
genetic variance at three spatial scales. Statistical significance of variance components were
determined by comparison to 1000 random permutations (SS sum of squares; MS mean
square).
Source of Variation

(df)

SS

MS

Variance
Component

% Total
Variance

p-value

Between stand types

1

28.86

28.86

0.08

1.66

0.16 (NS)

Between study sites

4

85.26

21.32

1.41

28.44

<0.001

Between individuals

76

263.83

3.47

3.47

69.89

<0.001

within study sites

91

Table 10. Observed and expected genotypic diversity in all stand types. Go is the observed
genotypic diversity; G q/G e is the observed to expected genotypic diversity
Pop.

n“

N"

# loci

Go

Ge

Go/ G e

p-value

U1

8

6

10

5.33

7.73

0.69

0.015

U2

17

12

20

9.63

16.96

0.57

<0.001

U3

22

18

18

15.21

20.84

0.73

0.002

PI

22

20

20

18.62

21.94

0.85

0.003

P2

23

18

19

14.3

22.79

0.63

<0.001

P3

15

7

14

3.69

13.86

0.27

<0.001

®Number of isolates analyzed.
^ Number of genotypes identified using RAPDs only.

92

Table 11. Tests of random association among pairs of markers (linked loci) calculated with
Arlequin v. 2.000 and Index of Association (Ia) values calculated with MULTILOCUS v.
1.3h for RAPD data. A p-value < 0.05 means that the calculated value of Ia (observed
number of mismatches in allele frequencies) differs significantly from 0 (the value for a
population that is randomly mating), therefore there is significant linkage disequilibrium
detected.
Only Unique Genotypes

All Individuals
n*

No. of pairs of
markers in
linkage
disequilibrium

1a^

<0.001

6

I (2.2%)

0.107

0.020

0.059

< 0.001

13

23(I2.1<%)

0.022

0.045

28(!& 3% f)

0.082

<0.001

18

28 (18.3%)

0.071

<0.001

22

29(15.3%")

0.019

0.010

20

25(13.1% )

0.017

0.020

171

23

55 (32.1%")

0.123

<0.001

18

28 (16.3%)

0.069

< 0.001

91

15

26 (28.6%")

0.314

<0.001

7

8 (8.8%)

0.173

<0.001

Site

Total
no. of
pairs
markers

U1

45

U2

No. of pairs of
markers in
linkage
disequilibrium

L'

8

8 (17.8%")

0.185

190

17

39 (20.5%")

U3

153

22

PI

190

P2
P3

^ Number of isolates analyzed.
'’ Proportion of linked loci based on 95% confidence limit.
^ Index of Association value.
^ Probability value for test statistic Ia.

93

Table 12. Number of trees infected and distance between host trees as indicators of
clone size.
Number
of
Multi­
tree
Genets

Minimum
Clone
Size by
Tree
Count

Maximum
Clone
Size by
Tree
Count

Average
Clone Size
by Distance
(m)"(SD)

0.00.9 m

1.01.9 m

2.02.9 m

3.04.9 m

5.09.9 m

U1

2

2

4

8.4 (1.8)

-

-

-

-

2

U2

5

2

3

3.2 (0.8)

-

-

3

2

-

-

U3

9

2

3

5.1 (3.6)

1

1

-

2

4

1

PI

3

2

2

2.6 (1.4)

1

-

1

-

-

-

P2

3

2

3

3.8 (1.6)

-

1

-

1

1

-

P3

4

2

7

4 J (3 j)

-

1

1

1

-

1

Site

Number of Genets by Distance
Class

“ Measured as the maximum distance (in meters) between the most distant trees infected by
the same fungal genet, averaged for all the genets within each site.

94

10.0-1m

U,2

7? ' " -

PI

Tmm = 1km

Figure 1. Location of field study sites. Circles are plantations and stars are unmanaged forests.
Map of BC from EC Ministry of Sustainable Resource Management website
(http://srmwww.gov.bc.ca/bmgs/2mil/bcmap.gif).

95

Figure 2. Examples of chlamydospore-like structures for identification of I. tomentosus.
Structures on the hyphae of I. tomentosus, indicated with arrows (a); hyphae of Phellinus pini
(b), which lack chlamydospore-like structures. Viewed at lOOOx magnification. (Photos taken
by Jennifer Russell)

96

lKb+ 1 2

3

4

5

6

7

8

9

10 11

12 13 14 15 16 17 18 lKb+

lKb+ 19 20 21 22 23 24 25 26

27

28 29 30 31 32 33

34

35 36 lKb+

Figure 3. Examples of RAPD banding on agarose gels. Patterns generated by primer OPA-13,
run with 1 Kb+ ladder (Invitrogen teehnologies). Lanes 1-10 are isolates from site U l, Lanes
11-18 are isolates from site U2, and lanes 19-36 are isolates from site P2.

97

35
30
T3
g 25
.B

20
P
15
ex

10

Ul

U2

U3

PI

P2

P3

Study Site

Figure 4. Infeetion of spruce by Inonotus tomentosus. White bars indicate proportion of
spruce from which I. tomentosus was successfully isolated and identified. Black bars indicate
proportion of spruce that were diagnosed as infected with TRR in the field. U1-U3 are
unmanaged sites, P1-P3 are plantation sites.

98

Figure 5. Examples of vegetative compatibility reactions. Incompatible reaction (3) between
two isolates (a); a compatible reaction (0) between isolates (b). The white fluffy mycelia in
the upper part of Petri plate in 3b is an example of sectoring^.

^ Sectoring is defined by Kirk et al. (2001) as mutation or selection in plate cultures resulting
in one or more cultures having a changed form of growth.
99

U1
U2
U3
P1
P2
P3

0.02
Figure 6. UPGMA tree generated with RAPD marker data (using only unique genotypes).
Tree generated using POPGENE v.1.32, algorithm based on Nei’s (1978) unbiased genetic
distance. U1-U3 are unmanaged sites, P1-P3 are plantation sites.

100

Ul

U2

U3

PI

P2

P3

Study Site
Figure 7. Number of genets per 10 m of plot area detected using RAPD, SSCP and VC
testing. Bars indicate number of genets by area (left axis), points indicate sample size (right
axis). U1-U3 are unmanaged sites, P1-P3 are plantation sites.

101

<

16.0

35

14.0

30

12.0

13
25 S

% 10.0
m
X
8.0
"'B

20

15 M
q-i
O

6.0

(U
Ü
d 4.0

2.0
0.0

I
I

10

□
Ul

U2

PI

U3

P2

P3

Figure 8. Number of genets per m of spruce basal area in relation to number of isolates
sampled. Bars indicate number of genets per m^ of spruce basal area of spruce (left axis),
points indicate sample size per site (right axis). U1-U3 are unmanaged sites, P1-P3 are
plantation sites.

102

100
90
80

I
3

B
0

1

70
60
□ Multi-tree
Genets

50
40

■ Single-tree
Genets

30

20
10
0
Ul

U2

U3

PI

P2

P3

Study Site

Figure 9. Frequency of single- and multi-tree genets by study plot based on pooled count of
genets. U1-U3 are unmanaged sites, P1-P3 are plantation sites.

103

100
90

Ig
fî
;

80
□ Multi-tree
Genets

70
60

■ Single-tree
Genets

50
40
30

20

I

10

Ul

U2

U3

PI

P2

P3

Study Site

Figure 10. Proportion of basal area colonized by single and multi-tree genets. U1-U3 are
unmanaged sites, P1-P3 are plantation sites.

104

□ Multi-tree
Genets

I Single-tree
Genets

I Healthy
Trees

Ul

U2

U3

PI

P2

P3

Study Site

Figure 11. Comparison of average DBH of spruce trees infected by single-tree or multi-tree
genets and of uninfected trees. Error bars represent standard deviation of DBH for all spruce
in plot. U1-U3 are unmanaged sites, P1-P3 are plantation sites

105

o Healthy Spruce Trees
o

Infected Spruce Trees

X Other Species

5m
Appendix V. Plantation Study Site 2. Grey areas indicate genets as identified by RAPD and actin
markers, hatched areas indicate vegetative compatibility groups and dashed lines indicate genets that
share the same mitochondrial markers. Italicised numbers indicate Ms:Ml mt-haplotype.

yrniN.
«11:3%
o Healthy Spruce Trees
o
<1

• Infected Spruce Trees

X Other Species

5m
Appendix IV. Plantation Study Site 1. Grey areas indicate genets as identified by RAPD and actin
markers, hatched areas indicate vegetative compatibility groups and dashed lines indicate genets that
share the same mitochondrial markers. Italicised numbers indicate Ms:Ml mt-haplotype.

O Healthy Spruce Trees

ooo

Infected Spruce Trees

X Other Species

5m
Appendix HI. Unmanaged Study Site 3. Grey areas indicate genets as identified by RAPD and actin
markers, hatched areas indicate vegetative compatibility groups and dashed lines indicate genets that share
the same mitochondrial markers. Italicised numbers indicate Ms:Ml mt-haplotype.

o Healthy Spruce Trees
o

4:1 1:1

"0< X

• Infected Spruce Trees

X Other Species

5m
Appendix H. Unmanaged Study Site 2. Grey areas indicate genets as identified by RAPD and actin
markers, hatched areas indicate vegetative compatibility groups and dashed lines indicate genets that
share the same mitochondrial markers. Italicised numbers indicate Ms:Ml mt-haplotype.

o Healthy Spruce Trees

• Infected Spruce Trees

X Other Tree Species

Appendix I. Unmanaged Study Site 1. Grey areas indicate genets as identified by RAPD and actin
markers, hatched areas indicate vegetative compatibility groups and dashed lines indicate genets that
share the same mitochondrial markers. Italicised numbers indicate Ms:Ml mt-haplotype.

o Healthy Spruce Trees

• Infected Spruce Trees

X Other Species

5m
Appendix VI. Plantation Study Site 3. Grey areas indicate genets as identified by RAPD and actin
markers, hatched areas indicate vegetative compatibility groups and dashed lines indicate genets that
share the same mitochondrial markers. Italicised numbers indicate Ms:Ml mt-haplotype.